ID: 966693704

View in Genome Browser
Species Human (GRCh38)
Location 3:182767565-182767587
Sequence CAGGCATGAGCCACCGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693702_966693704 -5 Left 966693702 3:182767547-182767569 CCCAAAGTGTTGGGATTACAGGC No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693692_966693704 22 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693703_966693704 -6 Left 966693703 3:182767548-182767570 CCAAAGTGTTGGGATTACAGGCA No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693694_966693704 11 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693700_966693704 -2 Left 966693700 3:182767544-182767566 CCTCCCAAAGTGTTGGGATTACA No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693698_966693704 4 Left 966693698 3:182767538-182767560 CCTTGGCCTCCCAAAGTGTTGGG No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693696_966693704 7 Left 966693696 3:182767535-182767557 CCACCTTGGCCTCCCAAAGTGTT No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693695_966693704 8 Left 966693695 3:182767534-182767556 CCCACCTTGGCCTCCCAAAGTGT No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693691_966693704 27 Left 966693691 3:182767515-182767537 CCTGACCTCAGGTGATCCACCCA No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693704 Original CRISPR CAGGCATGAGCCACCGCGCC CGG Intergenic