ID: 966693704

View in Genome Browser
Species Human (GRCh38)
Location 3:182767565-182767587
Sequence CAGGCATGAGCCACCGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516338
Summary {0: 7065, 1: 55609, 2: 120140, 3: 162711, 4: 170813}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693700_966693704 -2 Left 966693700 3:182767544-182767566 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693703_966693704 -6 Left 966693703 3:182767548-182767570 CCAAAGTGTTGGGATTACAGGCA 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693696_966693704 7 Left 966693696 3:182767535-182767557 CCACCTTGGCCTCCCAAAGTGTT 0: 4221
1: 66343
2: 155330
3: 159343
4: 92549
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693702_966693704 -5 Left 966693702 3:182767547-182767569 CCCAAAGTGTTGGGATTACAGGC 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693692_966693704 22 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG 0: 4668
1: 19931
2: 47709
3: 74326
4: 87194
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693691_966693704 27 Left 966693691 3:182767515-182767537 CCTGACCTCAGGTGATCCACCCA 0: 15131
1: 42916
2: 78223
3: 96454
4: 105535
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693694_966693704 11 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693698_966693704 4 Left 966693698 3:182767538-182767560 CCTTGGCCTCCCAAAGTGTTGGG 0: 6346
1: 95043
2: 216067
3: 233638
4: 146425
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693695_966693704 8 Left 966693695 3:182767534-182767556 CCCACCTTGGCCTCCCAAAGTGT 0: 2536
1: 40105
2: 146028
3: 241222
4: 211356
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693704 Original CRISPR CAGGCATGAGCCACCGCGCC CGG Intergenic
Too many off-targets to display for this crispr