ID: 966693707

View in Genome Browser
Species Human (GRCh38)
Location 3:182767578-182767600
Sequence CCGCGCCCGGCCTATGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693694_966693707 24 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693700_966693707 11 Left 966693700 3:182767544-182767566 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693702_966693707 8 Left 966693702 3:182767547-182767569 CCCAAAGTGTTGGGATTACAGGC 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693696_966693707 20 Left 966693696 3:182767535-182767557 CCACCTTGGCCTCCCAAAGTGTT 0: 4221
1: 66343
2: 155330
3: 159343
4: 92549
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693695_966693707 21 Left 966693695 3:182767534-182767556 CCCACCTTGGCCTCCCAAAGTGT 0: 2536
1: 40105
2: 146028
3: 241222
4: 211356
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693703_966693707 7 Left 966693703 3:182767548-182767570 CCAAAGTGTTGGGATTACAGGCA 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693698_966693707 17 Left 966693698 3:182767538-182767560 CCTTGGCCTCCCAAAGTGTTGGG 0: 6346
1: 95043
2: 216067
3: 233638
4: 146425
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693707 Original CRISPR CCGCGCCCGGCCTATGAAAT AGG Intergenic
No off target data available for this crispr