ID: 966693711

View in Genome Browser
Species Human (GRCh38)
Location 3:182767597-182767619
Sequence TAGGTACTCATTTTCAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693700_966693711 30 Left 966693700 3:182767544-182767566 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data
966693702_966693711 27 Left 966693702 3:182767547-182767569 CCCAAAGTGTTGGGATTACAGGC 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data
966693709_966693711 -10 Left 966693709 3:182767584-182767606 CCGGCCTATGAAATAGGTACTCA No data
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data
966693708_966693711 -9 Left 966693708 3:182767583-182767605 CCCGGCCTATGAAATAGGTACTC No data
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data
966693703_966693711 26 Left 966693703 3:182767548-182767570 CCAAAGTGTTGGGATTACAGGCA 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data
966693705_966693711 -1 Left 966693705 3:182767575-182767597 CCACCGCGCCCGGCCTATGAAAT No data
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data
966693706_966693711 -4 Left 966693706 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693711 Original CRISPR TAGGTACTCATTTTCAGTTA AGG Intergenic
No off target data available for this crispr