ID: 966695055

View in Genome Browser
Species Human (GRCh38)
Location 3:182780989-182781011
Sequence AGCAGGTGCTCCCAACATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695055_966695060 14 Left 966695055 3:182780989-182781011 CCTCGATGTTGGGAGCACCTGCT No data
Right 966695060 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
966695055_966695062 20 Left 966695055 3:182780989-182781011 CCTCGATGTTGGGAGCACCTGCT No data
Right 966695062 3:182781032-182781054 AGTTTCAGAATTTGAGGACAAGG No data
966695055_966695063 26 Left 966695055 3:182780989-182781011 CCTCGATGTTGGGAGCACCTGCT No data
Right 966695063 3:182781038-182781060 AGAATTTGAGGACAAGGTTGAGG No data
966695055_966695064 27 Left 966695055 3:182780989-182781011 CCTCGATGTTGGGAGCACCTGCT No data
Right 966695064 3:182781039-182781061 GAATTTGAGGACAAGGTTGAGGG No data
966695055_966695065 28 Left 966695055 3:182780989-182781011 CCTCGATGTTGGGAGCACCTGCT No data
Right 966695065 3:182781040-182781062 AATTTGAGGACAAGGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695055 Original CRISPR AGCAGGTGCTCCCAACATCG AGG (reversed) Intergenic
No off target data available for this crispr