ID: 966695058

View in Genome Browser
Species Human (GRCh38)
Location 3:182781016-182781038
Sequence TGAAACTAAAGGGTTAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695058_966695068 28 Left 966695058 3:182781016-182781038 CCAGTGTTAACCCTTTAGTTTCA No data
Right 966695068 3:182781067-182781089 CAGGAGAAGAGTTGAGCCACTGG No data
966695058_966695062 -7 Left 966695058 3:182781016-182781038 CCAGTGTTAACCCTTTAGTTTCA No data
Right 966695062 3:182781032-182781054 AGTTTCAGAATTTGAGGACAAGG No data
966695058_966695063 -1 Left 966695058 3:182781016-182781038 CCAGTGTTAACCCTTTAGTTTCA No data
Right 966695063 3:182781038-182781060 AGAATTTGAGGACAAGGTTGAGG No data
966695058_966695064 0 Left 966695058 3:182781016-182781038 CCAGTGTTAACCCTTTAGTTTCA No data
Right 966695064 3:182781039-182781061 GAATTTGAGGACAAGGTTGAGGG No data
966695058_966695066 9 Left 966695058 3:182781016-182781038 CCAGTGTTAACCCTTTAGTTTCA No data
Right 966695066 3:182781048-182781070 GACAAGGTTGAGGGGTCCGCAGG No data
966695058_966695065 1 Left 966695058 3:182781016-182781038 CCAGTGTTAACCCTTTAGTTTCA No data
Right 966695065 3:182781040-182781062 AATTTGAGGACAAGGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695058 Original CRISPR TGAAACTAAAGGGTTAACAC TGG (reversed) Intergenic
No off target data available for this crispr