ID: 966695059

View in Genome Browser
Species Human (GRCh38)
Location 3:182781026-182781048
Sequence CCTCAAATTCTGAAACTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695059_966695065 -9 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695065 3:182781040-182781062 AATTTGAGGACAAGGTTGAGGGG No data
966695059_966695068 18 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695068 3:182781067-182781089 CAGGAGAAGAGTTGAGCCACTGG No data
966695059_966695066 -1 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695066 3:182781048-182781070 GACAAGGTTGAGGGGTCCGCAGG No data
966695059_966695064 -10 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695064 3:182781039-182781061 GAATTTGAGGACAAGGTTGAGGG No data
966695059_966695070 28 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695070 3:182781077-182781099 GTTGAGCCACTGGAGATATAGGG No data
966695059_966695069 27 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695069 3:182781076-182781098 AGTTGAGCCACTGGAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695059 Original CRISPR CCTCAAATTCTGAAACTAAA GGG (reversed) Intergenic
No off target data available for this crispr