ID: 966695061

View in Genome Browser
Species Human (GRCh38)
Location 3:182781027-182781049
Sequence TCCTCAAATTCTGAAACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695061_966695070 27 Left 966695061 3:182781027-182781049 CCTTTAGTTTCAGAATTTGAGGA No data
Right 966695070 3:182781077-182781099 GTTGAGCCACTGGAGATATAGGG No data
966695061_966695065 -10 Left 966695061 3:182781027-182781049 CCTTTAGTTTCAGAATTTGAGGA No data
Right 966695065 3:182781040-182781062 AATTTGAGGACAAGGTTGAGGGG No data
966695061_966695068 17 Left 966695061 3:182781027-182781049 CCTTTAGTTTCAGAATTTGAGGA No data
Right 966695068 3:182781067-182781089 CAGGAGAAGAGTTGAGCCACTGG No data
966695061_966695066 -2 Left 966695061 3:182781027-182781049 CCTTTAGTTTCAGAATTTGAGGA No data
Right 966695066 3:182781048-182781070 GACAAGGTTGAGGGGTCCGCAGG No data
966695061_966695069 26 Left 966695061 3:182781027-182781049 CCTTTAGTTTCAGAATTTGAGGA No data
Right 966695069 3:182781076-182781098 AGTTGAGCCACTGGAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695061 Original CRISPR TCCTCAAATTCTGAAACTAA AGG (reversed) Intergenic
No off target data available for this crispr