ID: 966695062

View in Genome Browser
Species Human (GRCh38)
Location 3:182781032-182781054
Sequence AGTTTCAGAATTTGAGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695058_966695062 -7 Left 966695058 3:182781016-182781038 CCAGTGTTAACCCTTTAGTTTCA No data
Right 966695062 3:182781032-182781054 AGTTTCAGAATTTGAGGACAAGG No data
966695057_966695062 -6 Left 966695057 3:182781015-182781037 CCCAGTGTTAACCCTTTAGTTTC No data
Right 966695062 3:182781032-182781054 AGTTTCAGAATTTGAGGACAAGG No data
966695055_966695062 20 Left 966695055 3:182780989-182781011 CCTCGATGTTGGGAGCACCTGCT No data
Right 966695062 3:182781032-182781054 AGTTTCAGAATTTGAGGACAAGG No data
966695056_966695062 3 Left 966695056 3:182781006-182781028 CCTGCTGTGCCCAGTGTTAACCC No data
Right 966695062 3:182781032-182781054 AGTTTCAGAATTTGAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695062 Original CRISPR AGTTTCAGAATTTGAGGACA AGG Intergenic
No off target data available for this crispr