ID: 966695064

View in Genome Browser
Species Human (GRCh38)
Location 3:182781039-182781061
Sequence GAATTTGAGGACAAGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695055_966695064 27 Left 966695055 3:182780989-182781011 CCTCGATGTTGGGAGCACCTGCT No data
Right 966695064 3:182781039-182781061 GAATTTGAGGACAAGGTTGAGGG No data
966695058_966695064 0 Left 966695058 3:182781016-182781038 CCAGTGTTAACCCTTTAGTTTCA No data
Right 966695064 3:182781039-182781061 GAATTTGAGGACAAGGTTGAGGG No data
966695056_966695064 10 Left 966695056 3:182781006-182781028 CCTGCTGTGCCCAGTGTTAACCC No data
Right 966695064 3:182781039-182781061 GAATTTGAGGACAAGGTTGAGGG No data
966695059_966695064 -10 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695064 3:182781039-182781061 GAATTTGAGGACAAGGTTGAGGG No data
966695057_966695064 1 Left 966695057 3:182781015-182781037 CCCAGTGTTAACCCTTTAGTTTC No data
Right 966695064 3:182781039-182781061 GAATTTGAGGACAAGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695064 Original CRISPR GAATTTGAGGACAAGGTTGA GGG Intergenic
No off target data available for this crispr