ID: 966695067

View in Genome Browser
Species Human (GRCh38)
Location 3:182781064-182781086
Sequence GTGGCTCAACTCTTCTCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695067_966695071 -5 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695071 3:182781082-182781104 GCCACTGGAGATATAGGGTGTGG No data
966695067_966695078 21 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695078 3:182781108-182781130 GGAGGATACTTGGGGAACTCAGG No data
966695067_966695077 13 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695077 3:182781100-182781122 TGTGGTATGGAGGATACTTGGGG No data
966695067_966695075 11 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695075 3:182781098-182781120 GGTGTGGTATGGAGGATACTTGG No data
966695067_966695074 3 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695074 3:182781090-182781112 AGATATAGGGTGTGGTATGGAGG No data
966695067_966695070 -10 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695070 3:182781077-182781099 GTTGAGCCACTGGAGATATAGGG No data
966695067_966695073 0 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695073 3:182781087-182781109 TGGAGATATAGGGTGTGGTATGG No data
966695067_966695076 12 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695076 3:182781099-182781121 GTGTGGTATGGAGGATACTTGGG No data
966695067_966695079 22 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695079 3:182781109-182781131 GAGGATACTTGGGGAACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695067 Original CRISPR GTGGCTCAACTCTTCTCCTG CGG (reversed) Intergenic
No off target data available for this crispr