ID: 966695069

View in Genome Browser
Species Human (GRCh38)
Location 3:182781076-182781098
Sequence AGTTGAGCCACTGGAGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695061_966695069 26 Left 966695061 3:182781027-182781049 CCTTTAGTTTCAGAATTTGAGGA No data
Right 966695069 3:182781076-182781098 AGTTGAGCCACTGGAGATATAGG No data
966695059_966695069 27 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695069 3:182781076-182781098 AGTTGAGCCACTGGAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695069 Original CRISPR AGTTGAGCCACTGGAGATAT AGG Intergenic
No off target data available for this crispr