ID: 966695070

View in Genome Browser
Species Human (GRCh38)
Location 3:182781077-182781099
Sequence GTTGAGCCACTGGAGATATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966695061_966695070 27 Left 966695061 3:182781027-182781049 CCTTTAGTTTCAGAATTTGAGGA No data
Right 966695070 3:182781077-182781099 GTTGAGCCACTGGAGATATAGGG No data
966695059_966695070 28 Left 966695059 3:182781026-182781048 CCCTTTAGTTTCAGAATTTGAGG No data
Right 966695070 3:182781077-182781099 GTTGAGCCACTGGAGATATAGGG No data
966695067_966695070 -10 Left 966695067 3:182781064-182781086 CCGCAGGAGAAGAGTTGAGCCAC No data
Right 966695070 3:182781077-182781099 GTTGAGCCACTGGAGATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966695070 Original CRISPR GTTGAGCCACTGGAGATATA GGG Intergenic
No off target data available for this crispr