ID: 966696278

View in Genome Browser
Species Human (GRCh38)
Location 3:182793513-182793535
Sequence GGTGGCTGCGGCGCGGCGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 510}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966696278 Original CRISPR GGTGGCTGCGGCGCGGCGGC AGG Exonic
900092194 1:925340-925362 GGAGGCTGCGGGGCGGCGCGGGG + Intronic
900113522 1:1019551-1019573 GGGAGCTGCGGCGCGGAGGCGGG - Intergenic
900171992 1:1273794-1273816 GGCGGCGGCGGCGCTGCGGCGGG - Exonic
900269146 1:1778346-1778368 GCTGGCGGCGGCGCGGCGGCGGG - Intronic
900362025 1:2293743-2293765 GGTGGCTGCTGCCCGGCCTCTGG + Intronic
900393542 1:2443985-2444007 GTTGGCAGCGGCGCAGCGGCAGG - Intronic
900698434 1:4027615-4027637 GGTGGCTGCGGTGATGCAGCCGG - Intergenic
900996946 1:6127936-6127958 GCTGGCTGCGGCGGGAGGGCGGG + Intronic
901045518 1:6393488-6393510 GGTGGGGCCGGCGCGGGGGCGGG - Intronic
901109773 1:6785440-6785462 GGCGGGTGCGCGGCGGCGGCGGG + Exonic
902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG + Intronic
902690578 1:18108092-18108114 GGCGGCGGTGGCGGGGCGGCGGG - Exonic
902896934 1:19485560-19485582 GGTGGCGGCGGCCCGGCGCGGGG - Intergenic
902916701 1:19644143-19644165 GGAGGGGGCGCCGCGGCGGCAGG - Intronic
903476017 1:23619640-23619662 GGTGGCGGCGTCGGCGCGGCGGG + Intronic
903907168 1:26695812-26695834 CGAGGCTGCTGCGCGGCAGCGGG - Intergenic
903950620 1:26994048-26994070 GGGGGCTCTGGCGCGGCTGCGGG + Exonic
904031653 1:27536962-27536984 GGTGCCTGCGGCCAGGCAGCAGG + Intronic
904199782 1:28812259-28812281 GGCGGCCGGGGCGCGGCAGCCGG + Exonic
904215400 1:28914781-28914803 GGCGGCGGCGGCGCGGGAGCCGG + Intronic
905399873 1:37693221-37693243 GGTGGTTGGGGGGCGGCGGGCGG + Intronic
905449323 1:38046755-38046777 GGCGGCGGCGGCGCGGCGCAGGG - Exonic
905569352 1:38991501-38991523 GGCGGCGGCGGCTCGGCGTCCGG - Exonic
905580774 1:39081633-39081655 GGGAGCTGGGGCGCGGCCGCCGG - Intronic
905653586 1:39672090-39672112 GGTGGCTGGGGCTGGGCTGCAGG + Intergenic
906356934 1:45115252-45115274 GGTGGCTGCCGGGCGGGGGCGGG + Intronic
906640674 1:47438865-47438887 CGTGGCGGGGCCGCGGCGGCGGG + Exonic
907364099 1:53945746-53945768 GGTGGCCGCGGCGAAGGGGCGGG - Exonic
910777881 1:90893855-90893877 GGCGACTGGGGCGCTGCGGCGGG - Intergenic
910935097 1:92480848-92480870 GCTGCCGGCGGCGCGGGGGCCGG - Exonic
911072979 1:93847005-93847027 GCTGGGTCGGGCGCGGCGGCCGG + Intronic
911633988 1:100213392-100213414 GGCGGCTGCGGGGGCGCGGCGGG - Intronic
912798625 1:112707232-112707254 GGTGGCTGCGGCCCTGCGCGGGG - Intronic
913653799 1:120942561-120942583 TGAGGCTGCGGCGGGGCGGAGGG + Intergenic
914197408 1:145454631-145454653 GGCGGCTGCGGCGGTGGGGCCGG - Intergenic
914519491 1:148402676-148402698 TGAGGCTGCGGCGGGGCGGAGGG + Intergenic
914643993 1:149636727-149636749 TGAGGCTGCGGCGGGGCGGAGGG + Intergenic
914718317 1:150269027-150269049 GGTGGCCGTGGGGCTGCGGCCGG - Intronic
915463201 1:156081760-156081782 GCCGGCTGCGGGGGGGCGGCCGG + Exonic
916211762 1:162365433-162365455 TGAGGCTGCGGCGCGGCTGGAGG + Exonic
916438313 1:164797324-164797346 GGAGGCTGCAGCCCGGCGGGAGG + Intronic
916890296 1:169106768-169106790 GGTGGCTGCGGCGCGCGCCCTGG - Exonic
919463190 1:197902701-197902723 GCTGGCGGCGGGGCGGCGGAAGG - Exonic
919795524 1:201319343-201319365 GGTGGGTGTGGAGGGGCGGCTGG + Intronic
919861141 1:201740140-201740162 GGGGGCTGCGGCGGGGCTGGGGG - Intronic
919892101 1:201982930-201982952 GACGGCGGCGGCGCTGCGGCGGG + Exonic
920234673 1:204494786-204494808 GGCGGATTCGGCGCTGCGGCTGG - Intergenic
920528485 1:206685278-206685300 GGGGGCTGCGGCGGCGGGGCCGG - Exonic
921207062 1:212858248-212858270 GGTGACTGCCGCGCGGCGCGGGG + Exonic
922243968 1:223776995-223777017 GGTGGCGGCGGGGGGGCGGGGGG - Intergenic
922422261 1:225467877-225467899 GGTGGCTGCAGGGCAGCGCCAGG + Intergenic
922513139 1:226186450-226186472 GGCGGAGGAGGCGCGGCGGCTGG - Exonic
922766397 1:228158683-228158705 GGGGGCCGCGGCGCGGGGGCGGG - Exonic
924801420 1:247331712-247331734 GGAGGCGGCGCCGCGGAGGCCGG + Exonic
1062843779 10:689671-689693 GGAGGCGGCGGCGCGGGCGCGGG + Intronic
1065140531 10:22714654-22714676 GGCGGCTGCGGCGCCGCGGGCGG + Intergenic
1066464407 10:35640354-35640376 GGCGCGGGCGGCGCGGCGGCGGG - Exonic
1067711844 10:48656286-48656308 GGGGGATGCGGCGCAGCGGGCGG + Intergenic
1068637397 10:59362679-59362701 GCTGGGCGGGGCGCGGCGGCGGG + Intronic
1069386176 10:67884931-67884953 GGCGGCGGCGGCGCTGTGGCGGG + Exonic
1069486780 10:68828392-68828414 GGGGGCTGCGGTTGGGCGGCCGG + Intronic
1069767989 10:70878061-70878083 GGAGGCTGAGGCGGGGGGGCGGG - Exonic
1069850010 10:71398178-71398200 GGTCGCAGTGGGGCGGCGGCTGG - Intronic
1070162273 10:73873835-73873857 TGAGGCTGCGGCGCGGCTCCCGG + Intronic
1070768474 10:79069445-79069467 GGGGGCCGAGGCCCGGCGGCCGG + Intronic
1070877196 10:79825797-79825819 GGAGGGGGCGGCGGGGCGGCGGG + Intergenic
1070923019 10:80200790-80200812 GGAGGCTGAGGCGGGGCGGGGGG + Intronic
1071618084 10:87094639-87094661 CCCGGCTGCGGGGCGGCGGCGGG + Exonic
1071643692 10:87341841-87341863 GGAGGGGGCGGCGGGGCGGCGGG + Intergenic
1072102207 10:92239824-92239846 GCCGGCTGCGGCGCGGGCGCAGG + Exonic
1072650625 10:97292412-97292434 GGGGGCTGAGGCGCGGGGGTCGG - Intronic
1073290057 10:102409099-102409121 GGGGGCCGCGGCGCGCCGGCCGG - Intronic
1075724898 10:124606146-124606168 GGCGCCTGCGGGGCGGCTGCGGG - Intronic
1075748488 10:124744231-124744253 GGCGGCTCCGCGGCGGCGGCGGG - Intronic
1076022875 10:127089029-127089051 GGTGGCTGCGGCATGGCTGCGGG - Intronic
1076035532 10:127196221-127196243 GCGAGCTGCGGCGCGGGGGCCGG - Intronic
1076149356 10:128150074-128150096 GGGCGCTGCGGGGCGCCGGCTGG - Intergenic
1077025615 11:438626-438648 GGTGGCTGTGGCCCGGGGGATGG - Intronic
1077049555 11:560690-560712 GGTGGCTGCGGCCCGCGGGCAGG - Exonic
1077054547 11:584563-584585 GGTGGCTGGGCAGAGGCGGCAGG + Intronic
1077080345 11:722165-722187 GGTGCCTGGGGCCGGGCGGCAGG + Exonic
1077089475 11:771925-771947 GGTGGCTGCTGTGCGGAGGCTGG - Intronic
1077140158 11:1020710-1020732 GGTGGCTGCGGCGTGGTGGGCGG + Exonic
1077154564 11:1085622-1085644 GGTGGCTGGGGAGGGGTGGCCGG - Intergenic
1077299602 11:1840915-1840937 GGTGGCGGCGGGCCGGCGGCAGG + Intronic
1077920756 11:6640323-6640345 GGTGTGTGTGGCTCGGCGGCTGG - Exonic
1077962383 11:7089405-7089427 CGCGGCTGCGGGGAGGCGGCGGG - Exonic
1078514277 11:12009150-12009172 GGTGGGTGAGGGGCGGCGGCGGG - Intronic
1081488335 11:43548141-43548163 GGTGGCAGCGCCGCGCCTGCAGG - Intergenic
1081620827 11:44618373-44618395 GGGGGCTGCGGATCGGGGGCGGG + Intronic
1081831908 11:46121532-46121554 GGCGGCGGCGGCGGGCCGGCGGG - Intergenic
1081938138 11:46918595-46918617 CGGGGCTGCGGCGCGGGGGGCGG - Exonic
1082028736 11:47590155-47590177 GGCGACTTCGACGCGGCGGCCGG - Exonic
1082064722 11:47890752-47890774 GGAGGCTGGGGCGGGGTGGCGGG + Intergenic
1083747711 11:64744862-64744884 GGGGGCGGGGGCGGGGCGGCGGG - Intronic
1083752092 11:64766438-64766460 GGTGGCGGCGGCTGGGCGGAGGG - Intronic
1083766463 11:64843756-64843778 GGGGGCTGTGGCGCCGGGGCCGG - Intronic
1083822610 11:65181652-65181674 GGGGGCTGGGGCGCGGCGGAAGG - Exonic
1083869366 11:65477494-65477516 CGTGGCCCCGGCGCGGGGGCAGG + Intergenic
1083970448 11:66070852-66070874 GGAGGGTGCGGCGGGGCGCCGGG + Intronic
1084070213 11:66728614-66728636 GGTGGCTGGGGGTCGGCAGCCGG - Intronic
1084296024 11:68213759-68213781 CGTGGAAGCGCCGCGGCGGCTGG - Intronic
1085044001 11:73343087-73343109 GGTGGCGGCGGGGCGGGGGGCGG - Intronic
1085332960 11:75668230-75668252 GGTGGCTGCGGCGGGGCGCCCGG + Exonic
1086993446 11:93330651-93330673 GGCGGCGGGAGCGCGGCGGCGGG + Intronic
1087014545 11:93542993-93543015 GGTTGCTGCGGGGCGGGGGCTGG - Intronic
1088462063 11:110092908-110092930 GGTGGCTGCGGGCGGGCGGGCGG + Intergenic
1088522141 11:110711936-110711958 GGAGGCGGCGGCGCTGCCGCTGG + Intronic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1089300764 11:117497431-117497453 GGGGGCTGCGGCGGGGAGCCTGG + Intronic
1089329114 11:117677538-117677560 TGTGGCTGCGGGGCAGGGGCTGG + Intronic
1091590552 12:1840447-1840469 GGTGGGTGGGGGGCGGCGGGGGG + Intronic
1091705761 12:2691812-2691834 GCTGCCTGCGGGCCGGCGGCTGG - Intronic
1092219136 12:6700817-6700839 GCTGGGCTCGGCGCGGCGGCTGG + Intergenic
1095049505 12:37543725-37543747 AATGGCAGCTGCGCGGCGGCAGG - Intergenic
1095206106 12:39442676-39442698 GCTGGCGGCTGCGCGGCGCCGGG - Intronic
1095476152 12:42589406-42589428 GGGGGCTGCGGCGCGGTGGTGGG - Intronic
1095752373 12:45727547-45727569 GGCGGCGGCGGCGCGGCGGCAGG + Intergenic
1096159860 12:49367410-49367432 GGTGGGGGCGGGGCGGCGTCCGG + Intronic
1096191539 12:49623360-49623382 GGACGCGGCGGCGCGGGGGCGGG + Intronic
1096495492 12:52037249-52037271 AGCGGCTGCGGCGCGGCTGCAGG + Intronic
1097155126 12:57006606-57006628 GGGCGCTGCGGCCGGGCGGCGGG - Intergenic
1099014126 12:77324940-77324962 GGTGGCGGCGGCGCGGGGCGGGG + Intergenic
1099365203 12:81759181-81759203 TGTGGCGGCGGGGGGGCGGCGGG - Intronic
1100234860 12:92650817-92650839 AGTGGCTGAGGCACGGCTGCTGG + Intergenic
1100611530 12:96194901-96194923 GGTGGCAGCGACGCGGGCGCAGG - Intronic
1101466912 12:104958333-104958355 CGGGGCTGCCGCGCGGGGGCGGG - Intronic
1101910477 12:108857370-108857392 GGCGGCCTCGGCGCGGCGTCCGG + Intronic
1102913818 12:116738082-116738104 TGTCGCTGCGGAGCGGAGGCGGG - Intergenic
1103474809 12:121210433-121210455 CGGGGCCCCGGCGCGGCGGCTGG - Intronic
1103779406 12:123389129-123389151 GGTGGCGGCGGCGAGGGCGCGGG + Intronic
1104602355 12:130162319-130162341 GGAGCCCGCGGCGGGGCGGCGGG + Intergenic
1104828770 12:131733806-131733828 GAGGGCTGCTGCGCTGCGGCAGG - Intronic
1104847898 12:131855951-131855973 CGTGGCTGCAGCGGGGCGGCTGG + Intergenic
1104939034 12:132386313-132386335 GGCGGCTGCGGCTCCGAGGCCGG - Intergenic
1104941805 12:132398759-132398781 GGTGGCTGCGCTGCCGTGGCAGG - Intergenic
1106517084 13:30465183-30465205 GGCGGCGGCGGCCGGGCGGCGGG - Intronic
1107851660 13:44577392-44577414 GGTGGCTGGGGGGAGGGGGCAGG + Intergenic
1108229559 13:48321390-48321412 GGTGGCAGCGGCGCGCGGGGAGG - Intronic
1110705974 13:78602259-78602281 GGCGGCGCGGGCGCGGCGGCCGG - Exonic
1111672762 13:91348993-91349015 GGCGGCAGCCGCGCGGCGACCGG - Intergenic
1112504969 13:99970090-99970112 GGCGGCGGCGGCGGCGCGGCCGG + Intronic
1112507854 13:99985572-99985594 GGGGGCGGCGGCGGGGCGGGCGG + Exonic
1113378666 13:109784933-109784955 GGCGACGGCGGCGCGGCGGCGGG - Exonic
1115028333 14:28767235-28767257 GGCGGCGGCGGCGCGGGAGCGGG - Exonic
1115217339 14:31026261-31026283 GCTGGCTGCGGGGCGGAGGCCGG + Exonic
1115399310 14:32939390-32939412 GGGAGCAGCGGCCCGGCGGCAGG - Intronic
1115474571 14:33800612-33800634 GGGGGCGGCGGCGCGGGGGGCGG + Exonic
1115851786 14:37595145-37595167 GGCGGCGGCGGCGGCGCGGCGGG + Intronic
1115851787 14:37595148-37595170 GGCGGCGGCGGCGCGGCGGGCGG + Intronic
1118610164 14:67533433-67533455 TGGGGCTGCGCCGCGGCGGAGGG + Intronic
1118796829 14:69152243-69152265 GGGGGCTGCGACCCGGGGGCTGG - Intronic
1118809217 14:69261213-69261235 GGGGGCGGCGGCGGGGCTGCGGG + Intronic
1118911345 14:70064548-70064570 GGTGGCGGCGGCGGGGATGCTGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119725534 14:76919947-76919969 GGTGGCAGCGGCGTGGCAGGCGG + Intergenic
1119759654 14:77141540-77141562 GGCGGCGGCGGCGCGGGGGGCGG - Intronic
1120993251 14:90396961-90396983 GGCGGCTCCGCCGCGGCGGAGGG + Exonic
1121199629 14:92106482-92106504 GCTGTCTGCCGCGCGGTGGCGGG - Intronic
1121473349 14:94173972-94173994 GGGGGCTGGGGGGCGGGGGCTGG - Intronic
1122108796 14:99480908-99480930 GGCGGCTGCGGCCCGGGGGCGGG - Intergenic
1122558011 14:102592006-102592028 GGGGGCCGCGGCGCGGGGGACGG - Intergenic
1122582081 14:102777387-102777409 GGCGGCGGGGGCGGGGCGGCGGG + Intergenic
1122599452 14:102914021-102914043 GGAGGCTGGGGCTCGGCTGCTGG + Intergenic
1122940758 14:104980360-104980382 GGTGGCTGCAGCGCGGCTAACGG - Intergenic
1123042964 14:105497938-105497960 GGAGGCTGCGGAGCGCAGGCGGG + Exonic
1123089900 14:105737887-105737909 GGTGGGTGGGGCTCGGGGGCAGG - Intergenic
1124014388 15:25863293-25863315 GGGGACTGCGGCCGGGCGGCGGG - Intronic
1124424784 15:29554715-29554737 GGTGGCTGTGGCGCTGAGCCAGG + Intronic
1124619652 15:31266429-31266451 GGGGGCTGGGGCGGGGCGGGGGG - Intergenic
1124971133 15:34490513-34490535 GGTGGAGGAGGCGGGGCGGCGGG - Intergenic
1124971486 15:34494383-34494405 GGAGGCCGCGGCGCGGCCCCGGG - Intergenic
1125051176 15:35299492-35299514 GGTGGCGGCAGCGCGGAGCCGGG + Intronic
1125508790 15:40282038-40282060 GGCGGCGGCGGCGCGGCCCCAGG + Exonic
1125509137 15:40283350-40283372 GGCGGTTGCGGGGCGGGGGCGGG + Intronic
1125652928 15:41332362-41332384 GGCAGCTGCGGGCCGGCGGCTGG + Exonic
1128321954 15:66700973-66700995 GGTGACCGCGGGGCGCCGGCGGG - Intergenic
1128454952 15:67827110-67827132 GGCGGCGGCGGCGCGGGGACAGG + Intronic
1128582317 15:68818715-68818737 GGTGGGTGCGGGGGCGCGGCTGG - Intronic
1129116415 15:73367768-73367790 GGCGGCGGCGGCGAGGCTGCGGG + Exonic
1129269498 15:74411912-74411934 GATGGCAGCCGCGCGGCGGAAGG + Exonic
1129845116 15:78764596-78764618 GGTGGCAGCGGCGGGCAGGCTGG + Exonic
1130256721 15:82329265-82329287 GGTGGCAGCGGCGGGCAGGCTGG - Intergenic
1130598229 15:85260723-85260745 GGTGGCAGCGGCGGGCAGGCTGG + Intergenic
1131055275 15:89371246-89371268 GGAGGCTGCGGCGCGGCCTGAGG + Intergenic
1131119608 15:89814368-89814390 GGTGGGTGGGGCGCGGCCGAAGG - Intronic
1131629917 15:94165640-94165662 GGTGGCTGGGGGGCGGGGGGGGG + Intergenic
1131977520 15:97961073-97961095 GCTGGCCGAGGCGCGGGGGCAGG - Exonic
1132522220 16:397113-397135 GGGGGCTCCGGGGCGGCGGGGGG + Intronic
1132583006 16:693972-693994 TGTGGCTGTGGCGTGGCGGAGGG + Exonic
1132641460 16:980375-980397 GGTGGGTGCGGTGCGCTGGCAGG + Intronic
1132665543 16:1079914-1079936 GTTGGCTGCGGCGCGGTGCGCGG - Exonic
1132779520 16:1614823-1614845 GGCGCCTGCGGCGCGCCGGGGGG - Exonic
1133055575 16:3144026-3144048 GGTGGCTGGGACCCTGCGGCTGG + Intergenic
1134850900 16:17477994-17478016 GGAGGCTGAGGCGAGGCGGGAGG + Intergenic
1135382696 16:22008005-22008027 CGGAGCTGGGGCGCGGCGGCTGG + Intronic
1135517620 16:23148957-23148979 GGCGGCGTGGGCGCGGCGGCCGG + Exonic
1136611966 16:31371806-31371828 GGTGGCGGCCGCGCTGGGGCTGG + Intronic
1136666921 16:31820099-31820121 GGGGGCTGCGGCGCTGCTCCCGG - Intergenic
1137988486 16:53130532-53130554 GGCGGCCGCGGCGGGGCTGCCGG + Intronic
1138247634 16:55479298-55479320 GGGGGCTGGGGCGCGGGGGCCGG + Exonic
1138619101 16:58197773-58197795 GGTGGCGGCGGCGGCGCGGCGGG + Exonic
1139606556 16:68022980-68023002 GCTGGTTTCGGCGCGGCGGCCGG - Exonic
1140223114 16:73058196-73058218 GGCGGCGGCGGCGCGGGGCCGGG + Intronic
1140401440 16:74675050-74675072 GGTGGCTGTGAAGCGGCAGCAGG - Exonic
1140504809 16:75464560-75464582 GGCGGCAGCGGCGGGTCGGCCGG - Exonic
1140927858 16:79600239-79600261 GGTGGCTGCGGCGGCGAAGCTGG + Exonic
1141608548 16:85169152-85169174 GGAGGGGGCGGGGCGGCGGCGGG - Intergenic
1141831314 16:86511248-86511270 GGCTGCGGCGGCGCGGCGGCCGG + Exonic
1142147863 16:88499965-88499987 GGTGGTTGGGGGGCGGGGGCCGG + Intronic
1142210576 16:88806585-88806607 GGTGGCTGGGGCAGCGCGGCCGG - Exonic
1142292042 16:89197614-89197636 TGTGGCTGCGGCTCGGGGTCAGG - Intronic
1142697700 17:1643075-1643097 GGTGGCCGCGGCGGGGCGCCGGG - Intronic
1142812606 17:2402142-2402164 GGTGGGCGGGGCGCGGGGGCGGG + Intergenic
1143371641 17:6444246-6444268 GCTGGCGGCGGGGCGGGGGCCGG + Intergenic
1143477662 17:7211810-7211832 GGAGGCTGCGGCGGGGGGGGGGG + Intronic
1143562675 17:7705027-7705049 GGGGGCTGAGGCGGGGCGGCGGG + Intergenic
1143736737 17:8916480-8916502 GGTGGCGGGGGCGGGGGGGCGGG - Intronic
1144686000 17:17226853-17226875 TGTGGCTGCAGCGGGGCAGCGGG - Intronic
1144870045 17:18363622-18363644 ATTGGCTGCGGCGCAGCGGCGGG + Intergenic
1145041279 17:19579891-19579913 GCTGGCGGCGGCGCGGGCGCGGG - Intergenic
1146208055 17:30921922-30921944 CCTGGCTGAGGCGCCGCGGCCGG + Exonic
1146371095 17:32266013-32266035 GGCGGCGGCGGCGCGGGGACCGG + Intergenic
1147158613 17:38558315-38558337 GTCGGAGGCGGCGCGGCGGCAGG - Exonic
1147563326 17:41522049-41522071 TGTGGCTGCGGGGCGGGGTCTGG - Exonic
1147994634 17:44354058-44354080 GGCGGCGGCGGCGGCGCGGCAGG + Exonic
1147994635 17:44354061-44354083 GGCGGCGGCGGCGCGGCAGGCGG + Exonic
1148156834 17:45429590-45429612 GGGCGCTGGGGCGCGGAGGCGGG - Intronic
1148225224 17:45894583-45894605 GGTGGCAGCGGCGCTGCTGTTGG - Exonic
1148271789 17:46267159-46267181 CGGGGCGGCGGCGCGGCGGCCGG - Intergenic
1148557365 17:48586444-48586466 GGTGGCTGCGGCGGTGTGGCCGG + Intronic
1148945857 17:51260932-51260954 GGAGGCCGCGGCGCGCGGGCTGG + Intronic
1149659346 17:58326261-58326283 GGAGGCTGCTGGGCGGAGGCTGG - Intronic
1149849397 17:60026308-60026330 GGGGTCTGCGGCCCCGCGGCGGG - Intergenic
1149860771 17:60120216-60120238 GGGGTCTGCGGCCCCGCGGCGGG + Intergenic
1150692752 17:67378873-67378895 GGGGGCTGCGACGCGGCCACAGG + Intronic
1150764596 17:67993395-67993417 CGGGGCGGCGGCGCGGCGGCCGG + Intronic
1151293184 17:73165008-73165030 GGTGGCTGCGCCGCTGGGACTGG - Exonic
1151658095 17:75504921-75504943 GGTGGGTGCGGAGGGGAGGCGGG + Exonic
1151876066 17:76868839-76868861 GGAGGGAGCGGCGCGGCTGCCGG - Intronic
1152441399 17:80312364-80312386 GGTGGGTCCGGCACGGAGGCGGG + Intronic
1152557746 17:81062917-81062939 GGTGGGGGCGGCGGGGGGGCGGG - Intronic
1152581088 17:81165899-81165921 GGAGGCAGCGGCGCGCAGGCCGG + Intronic
1152627997 17:81397001-81397023 GGTGGCGGCGTCGCCGCTGCGGG + Intronic
1153451865 18:5238551-5238573 GGTGTCTGGGGAGCGGCTGCCGG + Intergenic
1153886956 18:9475649-9475671 GGAGGCTGCGGCGGGGCGGACGG + Intronic
1154132893 18:11751652-11751674 GGCGGCCGCGGCGCAGCGGAGGG + Intronic
1154143997 18:11851243-11851265 GGACGCTCCGGCGCTGCGGCGGG - Intronic
1157279076 18:46334122-46334144 GGCGGCGGTGGGGCGGCGGCTGG - Intronic
1157753011 18:50194985-50195007 CGTAGCTGCGCCGCCGCGGCGGG - Exonic
1157867211 18:51197256-51197278 GGCGGCTGCGGCAGGGGGGCCGG + Exonic
1160156904 18:76441531-76441553 GGTGGCTGCGGCCCTGCGGTTGG + Exonic
1160408635 18:78659920-78659942 GGAGGCTGCGAGGCTGCGGCTGG + Intergenic
1160577343 18:79864128-79864150 GGCGGCTGCAGCGCGGCCGGCGG + Exonic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1160975131 19:1789335-1789357 GGTGGCGGCGGCGGGGCTGGGGG - Intronic
1160982788 19:1823865-1823887 GGTGGCTGGAGCTCGGGGGCCGG + Intronic
1161015504 19:1980927-1980949 GGAGGCTGCGCCCCGGCGCCTGG + Exonic
1161087878 19:2343488-2343510 GGTGGCTGCGGGGCGGTTCCCGG + Intronic
1161089515 19:2352979-2353001 GGAGGCTGCGGGCCGTCGGCTGG - Exonic
1161203647 19:3029220-3029242 GGTGGCGGCGGCGCGGGCGGCGG + Intronic
1161215743 19:3094406-3094428 GGTGGCTGCGGCGGCGGCGCGGG + Exonic
1161215821 19:3094599-3094621 GGGGGCCGGGGGGCGGCGGCGGG + Exonic
1161495002 19:4581689-4581711 GGGGGGCGCTGCGCGGCGGCCGG + Intergenic
1161550637 19:4910274-4910296 GGTGGCCGGGACGGGGCGGCCGG + Intronic
1161570109 19:5025788-5025810 GGTGGCAGCGGGGCTGCGTCTGG - Intronic
1161586065 19:5106546-5106568 GGTGGCTGCCGGGTGGCTGCTGG - Intronic
1162566874 19:11449350-11449372 GGTGGCTCCGGGCAGGCGGCTGG - Exonic
1163443687 19:17334409-17334431 TGCGGCTGCGGCCCGGCGGGCGG - Intronic
1163513075 19:17747710-17747732 CGCGGCTGCGGCGCGGCTGCCGG - Exonic
1163557601 19:18001413-18001435 GGAGGCGGCGGCGCCGCTGCGGG + Intronic
1163561150 19:18020419-18020441 GGTGGCTGGAGCGGGGAGGCTGG - Intergenic
1163678613 19:18668114-18668136 CGTGGCTGGCGCGCGGCCGCCGG - Exonic
1163717869 19:18882526-18882548 GGAGGCTGAGGCGAGGCGGGAGG + Intronic
1165596116 19:37012249-37012271 AATGGCGGCGGCGCGGCGGTAGG - Intronic
1165851436 19:38852183-38852205 GGTGGGGGCGGGGCGGTGGCCGG - Intronic
1165871386 19:38975734-38975756 GGCGGCTGCAGCCCGGCGCCGGG + Exonic
1166139700 19:40799388-40799410 TGTGGGTGCGGCGCGGGGGAGGG + Intronic
1166304255 19:41928596-41928618 GGCGGCGGCGGCGCGGGGGAGGG + Intronic
1166368107 19:42287302-42287324 GGAAGCTGCGGCGGGGCAGCAGG - Exonic
1166546898 19:43639518-43639540 GGGGGCTGCGGCACGGCGGCCGG + Intronic
1167019066 19:46861006-46861028 GAGAGCCGCGGCGCGGCGGCAGG + Intergenic
1167108843 19:47447251-47447273 GGTGGCTGTGGAGAGGGGGCGGG - Intronic
1167286959 19:48603704-48603726 GGGGGCCACGGAGCGGCGGCGGG + Exonic
1168078488 19:53992922-53992944 GGGGGCCGCGGGCCGGCGGCGGG + Exonic
1168315488 19:55483159-55483181 GGGGGCTGGGGGCCGGCGGCAGG - Exonic
1168339121 19:55613802-55613824 GGGGGCTGCGGCGGGGGGCCGGG - Exonic
1168650070 19:58087061-58087083 TGTGGCTGTGGGGCTGCGGCGGG - Intronic
1168706293 19:58472122-58472144 GCTGGCTGCGAGACGGCGGCTGG - Exonic
926089867 2:10043177-10043199 GGAGGGGGCGGGGCGGCGGCTGG - Intronic
926089884 2:10043211-10043233 GGAGGGGGCGGCGGGGCGGCGGG - Intronic
927472214 2:23385238-23385260 GGCGGCGGCGGCGCGGGGGCTGG - Exonic
927558159 2:24050111-24050133 GGGGTCTGCGGCCCGGAGGCGGG + Intronic
927679767 2:25131907-25131929 CGTGGGTGCGGCGCGGGGCCGGG + Exonic
927751458 2:25673717-25673739 GGTGGGCGGGGCGCGGCCGCGGG - Intergenic
928858492 2:35828002-35828024 GGTGGCTGGGGGGAGGGGGCAGG + Intergenic
932144844 2:69307710-69307732 GGTGGATACGGCGCGGGGGTGGG + Intergenic
932355977 2:71068712-71068734 GGTGAGTGCGGCCCGGCGGAGGG + Exonic
932763959 2:74458537-74458559 GGTGGCAGGGGCGGGGCGGCTGG + Exonic
932812046 2:74834009-74834031 ATTGGCTGCGCCACGGCGGCGGG + Exonic
933658111 2:84905718-84905740 GGTGAGTGCGGCGCCGGGGCGGG + Exonic
933772709 2:85754338-85754360 GGTGGCTACGGCGCGGGGCTCGG - Exonic
933909981 2:86930798-86930820 GGTGGCAGGGGCGGGGCGGCTGG - Intronic
934022744 2:87972590-87972612 GGTGGCAGGGGCGGGGCGGCTGG + Intergenic
934566974 2:95346591-95346613 GGCGGCGGCGGCGCGGCGGCGGG - Intronic
934660066 2:96138576-96138598 GGTGGTTGGGGCGGGGCTGCAGG - Intergenic
934660085 2:96138630-96138652 GGTGGTTGGGGCGGGGCTGCAGG - Intergenic
935592519 2:104855477-104855499 GGTGGCGGCGGTGGGGTGGCGGG + Intergenic
935592786 2:104856399-104856421 GGCGGCGGCGGCGCGGGGCCTGG + Exonic
935653135 2:105399023-105399045 GGTGGCTGCGGCTCCGCTGCCGG + Intronic
935963442 2:108449243-108449265 GCTGGTTGCGGGCCGGCGGCGGG + Exonic
936175080 2:110212546-110212568 GCGGTCTACGGCGCGGCGGCGGG + Intergenic
936390778 2:112071303-112071325 GGTGGCGGCGGCGGGGGGGCGGG - Intronic
936412833 2:112275698-112275720 GGTGGCTGTGGCGTGGGAGCGGG - Exonic
936433245 2:112482184-112482206 GGTGCCGGCGGCGCCGCGCCCGG - Exonic
937119492 2:119431874-119431896 CGAGGCTGCAGCGCGGCCGCCGG + Exonic
938018201 2:127885409-127885431 GGAGGGGGCGGCGGGGCGGCGGG + Intronic
938414553 2:131093426-131093448 GGTGGCTGCGCAGCGTCGGCGGG - Exonic
938796022 2:134718863-134718885 CGTGGCCCCGGGGCGGCGGCGGG + Exonic
938895201 2:135742348-135742370 GGTGCCTCCGGCCCGGCTGCCGG - Intronic
939153842 2:138501846-138501868 GGTGGGGGCTGCGCGGGGGCGGG + Exonic
939900511 2:147844621-147844643 GGCGGCTGCGGCGCGGGGAAGGG - Exonic
939969663 2:148644967-148644989 GGCGGCGGCGGCGGGGCGGGCGG - Exonic
942398881 2:175580512-175580534 GGTGGCGGGGGCGCGGTGGGGGG + Intergenic
942450994 2:176107920-176107942 GGGGGCTGCGGCCCGGCGAACGG - Exonic
944766651 2:202871505-202871527 GGAGGCGGGGGCGCGGCGGGAGG - Intronic
945119582 2:206443796-206443818 GCTAGCTGCGGGGCGGCCGCGGG - Exonic
945245235 2:207711662-207711684 GGCGGCGGCAGCGCGGCGGTGGG + Intronic
946354932 2:219178519-219178541 TGTGGCTGCGGCTCCGCGGCTGG + Exonic
947374557 2:229482509-229482531 GGTGGCTGCAGCACGGTGGTCGG - Intronic
948047031 2:234952433-234952455 GAGGGCTGCGGCTCGGCGCCCGG - Intronic
948467418 2:238159018-238159040 GCGGGCTCCGGCGGGGCGGCGGG - Exonic
948805938 2:240453464-240453486 GGGGGCCCCGGGGCGGCGGCAGG - Intronic
948806688 2:240456151-240456173 GGAGGCTGAGGCGCGGGGGCCGG + Intronic
948839862 2:240643548-240643570 GGTGGCAGAGGGGCGGCGGGGGG + Intergenic
949014745 2:241702638-241702660 GGGGACTGCGGCGCGGAGGCGGG + Intronic
1169081605 20:2800665-2800687 GGAGGCTGCGGAGGGGCGGGGGG - Intergenic
1169213024 20:3778144-3778166 GGTGGGTCCGGCGCGGCGTCGGG + Exonic
1170150366 20:13221315-13221337 TGTGGCCGCGGCGCCGCAGCTGG - Intergenic
1170890078 20:20368838-20368860 GGGGGCCGCAGGGCGGCGGCAGG - Exonic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1170946412 20:20895077-20895099 GGAGGCTGAGGCGAGGCGGGAGG + Intergenic
1171059709 20:21944418-21944440 GGTGGATGCGGTGCGGCAGCTGG + Intergenic
1172118566 20:32585010-32585032 TGTGGCTCCGGCGAGGCTGCTGG + Intronic
1172587137 20:36092789-36092811 GGCGGCGGCGGCGCGGCTTCCGG - Intronic
1172698075 20:36835844-36835866 GGCGGCGGCGGCGGGGAGGCGGG - Intronic
1173615657 20:44401346-44401368 GGTGGCCGCGGCGTGGAGGCAGG + Exonic
1173672897 20:44810377-44810399 GGTGGCGGCGGCCCGGGGCCGGG + Intergenic
1173856040 20:46251389-46251411 GGTGGCCTCAGCGCGGCCGCCGG + Exonic
1174407662 20:50312672-50312694 GGTGTCTGCGTGGCGGAGGCTGG - Intergenic
1174607023 20:51768431-51768453 GCGGGCGGCGGCGCGGAGGCCGG - Exonic
1175268696 20:57718718-57718740 GGTGGCTGCGGGGCGGGGCGCGG + Intergenic
1175428880 20:58889251-58889273 CCGGGCTGCGGCGCGGCGGCTGG + Intronic
1175442435 20:59001335-59001357 GGTGGCTGGGGAGCTGCGGGAGG - Intronic
1175847002 20:62064790-62064812 GGCGGCTGCGGCGCCGGCGCCGG - Exonic
1175847101 20:62064993-62065015 GGCGGGGGCGGGGCGGCGGCGGG + Exonic
1176018666 20:62951894-62951916 GGTGGCTGCTGCGTGGAGGATGG + Intergenic
1176221082 20:63969676-63969698 GGGGGCTCGGGCGCGGCGGGGGG + Intronic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1178168520 21:30010508-30010530 GGTGGCAGAGGCGTGGGGGCAGG + Intergenic
1178561507 21:33642916-33642938 GGTGGCGGCGGAGTGGCGGGCGG + Intronic
1179494589 21:41763823-41763845 AGTGCCTGCGGGGCGCCGGCTGG - Intronic
1179534026 21:42039835-42039857 GCTGGCTGCAGGGCGGCTGCTGG + Intergenic
1179810170 21:43865152-43865174 GGCGGCGGCGGCGCGGCCGAGGG + Intergenic
1180011639 21:45055142-45055164 GCAGGCTGCGGCGTGGCGCCCGG - Intergenic
1180413983 22:12692899-12692921 GGTGGCAGCTGGGAGGCGGCAGG + Intergenic
1180843828 22:18970980-18971002 CGTGGCCGCGGCGCCGAGGCCGG - Intergenic
1180876661 22:19178100-19178122 GGAGGCCGCGGCGCCGCGGGGGG - Intronic
1181057847 22:20268300-20268322 GGCGGCGGCGGCGCGGGGGTTGG + Exonic
1181307145 22:21923256-21923278 GGTGGCTGCGGCCCGGGAGCGGG - Exonic
1181477987 22:23180459-23180481 GGTGGCCGCGGCGCGGATGACGG - Exonic
1181787642 22:25238397-25238419 GGTGGCGGGGGCGGGGCGGGGGG + Intergenic
1182903851 22:33920441-33920463 CCGGGCTCCGGCGCGGCGGCGGG + Intronic
1183370131 22:37427497-37427519 AGGGGCAGAGGCGCGGCGGCGGG - Intergenic
1183441395 22:37825026-37825048 GGCGGCCGAGGCGCGGCGGAGGG + Exonic
1183540707 22:38427835-38427857 GGTGCCTGCGGCGGGGGGCCCGG - Exonic
1183683772 22:39350210-39350232 CCCGGCGGCGGCGCGGCGGCGGG + Intronic
1183829547 22:40410488-40410510 GCTGGCTGCAGTGAGGCGGCGGG + Exonic
1184222646 22:43110734-43110756 CGTGTCTGCGGCCCGGCTGCCGG - Exonic
1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG + Intergenic
1184369002 22:44070763-44070785 GGTGGATGGGGCTTGGCGGCTGG + Intronic
1185055370 22:48576158-48576180 GCTGGCTGCGGGGCGCCGGGGGG - Intronic
1185345061 22:50307419-50307441 GGCGGCTGCGGCTCCGCGGAGGG - Intronic
1185420559 22:50732097-50732119 GATGGCTGCGGTGGAGCGGCAGG - Intergenic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
950046700 3:9952367-9952389 GGAGGATGCGGCGCGGCGATCGG - Exonic
951717390 3:25664263-25664285 GGTGGCTGCGGCGCGGGAGCCGG - Exonic
951780196 3:26354466-26354488 GGGGGCGGCGGAGCGGGGGCGGG - Intergenic
952942284 3:38454057-38454079 GGGGGCCGGGGGGCGGCGGCGGG - Exonic
953485070 3:43286896-43286918 CCTGGCGGCGGGGCGGCGGCGGG + Intronic
954215225 3:49120854-49120876 GGTGGCGGCGGCGCCGGGACGGG - Intronic
954396248 3:50294931-50294953 GGTGGCTGCATGGCAGCGGCCGG + Exonic
954615557 3:51967351-51967373 GGCGGCGGCGGCACGGCGGCTGG + Exonic
954733466 3:52685587-52685609 GTTGGGCGGGGCGCGGCGGCTGG - Intronic
954778997 3:53045743-53045765 GGCGGCGGCGGCGCCGGGGCGGG - Intronic
954912500 3:54121753-54121775 GGGGGCCGCTGCGCTGCGGCCGG + Intergenic
955884722 3:63585453-63585475 GGTGGGTGCGGGGCGGAGGGGGG - Intronic
956978964 3:74614581-74614603 GGTGGCAGCGGCGGGCGGGCTGG - Intergenic
957215834 3:77317922-77317944 GGGGGCTGCGGCGCCAAGGCAGG + Intronic
958026892 3:88059273-88059295 GGCGGCGGCGGCGCAGGGGCTGG + Exonic
959941653 3:112086992-112087014 GGGGGCTGCGGCGAGGTGGGTGG - Intronic
961402159 3:126655043-126655065 GGCGGCTGCGGCGCCGGGACGGG + Intronic
962575510 3:136752120-136752142 GGCGGCAGCGGCGCGGGGGCTGG - Intronic
963827504 3:149970927-149970949 GGCGGCGGCGGCGCGGGGGGAGG + Exonic
964720684 3:159764956-159764978 AGTGGCCGCGGCCCGGCGGCTGG + Exonic
966182247 3:177197691-177197713 GGAGGCGGCGGCGGCGCGGCGGG + Intergenic
966182250 3:177197694-177197716 GGCGGCGGCGGCGCGGCGGGGGG + Intergenic
966696278 3:182793513-182793535 GGTGGCTGCGGCGCGGCGGCAGG + Exonic
966915825 3:184583711-184583733 GCCGGCTGCGGCGGCGCGGCTGG - Intronic
967596259 3:191329445-191329467 GGTGGCCGCGGCGGGGCAGCTGG + Exonic
967685276 3:192409903-192409925 GGAGGCGGCGGCGCGGCGGCGGG - Intronic
967916722 3:194583900-194583922 GGCGGCTGCGGCGGCGGGGCGGG + Intergenic
968066377 3:195761849-195761871 GGGGGCTGCGGGGAGGCGGGGGG - Intronic
968353342 3:198080765-198080787 GGCGGCTGCGGCTCGGGCGCAGG + Intergenic
969288322 4:6222150-6222172 GGAGGCTGCGGTTCGGTGGCTGG + Intergenic
969413377 4:7043537-7043559 GGCGGCTGCGGCGGGCCGGGCGG + Exonic
970333146 4:15004213-15004235 GGCTGCTGCGGCGCCGCGGGCGG - Exonic
971457810 4:26860798-26860820 GGCGGCGGCGGCGCGGGAGCTGG + Intronic
972396525 4:38663740-38663762 TCGGGCGGCGGCGCGGCGGCTGG + Intergenic
974386094 4:61202538-61202560 GGCGGCCGCGGCGCCGGGGCGGG + Intronic
975118465 4:70704825-70704847 GGCGGCGGCGGCGCAGCGGACGG + Intronic
975420523 4:74158375-74158397 GTGGGCGGCCGCGCGGCGGCGGG + Intronic
975778968 4:77819626-77819648 GGCGGCGGCGACGGGGCGGCTGG + Intergenic
977064990 4:92303947-92303969 GTTTGCTGGGGCGCGGTGGCGGG - Intronic
978822413 4:112980453-112980475 GCTGGCTGCAGCGGTGCGGCCGG - Intronic
980130505 4:128812091-128812113 GCTGGCGGCGGCGGGGCGGGAGG + Intronic
980378102 4:131976334-131976356 GGCGGCTGCGGCGCAGCCCCAGG + Intergenic
981061269 4:140427623-140427645 AGTCGCTGCTGCGCGGCCGCCGG - Exonic
981713556 4:147732016-147732038 AGTGTCTGCCGCGCGGGGGCCGG + Intergenic
985580513 5:693353-693375 GGCGGGCGCGGGGCGGCGGCTGG - Exonic
985593653 5:778034-778056 GGTGGCTGCGGAGGTGCGCCGGG - Intergenic
985660783 5:1155727-1155749 GGCGGCTCGGGCGCGGCTGCGGG + Intergenic
986151128 5:5131308-5131330 AGTGGCTGAGGCGCTGCTGCTGG + Intergenic
986608629 5:9546184-9546206 GGAGGAGGCGGCGCGGCGGCGGG - Intergenic
987020332 5:13863875-13863897 TGTGGCTGAGGCGTGGAGGCAGG - Intronic
987312564 5:16694723-16694745 GGTCTCTGCGGTGCTGCGGCTGG - Intronic
988547650 5:32173764-32173786 GGGGGCGGCGGCGCGGGGCCCGG - Intronic
990955118 5:61332696-61332718 GGTGGCGGCGGCGGCGCGGGCGG + Exonic
992312072 5:75511355-75511377 CGCGGCGGCGGCGCGGCGGGCGG - Exonic
992549110 5:77844769-77844791 GGTCGCTGCTGCGCGGCGTGGGG + Intronic
993386540 5:87268506-87268528 GGAGGAGGCGGCGCGGCAGCGGG + Exonic
993726943 5:91380205-91380227 GGCGGCGGCGGCGCGCGGGCAGG - Intronic
996405347 5:123098370-123098392 GGAGGCTGGGTCGCGCCGGCGGG + Intronic
997454048 5:134004686-134004708 GGGGGCTGCGACGCGGAGGCAGG + Intronic
997652887 5:135535460-135535482 AGAGGCGGCGGCGCCGCGGCCGG - Exonic
999248212 5:150166761-150166783 GGTGGGGCGGGCGCGGCGGCAGG + Intergenic
999759713 5:154690901-154690923 TGTGGCTGAGGACCGGCGGCTGG - Intergenic
1000014557 5:157266050-157266072 GGTGGGGGCGGAGCCGCGGCGGG + Intergenic
1000014689 5:157266434-157266456 CGGAGCTCCGGCGCGGCGGCGGG + Intronic
1000296337 5:159916377-159916399 GGTGGCGGCGTCGGGGCTGCGGG + Intergenic
1001936954 5:175712166-175712188 GGTGGCTGCGGCTGGGAGGGAGG + Intergenic
1002029332 5:176416430-176416452 GGTGACAGCGTCGCGGCCGCCGG - Exonic
1002068616 5:176665173-176665195 GGGGGATGCGGCGCGGAGGCGGG + Intergenic
1002093493 5:176817848-176817870 GGTGGGTGCCGCGGGGCAGCCGG + Intronic
1002418000 5:179130711-179130733 GGTGGCTGCTGCGGGGCAGCTGG + Intronic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1003202828 6:3978042-3978064 GGTGGCGGCAGCACGGTGGCAGG + Intergenic
1003529823 6:6928185-6928207 GGTGGCTTCCGCACGGCGCCTGG - Intergenic
1003544904 6:7051443-7051465 GGCGGCTGCGGCGCGGAGCCGGG + Intergenic
1003872166 6:10412230-10412252 GGGGGCCGCGGCGCGGCGTCTGG + Intronic
1004044659 6:12012334-12012356 GGCGGCTGCTGGGCGGCGGCAGG + Exonic
1004114103 6:12749802-12749824 GGGGGCGGGGGCGCGGCGCCAGG - Intronic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1005385284 6:25279408-25279430 TGTAGGTGCGGCGCGGAGGCTGG + Exonic
1006300746 6:33192532-33192554 GGTGGCTGTGGGCGGGCGGCTGG - Intergenic
1006502155 6:34465962-34465984 GGTGGACGCGCCGCGGCTGCCGG - Intergenic
1006694574 6:35920646-35920668 GCGGGCTCCGGCGAGGCGGCCGG + Intronic
1006834024 6:36986070-36986092 GCTCGCGGCGGAGCGGCGGCGGG - Exonic
1006860850 6:37170683-37170705 CGGGGATGCGGGGCGGCGGCGGG + Intronic
1007406067 6:41637147-41637169 GGTGGTTGCGGCCCGGAGGAAGG - Intronic
1008932428 6:56954817-56954839 CGAGGCTGCGACTCGGCGGCTGG + Intergenic
1010703274 6:79077651-79077673 AGAGGCGGCCGCGCGGCGGCGGG + Intronic
1010980496 6:82364667-82364689 GGTGGCACCAGGGCGGCGGCAGG + Exonic
1011607447 6:89118301-89118323 GGTGGTGGCGGGGCTGCGGCTGG + Intergenic
1012400010 6:98835093-98835115 GGTGGCGGCGGCGGGGGGGGCGG + Exonic
1015149274 6:130020001-130020023 GGCGGCCGCGCCGGGGCGGCGGG + Intronic
1015843866 6:137497832-137497854 GCGGGCTGCGCCGCGGAGGCGGG + Intergenic
1015995068 6:138988377-138988399 GGTGGCCGGCGCCCGGCGGCGGG + Intergenic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1017877533 6:158536877-158536899 GCGGGCAGCGGCGGGGCGGCCGG + Intronic
1017880584 6:158560156-158560178 CGAGGCTGCTGCGCGGCGCCTGG + Intronic
1019517219 7:1445332-1445354 GGCGGCTGCGGGGAGGTGGCTGG + Exonic
1019523399 7:1470394-1470416 GGTGGCTCCGGGCCGGCCGCTGG - Exonic
1019552655 7:1610765-1610787 GGTGGGGGCAGCGGGGCGGCGGG + Intergenic
1019681858 7:2354991-2355013 GCTGGCGGCGGCTCGGCGGCCGG - Exonic
1020034985 7:4959218-4959240 GGTGGCGGGGGCGGGGCGGGCGG + Intergenic
1020274325 7:6615593-6615615 GGGGGCGGGGGCGCGGGGGCCGG - Intergenic
1020278330 7:6637568-6637590 GGAGGCCGCGGGGAGGCGGCGGG + Intronic
1021451285 7:20785439-20785461 GGCGGCTGCGGCGCTGCTGGAGG + Exonic
1021729957 7:23586401-23586423 GATGGCGGCGGCACTGCGGCCGG + Intergenic
1021828054 7:24573761-24573783 GGCGGCGGCGGCGCCGCGGTCGG + Intronic
1022090068 7:27102223-27102245 GGCGGCTGCAGGGCGCCGGCGGG + Exonic
1022715060 7:32891595-32891617 GGCCCCTCCGGCGCGGCGGCGGG + Exonic
1023064848 7:36367033-36367055 GGTGGCGGGGGCGCGGCGGGAGG + Intronic
1023349977 7:39310776-39310798 GGAGGCTGCGACCCAGCGGCAGG + Intronic
1024520949 7:50304047-50304069 GGTGGCGGCGGCGCGCCGAGCGG + Intergenic
1027111396 7:75442622-75442644 CGGGGCTGCGGCGGGCCGGCCGG - Intronic
1027177786 7:75915495-75915517 GGGGGCGGCGGCGCGGGGACTGG - Intronic
1027592586 7:80134849-80134871 CGAGGCTGCGGCGCGGCCACCGG + Exonic
1028417579 7:90596343-90596365 GGCGGCGGCGGCGCGGCGCGGGG + Intronic
1028762427 7:94510256-94510278 GGAGGCGGCGACGCGGCGGCTGG + Intronic
1029483804 7:100827463-100827485 GGAGACTGCGGCGCGGAGCCGGG + Exonic
1029537255 7:101163913-101163935 GGTGGAGGCCGGGCGGCGGCAGG - Exonic
1029640402 7:101816396-101816418 GGCGGCGGCGGCGCGGGGCCCGG - Intronic
1029746430 7:102517812-102517834 GGGGGCGGGGGCGGGGCGGCGGG + Intergenic
1029764367 7:102616791-102616813 GGGGGCGGGGGCGGGGCGGCGGG + Intronic
1030033465 7:105388981-105389003 GGTGGGGGCGGGGCGGGGGCGGG - Intronic
1030138697 7:106284560-106284582 GGCGGCGGCGGCGCGGCGGGGGG - Intronic
1032525661 7:132576994-132577016 GGGGGCTGCCGCGGCGCGGCCGG - Exonic
1033390658 7:140924660-140924682 GGTGGTGGCGGCGCGGAGCCGGG - Exonic
1034192723 7:149224075-149224097 GGGGGCGGCGGCGCGGAGGCGGG + Exonic
1034560623 7:151877327-151877349 TGGGGCCGCGGCGCGGCGGGGGG - Intergenic
1038302148 8:26362251-26362273 GGAGGCTGAGGCGAGGCGGATGG + Intronic
1038575701 8:28701791-28701813 GGCTGCTGCTGCCCGGCGGCGGG + Intronic
1038963496 8:32548072-32548094 GGGGGTGGCGGCGCGGCTGCCGG - Intronic
1042859129 8:73295346-73295368 GCTGGCCGCGGCGCGCTGGCTGG + Exonic
1044591605 8:93917786-93917808 GGAGGCGGCGGCGGGGAGGCGGG - Intronic
1045231185 8:100309437-100309459 GGTTGCCGCGGGGAGGCGGCGGG - Intronic
1045583222 8:103500810-103500832 GGCGGCACCGGCGCGGCGGCTGG - Intronic
1048400513 8:134063902-134063924 GGTGGCTGTGGATCGGAGGCTGG + Intergenic
1048554000 8:135457696-135457718 GGCGGCGGCGGCACGGGGGCGGG - Exonic
1049383236 8:142327907-142327929 GGTGGCTGCTGAGAGGCTGCTGG - Intronic
1049442131 8:142614383-142614405 TGTCGCTGCGGGCCGGCGGCGGG + Exonic
1049571023 8:143370339-143370361 GGTGGCAGTGGGGCGGAGGCAGG + Intronic
1049585297 8:143430156-143430178 GGCGGCGGCGGCGCGGGGGGCGG - Exonic
1049637061 8:143694755-143694777 GGGGGCTGCGCCCCGGCGCCGGG + Exonic
1049670752 8:143868753-143868775 GAGGGCTGCGGCCCTGCGGCAGG - Exonic
1049762179 8:144336612-144336634 TGAGGCTCCGCCGCGGCGGCGGG - Intergenic
1049788600 8:144462872-144462894 GGTGGTGGCGGCGGGGCGGGGGG - Intronic
1049861625 8:144902450-144902472 GGGGGCTGCGTGGGGGCGGCGGG + Intergenic
1049896241 9:113910-113932 GGGGGCGGCGGCGCAGAGGCCGG + Intergenic
1051513674 9:17906734-17906756 GGTGGCTCCGCGGCGGCGGCCGG - Intergenic
1051855425 9:21559635-21559657 GCCGGCTTCGGCGCCGCGGCCGG + Intergenic
1052807400 9:33025254-33025276 GACGGCTGCGGCGCGCCGGGCGG + Exonic
1053001156 9:34577958-34577980 GGCGGGGGCGTCGCGGCGGCGGG + Intronic
1053229990 9:36400513-36400535 GTTGGCTGCAGCGCGAGGGCGGG - Intronic
1053690458 9:40584309-40584331 GGCGGCGGCGGCGAGGCGGGCGG - Intergenic
1053690464 9:40584327-40584349 GGCGGCGGCGGCGAGGCGGGCGG - Intergenic
1053763026 9:41358723-41358745 GGCGGCTGCGGCGCAGCCCCGGG - Intergenic
1054274340 9:63053140-63053162 GGCGGCGGCGGCGAGGCGGGCGG + Intergenic
1054301701 9:63385234-63385256 GGCGGCGGCGGCGAGGCGGTCGG - Intergenic
1054301706 9:63385252-63385274 GGCGGCGGCGGCGAGGCGGGCGG - Intergenic
1054323974 9:63703994-63704016 GGCGGCTGCGGCGCAGCCCCAGG + Intergenic
1054400483 9:64711788-64711810 GGCGGCGGCGGCGAGGCGGGCGG - Intergenic
1054400489 9:64711806-64711828 GGCGGCGGCGGCGAGGCGGGCGG - Intergenic
1054434069 9:65196032-65196054 GGCGGCGGCGGCGCGGCGGGCGG - Intergenic
1054434075 9:65196050-65196072 GGCGGCGGCGGCGCGGCGGGCGG - Intergenic
1054434081 9:65196068-65196090 GGCGGCGGCGGCGAGGCGGGCGG - Intergenic
1054434087 9:65196086-65196108 GGCGGCGGCGGCGAGGCGGGCGG - Intergenic
1054496304 9:65825599-65825621 GGCGGCGGCGGCGAGGCGGGCGG + Intergenic
1054496310 9:65825617-65825639 GGCGGCGGCGGCGAGGCGGGCGG + Intergenic
1054496316 9:65825635-65825657 GGCGGCGGCGGCGAGGCGGGCGG + Intergenic
1054496321 9:65825653-65825675 GGCGGCGGCGGCGAGGCGGACGG + Intergenic
1054541632 9:66269837-66269859 GGCGGCTGCGGCGCAGCCCCGGG - Intergenic
1056799534 9:89681477-89681499 GGGGGCAGCGGTGCGGCGGGGGG - Intergenic
1057494959 9:95553501-95553523 GGCCGCGGCGGGGCGGCGGCTGG - Intergenic
1057600048 9:96450123-96450145 GGCGGCGGCGCCGCGGGGGCGGG + Intergenic
1057869676 9:98708575-98708597 GCGGGCTGCTGGGCGGCGGCCGG + Exonic
1058830993 9:108816266-108816288 GGTGGGGGCGGCGTGGCGGGGGG - Intergenic
1059099297 9:111454312-111454334 GGGGGGTGGGGTGCGGCGGCAGG + Intronic
1060856106 9:126915447-126915469 GGTGGCTGCGGTACGGAAGCAGG + Intronic
1061181691 9:129028289-129028311 GGCGGCTGCGGCGGGCGGGCAGG - Intronic
1061202444 9:129145711-129145733 TGTGGTTGCGGGGCGGCGGGGGG + Intronic
1061248591 9:129413957-129413979 GGTGGCCCCGGCGCGGCGACGGG - Intergenic
1061262627 9:129488531-129488553 GGCGGCCGCGGGGCGGGGGCGGG - Intergenic
1061293654 9:129666011-129666033 GGTGGCGGCGGCCGGGCGGCTGG + Exonic
1061472123 9:130835203-130835225 GGCGGCGGCGGGGCGGGGGCGGG + Intronic
1061541020 9:131277834-131277856 GGCGGCAGCGGCGCGGCGGCGGG - Intergenic
1062084682 9:134642477-134642499 GGGGGCGGCGGCGCGCCCGCGGG - Intronic
1062325693 9:136011542-136011564 GGCGGCCGCGGCCCGGAGGCCGG - Exonic
1062341420 9:136095320-136095342 GGCGGGGGCGGGGCGGCGGCGGG + Intergenic
1062462113 9:136666357-136666379 GGGGGCTGCGGGGCTGCTGCCGG + Intronic
1062562583 9:137148297-137148319 TGGGCCTGCGGCTCGGCGGCTGG - Intronic
1062696272 9:137877794-137877816 GGCGGCTGCGGCGGTGGGGCCGG + Exonic
1203771688 EBV:52931-52953 GGCGGCGGCGGCGCTGAGGCGGG + Intergenic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1186350113 X:8731931-8731953 CGCGGCTGCTGCGCGGCGGCTGG - Exonic
1186413276 X:9362036-9362058 GGAGGCTGAGGCGGGGGGGCGGG + Intergenic
1188542575 X:31266634-31266656 GGTTCCCGCGGCGCGGCTGCAGG - Intronic
1188835404 X:34948404-34948426 GGTGGCTGAGGCTCAGGGGCAGG - Intergenic
1192455164 X:71270051-71270073 GGTGGCAGCTGGGCGGCAGCTGG + Intergenic
1192624547 X:72714123-72714145 GGCGCCTGGGGCGCTGCGGCGGG - Intronic
1192656938 X:73002819-73002841 TGTGGCTGCTGCGGGGCTGCGGG - Intergenic
1192665182 X:73080182-73080204 TGTGGCTGCTGCGGGGCTGCGGG + Intergenic
1192903317 X:75522971-75522993 GGGGGCTGCGGTGCTGCCGCCGG - Exonic
1193391011 X:80929432-80929454 AGGGGCTGCAGCGCGGAGGCAGG - Intergenic
1196124312 X:112082901-112082923 AGTGGCTTCGGCCCGGGGGCTGG - Intergenic
1196393471 X:115233953-115233975 GGTGGCTGTGGCACGGCTGGAGG - Exonic
1198450988 X:136767188-136767210 GGAGGCGGCGGCGGCGCGGCTGG - Intronic
1200078163 X:153562082-153562104 GGTGGCTCAGGAGCCGCGGCTGG + Intronic
1200177189 X:154125475-154125497 GGCTGCTGCGGAGCGGGGGCTGG - Intergenic