ID: 966696338

View in Genome Browser
Species Human (GRCh38)
Location 3:182793721-182793743
Sequence TCCGGGTCCCGCGGGGCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 273}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966696338_966696352 5 Left 966696338 3:182793721-182793743 CCCCGCGCCCCGCGGGACCCGGA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 966696352 3:182793749-182793771 ACGACGGGGGAATGTGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25
966696338_966696355 25 Left 966696338 3:182793721-182793743 CCCCGCGCCCCGCGGGACCCGGA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 966696355 3:182793769-182793791 TGGATCCGGCAGCAGCTGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 135
966696338_966696353 11 Left 966696338 3:182793721-182793743 CCCCGCGCCCCGCGGGACCCGGA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 966696353 3:182793755-182793777 GGGGAATGTGGCGCTGGATCCGG 0: 1
1: 0
2: 0
3: 18
4: 161
966696338_966696348 -8 Left 966696338 3:182793721-182793743 CCCCGCGCCCCGCGGGACCCGGA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 966696348 3:182793736-182793758 GACCCGGACGGCGACGACGGGGG 0: 1
1: 0
2: 1
3: 5
4: 59
966696338_966696347 -9 Left 966696338 3:182793721-182793743 CCCCGCGCCCCGCGGGACCCGGA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 966696347 3:182793735-182793757 GGACCCGGACGGCGACGACGGGG 0: 1
1: 0
2: 1
3: 10
4: 78
966696338_966696351 -1 Left 966696338 3:182793721-182793743 CCCCGCGCCCCGCGGGACCCGGA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 966696351 3:182793743-182793765 ACGGCGACGACGGGGGAATGTGG 0: 1
1: 0
2: 0
3: 0
4: 31
966696338_966696346 -10 Left 966696338 3:182793721-182793743 CCCCGCGCCCCGCGGGACCCGGA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 966696346 3:182793734-182793756 GGGACCCGGACGGCGACGACGGG 0: 1
1: 0
2: 0
3: 4
4: 45
966696338_966696354 21 Left 966696338 3:182793721-182793743 CCCCGCGCCCCGCGGGACCCGGA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 966696354 3:182793765-182793787 GCGCTGGATCCGGCAGCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966696338 Original CRISPR TCCGGGTCCCGCGGGGCGCG GGG (reversed) Exonic
900190198 1:1349895-1349917 TCCGGGGCTCGCGGGGCTGGAGG + Intergenic
901082882 1:6593378-6593400 TCGGGGTCCCGCGGCGGCCGGGG + Exonic
901332769 1:8423731-8423753 CGCGGGGCCCGGGGGGCGCGGGG + Intronic
902214244 1:14924456-14924478 TGCGGGTCCCGGGGGCCGCGCGG - Intronic
902585631 1:17437695-17437717 TCCGGCGCCCGGGGGGGGCGGGG - Intronic
903526493 1:23994969-23994991 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
903923426 1:26817443-26817465 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
904050200 1:27634266-27634288 CCCGGATCCAGCGGGGAGCGCGG + Intronic
904199740 1:28812110-28812132 TCCGGGCCACGTGGTGCGCGCGG + Intergenic
904794827 1:33051313-33051335 GACGGGCCCCGCGGGGCCCGAGG + Intronic
906436931 1:45804039-45804061 GACGGGCCCCGCGGGGCCCGAGG + Exonic
906486657 1:46240474-46240496 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
906719769 1:47996793-47996815 GCCAGGGCCCGCGGGGCGCGGGG + Exonic
907296588 1:53459777-53459799 CCCGGGACCCGAGGGCCGCGCGG + Exonic
912401484 1:109397500-109397522 TCCGGGAGTCGCGGGGCGCACGG + Intronic
912825477 1:112899319-112899341 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
912844667 1:113068786-113068808 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
913975323 1:143450792-143450814 GCCGGGTCCCGGAGCGCGCGGGG + Intergenic
914069715 1:144276408-144276430 GCCGGGTCCCGGAGCGCGCGGGG + Intergenic
914109440 1:144689946-144689968 GCCGGGTCCCGGAGCGCGCGGGG - Intergenic
918066475 1:181105241-181105263 TCCGGGCCCGGCGGGCCGAGGGG + Intergenic
1062843808 10:689773-689795 GCCGGGGACCGTGGGGCGCGGGG - Intergenic
1062932622 10:1363045-1363067 TCCTGGCCCTGCCGGGCGCGTGG + Exonic
1064354243 10:14603840-14603862 GCCGGGCGCCGCGGGGCGAGGGG + Intronic
1065335699 10:24655547-24655569 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1065342960 10:24723624-24723646 TCCGGCTCACGCCGGGCGGGCGG - Exonic
1066126298 10:32346515-32346537 CCCGGGTCCCGCGGAGTTCGGGG - Intronic
1066665698 10:37780782-37780804 CCAGGGTCCCGCGCGGCTCGGGG - Intronic
1070318248 10:75334200-75334222 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1070326928 10:75395678-75395700 TCCGAGTCACCCCGGGCGCGCGG - Intergenic
1071997572 10:91163034-91163056 GGCGGGCCGCGCGGGGCGCGTGG - Intronic
1072150166 10:92675988-92676010 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1072950119 10:99840128-99840150 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1073063652 10:100746122-100746144 CCCGGCTGCTGCGGGGCGCGCGG - Exonic
1074086346 10:110210859-110210881 TGCGGGTCGCTCGGCGCGCGCGG + Intronic
1076734668 10:132453260-132453282 TCCGGTTCCTGCGGGGCCGGCGG - Intergenic
1077201408 11:1309333-1309355 CCCGGGGCACGCGGGGCGCCTGG - Intronic
1077297413 11:1832594-1832616 GCCGGGTCCCGAGGGGCGGACGG + Intronic
1078090737 11:8263089-8263111 GCCGGGACCCGGGGGGCGTGCGG + Intronic
1081784948 11:45739177-45739199 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1094040970 12:26122115-26122137 TCCGGGTTCCCCGGCTCGCGGGG + Exonic
1095584580 12:43836172-43836194 GAAGGGTCGCGCGGGGCGCGGGG - Exonic
1096022479 12:48333766-48333788 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1096241318 12:49961762-49961784 TCGGGGGCCAGCGCGGCGCGCGG - Intergenic
1096533908 12:52258675-52258697 TCCCGGCTCCGCGAGGCGCGAGG - Intronic
1097245340 12:57604888-57604910 AGCGGGGCCCGGGGGGCGCGCGG - Intronic
1101716734 12:107318859-107318881 AGCGAGTGCCGCGGGGCGCGGGG - Exonic
1101892835 12:108731584-108731606 GTTGGGTCCCGCGCGGCGCGGGG - Intronic
1102973552 12:117190156-117190178 GCCCGGCCCCGGGGGGCGCGGGG + Intronic
1103091993 12:118104054-118104076 GCCGGGTCCCGCCGGGCCAGGGG + Intronic
1103510042 12:121467600-121467622 GCCGGGCCGGGCGGGGCGCGGGG - Intronic
1103899324 12:124295270-124295292 TCCGGGGCGCGGGGGGCGCCGGG + Intronic
1104865446 12:131950536-131950558 TCCGGGACGCCCGGGACGCGGGG - Intronic
1105031537 12:132887547-132887569 TCCGGGTTCGGCGCGGGGCGGGG - Exonic
1105871156 13:24507068-24507090 TCCGGGGCCGGCGGGGCCAGCGG + Intronic
1106517042 13:30465005-30465027 TGCGGGGGCGGCGGGGCGCGCGG - Intronic
1107133348 13:36919730-36919752 CCCGGGGCCCGCGGCGCGGGCGG + Intronic
1107945960 13:45418123-45418145 GCCGGGCTCGGCGGGGCGCGAGG - Intronic
1110269183 13:73574277-73574299 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1111672554 13:91348324-91348346 TCCGGGGCCCGGGGCGCGCGCGG + Intergenic
1113082710 13:106535137-106535159 TCCGGGGCCCTCAGGGCGCGGGG + Intergenic
1113611220 13:111646060-111646082 GCTGGGGCCGGCGGGGCGCGGGG + Intronic
1114493358 14:23117026-23117048 TCCAGGTCCTGTGGGGGGCGGGG + Intergenic
1114554880 14:23556208-23556230 GCCGGGACCTGCCGGGCGCGCGG + Exonic
1115203238 14:30875075-30875097 GCCGGGGCCCGCGGGCAGCGAGG + Exonic
1115609554 14:35038543-35038565 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1117157023 14:52951239-52951261 TGCGGGTCCCGGGCGGGGCGGGG + Intronic
1119046351 14:71321198-71321220 CCCGGGTCCTGGGGGGAGCGGGG + Intronic
1122688941 14:103522592-103522614 GCCGCGTCCCGGGGGGCGCCGGG - Intronic
1122719628 14:103715142-103715164 TCCGGGGCCCCCGGTGCGCGCGG - Intronic
1122964017 14:105112698-105112720 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1123047587 14:105526480-105526502 CCCAGGTCCGGCGGGGCTCGCGG + Intergenic
1124848280 15:33311758-33311780 TCCCTGTCCTGCGGGGCTCGCGG - Intronic
1125659010 15:41381931-41381953 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1128089723 15:64911568-64911590 CCCGAGTCCCGAGAGGCGCGAGG + Intronic
1129116626 15:73368485-73368507 CCCGGGCCCGGCTGGGCGCGGGG + Exonic
1129428278 15:75480804-75480826 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1131838093 15:96409892-96409914 TCCGGGCCGCGCGGGGCTGGTGG - Intergenic
1132365038 15:101251269-101251291 TCCCAGGCCGGCGGGGCGCGCGG - Exonic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1136459447 16:30400515-30400537 CCCAGGCCCCGCGGGGCGCCGGG - Intergenic
1137267929 16:46884204-46884226 TCCCGGTCCGGCCCGGCGCGGGG + Intergenic
1138179784 16:54933345-54933367 TCCGGGTCCCGGCGGGCCCTCGG + Exonic
1138615282 16:58160558-58160580 GCTGGGTGCCGCGGGGCTCGTGG - Intronic
1140224474 16:73066872-73066894 TCCGTATCCCGCGGGGCTGGGGG - Intergenic
1141538468 16:84699951-84699973 GCCGCGCGCCGCGGGGCGCGGGG - Intergenic
1141665430 16:85463051-85463073 CCCGGGTCCCGCGGCCCGGGGGG + Intergenic
1141832192 16:86516008-86516030 TCCAGGTCTAGCGGGGCGGGAGG + Intergenic
1142238427 16:88934184-88934206 TCCGTGTGCCGAGGGGCGTGGGG - Intronic
1142240423 16:88942040-88942062 CCCGGGACCCGCGGGAAGCGAGG - Intronic
1142552882 17:751941-751963 TCCGGGTCCCGCCGCGCGTTGGG - Intronic
1142638268 17:1270935-1270957 CGCAGGGCCCGCGGGGCGCGGGG - Exonic
1142812289 17:2401003-2401025 CCCGGGGGCCGCGGGGCGGGAGG - Exonic
1142855007 17:2724415-2724437 TCCGGGTCCCCGGGCGCGCTGGG + Intergenic
1143063360 17:4222217-4222239 TCCGGGGTCCGCGGGGCGGCGGG - Intronic
1145205672 17:20984013-20984035 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1147123711 17:38351959-38351981 TCCGGGGGCCGCGGCGGGCGGGG + Intergenic
1147963189 17:44180015-44180037 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1148013387 17:44503572-44503594 TCCGGGTCGCGCGCGGAGCAGGG - Intergenic
1148740707 17:49890853-49890875 TCCTGTTCCCGCTGGGAGCGGGG + Intergenic
1149313787 17:55421223-55421245 TGGGGGTCTCCCGGGGCGCGCGG - Intronic
1149908732 17:60550847-60550869 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1152174971 17:78781776-78781798 TCCGGGTCCCGGGGGGCCGAGGG - Intronic
1152396275 17:80035685-80035707 GCGGGGGCGCGCGGGGCGCGTGG - Intronic
1152758975 17:82098503-82098525 GTCGGGGCCCGCGGGGCGGGAGG - Intergenic
1153051986 18:908413-908435 TGCGGGGCGCGCGGGGCGGGCGG + Intronic
1155392460 18:25351010-25351032 GCCGCGGCCCGAGGGGCGCGCGG - Intronic
1157338189 18:46756570-46756592 CCGGGGCCCCGGGGGGCGCGCGG + Exonic
1158137782 18:54224800-54224822 TCCGGCCCCCACTGGGCGCGCGG + Intergenic
1158236588 18:55322564-55322586 GCCGGGGCCCGCGGAGCCCGGGG - Intronic
1159100103 18:63949214-63949236 GGCGGGTCCCGCAGGCCGCGGGG - Intergenic
1159369867 18:67516544-67516566 TCCGGGCCGTGCGGGTCGCGGGG - Exonic
1160540360 18:79617421-79617443 GCGGGGTCCCGGGGGGGGCGGGG - Intergenic
1160592184 18:79951134-79951156 ACCGGGGCCCGGGGCGCGCGAGG + Intronic
1160668474 19:344611-344633 TCCGGGGCCGGAGGGGCGCGGGG - Intronic
1160719190 19:590067-590089 CCCGGGGCCCGGGGGGGGCGCGG - Exonic
1162738137 19:12757932-12757954 TTCGGGACCCGCAGGGGGCGGGG - Exonic
1163906083 19:20150711-20150733 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1164594982 19:29526566-29526588 TCCATCTCCCGCGGGGGGCGCGG - Exonic
1164653336 19:29901704-29901726 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1164989591 19:32674727-32674749 TTCGGATCTGGCGGGGCGCGGGG - Intronic
1165349482 19:35268403-35268425 CCGGGGCTCCGCGGGGCGCGAGG - Intergenic
1165668604 19:37655536-37655558 TCCGGGCCGGGAGGGGCGCGTGG + Intronic
1166261442 19:41644243-41644265 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1166677278 19:44747856-44747878 GCCGGGGCCCGCGGGGCACCGGG - Intronic
1166852646 19:45767888-45767910 TCAGGCGCCCGCGGGGCGCGGGG - Intronic
1166857930 19:45792499-45792521 TCCGGGGCCTGCGGGCGGCGGGG + Exonic
1167466081 19:49651692-49651714 TCGGGGGCCCGCGGAGCGGGAGG - Exonic
927357070 2:22186441-22186463 CCCGGGGCCGGCGGGGCCCGCGG - Intergenic
928998741 2:37324839-37324861 GCCGGGGCGCGCGGGGGGCGGGG + Intergenic
929614376 2:43296872-43296894 GACGGGCCCCGCGGGGCCCGAGG + Intronic
933684560 2:85133295-85133317 TCCGGGTTCCGCGAGGCGCGCGG + Intergenic
934180023 2:89611765-89611787 GCCGGGTCCCGGAGCGCGCGGGG + Intergenic
934290318 2:91686026-91686048 GCCGGGTCCCGGAGCGCGCGGGG + Intergenic
934521995 2:95025595-95025617 GCCGGGTCTCCCGGGGCGTGGGG + Intergenic
934951271 2:98577162-98577184 GCCGGGGCAGGCGGGGCGCGCGG - Intronic
936278613 2:111120374-111120396 TCCGCGTCCCGCCCGGCGCCAGG + Intronic
937045651 2:118850030-118850052 GCCGGGCCGCGCGGCGCGCGGGG - Intergenic
937919688 2:127120501-127120523 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
939003991 2:136765395-136765417 TCCGAGAGCCGCGGGGCGCGGGG - Intergenic
942278572 2:174340457-174340479 TGCAGGTCCCGCTGGCCGCGCGG + Intergenic
946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG + Exonic
946622162 2:221572461-221572483 TCCGGGCTCCACGGGGCGCGCGG + Intronic
946908983 2:224442361-224442383 TCCGGGTCCCGGGGCGAGTGCGG - Intergenic
947650273 2:231780902-231780924 GCCGGGTCCCGCCGGGTGCTCGG + Intronic
1170425167 20:16228411-16228433 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1171010294 20:21505860-21505882 TCCGGGTCCCGCCGGACCCCCGG - Intergenic
1171908681 20:30921713-30921735 TCCGGGTTCCTCGGGGTGCACGG + Intergenic
1172101191 20:32484492-32484514 TCGGGTGCCCGCGGGGGGCGGGG - Intronic
1172245608 20:33443442-33443464 TCCTGCTCCCGCGGAGCGCCGGG + Exonic
1172350058 20:34231338-34231360 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1172654353 20:36527896-36527918 TCCGGTGCCCGAGGGGCGGGCGG + Exonic
1173279954 20:41618717-41618739 CCGGGGTCCCGCGGGCCGAGGGG + Intergenic
1175429482 20:58891553-58891575 GCCGCGGGCCGCGGGGCGCGCGG - Intronic
1176100288 20:63361501-63361523 TCCCCGTCCCCCTGGGCGCGCGG - Intronic
1176185332 20:63775354-63775376 TCCGGGTCGCGCAGGGGCCGGGG - Intronic
1176548734 21:8212754-8212776 TCCGGGCTCCTCGGGGTGCGCGG + Intergenic
1176550434 21:8218679-8218701 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1176556629 21:8256963-8256985 TCCGGGCTCCTCGGGGTGCGCGG + Intergenic
1176567665 21:8395789-8395811 TCCGGGCTCCTCGGGGTGCGCGG + Intergenic
1176569363 21:8401718-8401740 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1176575568 21:8440005-8440027 TCCGGGCTCCTCGGGGTGCGCGG + Intergenic
1176577276 21:8445949-8445971 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1177178635 21:17721115-17721137 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1178981467 21:37268099-37268121 GCCGGGCTCCGCGGGCCGCGAGG + Intergenic
1179243852 21:39613122-39613144 GCCGGGTCCTGCGGCGCGCGGGG + Intronic
1179810299 21:43865497-43865519 GCCGCGCTCCGCGGGGCGCGGGG + Intronic
1180064396 21:45405318-45405340 GCCGGGTCCTGCGGGGGTCGCGG + Intronic
1181165129 22:20979257-20979279 CCTGGGTCCCGCAGGGCGCGTGG + Exonic
1181917538 22:26292801-26292823 TCCGGGTCCCCCGGTGGGCCAGG - Exonic
1182289823 22:29268544-29268566 TCCGGCGCCCGTGGCGCGCGGGG + Intronic
1183654063 22:39175036-39175058 TTCGGGTCCCCCGGGGGGCCAGG - Intergenic
1183841634 22:40502715-40502737 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1183845109 22:40536437-40536459 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1184207426 22:43014368-43014390 TCCGTGTCCCGGGGGGGGGGGGG - Intronic
1184207557 22:43014818-43014840 TCGGGGCCCCGGGGGGCGCCTGG - Intronic
1184228307 22:43143319-43143341 TCCGGGTCGCACGGGTAGCGTGG - Exonic
1184265346 22:43343268-43343290 TGCGGGCCCCGCTGGGCGTGCGG + Exonic
1184697956 22:46150369-46150391 CCCGGGGCCCGGAGGGCGCGCGG + Intergenic
1185259513 22:49853814-49853836 CCAGGGCCCCGCGCGGCGCGGGG - Intergenic
1185398324 22:50603728-50603750 TGGTGGGCCCGCGGGGCGCGGGG + Intronic
1203253617 22_KI270733v1_random:129059-129081 TCCGGGCTCCTCGGGGTGCGCGG + Intergenic
1203255330 22_KI270733v1_random:135018-135040 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1203261673 22_KI270733v1_random:174138-174160 TCCGGGCTCCTCGGGGTGCGCGG + Intergenic
950053970 3:10011057-10011079 TGCGGGTCCCGCGGCTCCCGCGG - Intronic
952896682 3:38082458-38082480 GACGGGCCCCGCGGGGCCCGAGG - Intronic
953657047 3:44862191-44862213 TGCGGGGCCCGCGGGGCTCTTGG + Intronic
954080524 3:48210861-48210883 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
955297224 3:57746955-57746977 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
955400118 3:58585521-58585543 AGCGGGCCGCGCGGGGCGCGGGG + Intronic
956270213 3:67443384-67443406 GACGGGCCCCGCGGGGCCCGAGG + Intronic
959042499 3:101438866-101438888 GACGGGCCCCGCGGGGCCCGAGG + Intronic
959419589 3:106112636-106112658 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
965757600 3:172040828-172040850 TCCGGTTCCCACGGGACGCCGGG - Intronic
966359453 3:179119490-179119512 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
966696338 3:182793721-182793743 TCCGGGTCCCGCGGGGCGCGGGG - Exonic
966936276 3:184711771-184711793 TCCCGGTCCCGCAGGCCGAGGGG - Exonic
968697687 4:2041021-2041043 TCCGGGTCCTGCACGGCGAGCGG + Intronic
969413361 4:7043495-7043517 GGCGGGTCCCGCGGGCGGCGGGG + Exonic
969559541 4:7938863-7938885 GGCGGGCCCCGGGGGGCGCGGGG - Intronic
971018977 4:22515792-22515814 GCCGGGGCCTGCGGGGCGAGCGG + Exonic
972725854 4:41746061-41746083 TCCGGGGGCGGCGGGGCCCGGGG - Exonic
972739875 4:41879158-41879180 GCCAGGGCCAGCGGGGCGCGGGG - Intergenic
973292338 4:48483287-48483309 GGCGGGGCCTGCGGGGCGCGGGG + Intergenic
973620596 4:52722150-52722172 TACGGGTCCTGCGGGTCCCGCGG + Intergenic
977231063 4:94451973-94451995 CTCGGGTCCGGCGCGGCGCGGGG - Exonic
984715122 4:182917651-182917673 CCCGGGTCACGCGTGGCGCTGGG + Intronic
984953238 4:185021364-185021386 ACCCGGGCCAGCGGGGCGCGTGG + Intergenic
985550112 5:528575-528597 TCCGGGGCGGGCGGGGCGGGCGG - Intergenic
986733088 5:10649505-10649527 TCCGGGCCCCGCACGGAGCGCGG - Exonic
992039631 5:72816933-72816955 CCCGGGTCCCGCAGGGCGCCTGG - Intronic
992373718 5:76171073-76171095 GACGGGCCCCGCGGGGCCCGAGG + Intronic
993901170 5:93584960-93584982 GCCGAGGGCCGCGGGGCGCGCGG - Exonic
994185026 5:96807549-96807571 TCCCTGTCCCTCCGGGCGCGTGG - Intronic
996948266 5:129095165-129095187 CCCGGGTCCCGGGCGGCTCGGGG - Intronic
998087979 5:139342236-139342258 TCCGGGTCCTCAGTGGCGCGAGG + Intronic
998374547 5:141682142-141682164 GCAGGGACCCGGGGGGCGCGGGG + Intronic
998797462 5:145835252-145835274 CGCGGGGCCCGCGGCGCGCGGGG - Exonic
1000318979 5:160118995-160119017 CCCGGCTCCCGAGGAGCGCGAGG - Exonic
1000345851 5:160312634-160312656 CCCCCGCCCCGCGGGGCGCGGGG - Intronic
1000345854 5:160312635-160312657 CCCGCGCCCCGCGGGGCGGGGGG + Intronic
1000985245 5:167858843-167858865 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1002341414 5:178518805-178518827 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1002363152 5:178689492-178689514 TCCGGGACCCGCTGGGCCCACGG - Intergenic
1004387946 6:15188460-15188482 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1004504769 6:16238823-16238845 TCCGGGTGGCGCGGGGCAAGTGG + Intronic
1004720616 6:18264769-18264791 GCTGTGTCCCGCGGGGCGGGCGG + Exonic
1005838146 6:29723414-29723436 TATGAGTCCCGCGGGGTGCGTGG - Exonic
1005875277 6:30006556-30006578 TCCGAGTCCCGGTGGGTGCGTGG - Intergenic
1006492128 6:34396993-34397015 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1007576655 6:42929511-42929533 TCCTCCTCCCGCGGCGCGCGCGG - Exonic
1011405425 6:87010810-87010832 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1013106129 6:107028144-107028166 AGCGGGTCGGGCGGGGCGCGAGG - Intergenic
1015476537 6:133664303-133664325 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1016739149 6:147509402-147509424 TCCGGGCGGCCCGGGGCGCGCGG + Intronic
1017470381 6:154733196-154733218 TCCCGCGTCCGCGGGGCGCGGGG + Intergenic
1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG + Intergenic
1018400467 6:163415090-163415112 GCCGGGTCCCGAGCGGCCCGCGG + Exonic
1018858351 6:167691757-167691779 TCTGGGTCACGCGGGGCCCCCGG - Intergenic
1019771525 7:2886505-2886527 TCCGGGTCACATGGGGCGGGAGG + Intergenic
1020213196 7:6170507-6170529 CCCGGGTCCCGCTGGGCCGGCGG + Intronic
1020616630 7:10466430-10466452 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1021653596 7:22854143-22854165 TCCGGGCCCCGCGGGCGGGGCGG + Intergenic
1021872146 7:25017968-25017990 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1022528387 7:31052591-31052613 TCCGCGGCCCGCGCGGCGCGGGG - Exonic
1022528513 7:31053034-31053056 TCCGGGTCCCTCCGGCCGCATGG - Intronic
1026523057 7:71132740-71132762 TCGGGCTCCGGCGAGGCGCGGGG - Exonic
1026665509 7:72337056-72337078 TCCCGCTCCCGCTGGCCGCGCGG + Intronic
1029496389 7:100897220-100897242 CCCGGTTCCCGTGGGGCGAGCGG - Intergenic
1033220457 7:139523830-139523852 TGGGGGGCCCGCAGGGCGCGCGG + Intergenic
1034344816 7:150379556-150379578 CCCGGGGCTCGGGGGGCGCGCGG - Intronic
1035508107 8:150592-150614 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1036536872 8:9658303-9658325 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1036691702 8:10948644-10948666 ACCGGGTCCTGCGGGGTGGGAGG - Intronic
1038644175 8:29349493-29349515 TCCAAGTACCACGGGGCGCGTGG - Intronic
1042048817 8:64685198-64685220 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1042059087 8:64798402-64798424 TCTGGGTCGCGCGCGGCCCGCGG + Intronic
1044660468 8:94590228-94590250 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1047848269 8:128827129-128827151 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1049716414 8:144095134-144095156 TGTTGGGCCCGCGGGGCGCGGGG + Exonic
1049785762 8:144449997-144450019 GCGGGTTCCGGCGGGGCGCGGGG - Exonic
1051641673 9:19230274-19230296 TGCGACCCCCGCGGGGCGCGGGG - Intergenic
1053008510 9:34620379-34620401 TACGGGCCGGGCGGGGCGCGCGG - Exonic
1053256035 9:36616017-36616039 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1053457071 9:38241564-38241586 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1055447007 9:76394038-76394060 GCCGGGTCACGTGGGGAGCGGGG - Intronic
1057516870 9:95729277-95729299 CCCGGGTCCCGCGGGCTGCAAGG + Intergenic
1059210863 9:112513724-112513746 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1060051880 9:120383712-120383734 TCGGGGGCCCGCGGGGCTCTGGG + Intergenic
1060064782 9:120495077-120495099 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1061293944 9:129666972-129666994 ACAGGGTCCCCCGGGGCGGGTGG - Intronic
1061984088 9:134119045-134119067 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1062567339 9:137169071-137169093 GCCAGGTCCCGCAGGGCGAGCGG + Exonic
1062599777 9:137314610-137314632 TCCGGGGCCCTGGGGGCGGGGGG - Intronic
1203470019 Un_GL000220v1:112207-112229 TCCGGGCTCCTCGGGGTGCGCGG + Intergenic
1203471728 Un_GL000220v1:118155-118177 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1203477840 Un_GL000220v1:156179-156201 TCCGGGCTCCTCGGGGTGCGCGG + Intergenic
1185469360 X:373502-373524 TCGGGCAGCCGCGGGGCGCGCGG + Intronic
1185778966 X:2829315-2829337 TCCAGGCGCGGCGGGGCGCGGGG + Intronic
1186423251 X:9443480-9443502 AACGGGTCCCACGCGGCGCGGGG + Intergenic
1191085530 X:56563751-56563773 GCCGGGTCAGGCGGGGAGCGCGG - Exonic
1191618309 X:63190318-63190340 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1192621083 X:72680858-72680880 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1193969970 X:88039135-88039157 CCCGGGTCGGGCGGGGGGCGGGG - Intergenic
1195036318 X:100973376-100973398 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1196404612 X:115348252-115348274 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1196804805 X:119574650-119574672 TCGGGTTCCCGCGGCGGGCGAGG - Exonic
1200003107 X:153072212-153072234 CCCGGGACCCGCGGCGCGAGGGG + Intergenic
1200004616 X:153077797-153077819 CCCGGGACCCGCGGCGCGAGGGG - Intergenic