ID: 966696409

View in Genome Browser
Species Human (GRCh38)
Location 3:182793907-182793929
Sequence CCCCGCGCCCGTCTCCGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966696409_966696417 11 Left 966696409 3:182793907-182793929 CCGCAGCGGAGACGGGCGCGGGG 0: 1
1: 0
2: 2
3: 24
4: 197
Right 966696417 3:182793941-182793963 AGAAGCCCCGTGCGGCTCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 100
966696409_966696416 10 Left 966696409 3:182793907-182793929 CCGCAGCGGAGACGGGCGCGGGG 0: 1
1: 0
2: 2
3: 24
4: 197
Right 966696416 3:182793940-182793962 GAGAAGCCCCGTGCGGCTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 100
966696409_966696414 3 Left 966696409 3:182793907-182793929 CCGCAGCGGAGACGGGCGCGGGG 0: 1
1: 0
2: 2
3: 24
4: 197
Right 966696414 3:182793933-182793955 AGAGCCGGAGAAGCCCCGTGCGG 0: 1
1: 0
2: 1
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966696409 Original CRISPR CCCCGCGCCCGTCTCCGCTG CGG (reversed) Intronic
900570611 1:3356422-3356444 CCCCACTCCCGTCTCCCCGGAGG - Intronic
901146737 1:7070004-7070026 CCTCTCGCCCTCCTCCGCTGGGG + Intronic
904837747 1:33349917-33349939 TCCCGCGGCCGCCTCCGCCGGGG + Intronic
906168934 1:43707672-43707694 CCCTGCCTCCCTCTCCGCTGTGG + Exonic
907689153 1:56645263-56645285 CCCCGCGCCCCTCGCGGCTCGGG + Intronic
913565552 1:120069377-120069399 CCCTGCGCCCCGCTCTGCTGTGG - Exonic
913959291 1:143326854-143326876 GCCCGCCCGCGTCTCTGCTGAGG + Intergenic
914286149 1:146228752-146228774 CCCTGCGCCCCGCTCTGCTGTGG - Exonic
914547180 1:148679505-148679527 CCCTGCGCCCCGCTCTGCTGTGG - Intronic
916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG + Exonic
919936678 1:202255485-202255507 CCCAGCGCCCTTCCCCGCTCAGG + Intronic
921310419 1:213837104-213837126 CCCAGCTCCCATCTCTGCTGTGG + Intergenic
1072089635 10:92115041-92115063 CCCCGCGCCCGCGGCCGCCGGGG - Intronic
1072667021 10:97401055-97401077 CCCCGCCCCCGGCTGCGCTCGGG + Intronic
1073044997 10:100631898-100631920 CCTCCCGCCCGTGCCCGCTGCGG + Intergenic
1073325833 10:102643699-102643721 CCGCGCGCCCGTCTCCGCGCTGG - Intergenic
1076395712 10:130136311-130136333 CCCCGCCCCTGCCTGCGCTGAGG - Intergenic
1076836222 10:133022313-133022335 CACCGCGCTTGTCTCCGCTGAGG + Intergenic
1076993472 11:287705-287727 CCCCGTCCCCTACTCCGCTGCGG - Intergenic
1077394246 11:2313354-2313376 CTCTGCGTCCGCCTCCGCTGTGG - Intronic
1078164527 11:8870963-8870985 CGCCGCGCCCGGCCCGGCTGGGG - Intronic
1083809719 11:65096737-65096759 CCCCGCGCCTGTCAACGCTTGGG - Intronic
1084165301 11:67372613-67372635 CCCCGCCCCCGCCCCCGCCGCGG - Intronic
1085011248 11:73142713-73142735 CGGCGCGCGCGTCTCCGCTCGGG + Intergenic
1086187274 11:84033748-84033770 CACCGCGCCCGGCCCGGCTGTGG - Intronic
1088896529 11:114082911-114082933 CCGCGGGCCAGTCTCGGCTGTGG + Intronic
1089243075 11:117098283-117098305 CCCCGCTGCCGTGTCCCCTGCGG - Exonic
1091769420 12:3141458-3141480 CCCCGGGCCCTGCTCCTCTGAGG + Intronic
1092270295 12:7018395-7018417 CCCCTCGTCCCCCTCCGCTGAGG + Exonic
1094375348 12:29783537-29783559 CCCGGCGCCCCGCTCCGCTGGGG - Exonic
1096143753 12:49264458-49264480 GCCCGCTCCCCTCGCCGCTGAGG - Intronic
1096411224 12:51378456-51378478 CCCAGTGCCCTTCTCTGCTGAGG + Intronic
1101403070 12:104404940-104404962 CCCCTGTCCCTTCTCCGCTGCGG + Intergenic
1102677553 12:114668834-114668856 CCCAGGGCCCGTCTCAGCTCAGG + Intergenic
1103764782 12:123272030-123272052 CCCCGCGCCCGGCGCCCCGGGGG + Exonic
1104857236 12:131907980-131908002 CCCCGCGCCCGCCGGCACTGTGG - Intronic
1105012028 12:132762127-132762149 CCCCGCGCCCGGCCCCGCCCTGG - Intergenic
1105502881 13:20988336-20988358 CCCCGCCCCCGCCCCGGCTGCGG - Exonic
1105577811 13:21669926-21669948 CTCCGCGCCCGCCGCCACTGGGG + Intergenic
1105578631 13:21674461-21674483 CCGCGCCCCCGCCTCCGCTCCGG + Intronic
1107467550 13:40664833-40664855 GCCCGCGCCCGCCCCCGCCGAGG + Intronic
1107548895 13:41457487-41457509 CCCCGGCCCCGCCTCCGCTCCGG + Intergenic
1110414815 13:75240456-75240478 CCCCGCAGCCGGCTCCGCAGTGG - Intergenic
1112344119 13:98576602-98576624 CCGCGCGCCCGGCTCGGCCGGGG - Intronic
1114423740 14:22605225-22605247 GCCAGCACCCTTCTCCGCTGGGG + Intronic
1116003368 14:39267316-39267338 CCCCGCAGCCGGCTCCGCAGTGG + Exonic
1118186456 14:63542847-63542869 CCCGCCGCCCGCCCCCGCTGCGG - Exonic
1118776949 14:68979181-68979203 CCCTGCGCCCGGTTCCGCCGCGG + Exonic
1119779770 14:77270264-77270286 CCCCCCACCCCTCTCCCCTGCGG + Intronic
1121448600 14:93993885-93993907 ACCTGCGCCCCTCACCGCTGTGG + Intergenic
1122289214 14:100670747-100670769 CCCAGGGCCCATCTCCACTGGGG + Intergenic
1122418234 14:101560530-101560552 CCCCGCGCCCGGGTCGGCTGGGG + Intergenic
1122486637 14:102086689-102086711 TCCCCCGCCCGGCCCCGCTGGGG - Intronic
1122906055 14:104801992-104802014 CCCGGCTGCCCTCTCCGCTGAGG - Exonic
1123084914 14:105712934-105712956 CCGCGCGGCCGTGTCTGCTGGGG - Intergenic
1124922398 15:34039198-34039220 CGCCCCGCCCCGCTCCGCTGCGG - Intronic
1125852826 15:42920746-42920768 CACCGCTCCCATCGCCGCTGCGG + Intronic
1127859982 15:62985945-62985967 CCAGGCTCCCATCTCCGCTGAGG - Intergenic
1127953600 15:63833866-63833888 ACCCGAGCCCGGCTCCGCAGAGG + Exonic
1128622265 15:69160767-69160789 CCCGGAGCGCGTCTCCGCTGAGG + Intronic
1129408551 15:75336254-75336276 CCCCGCCCCCGTCTCGGGAGCGG - Intronic
1132055316 15:98647685-98647707 CCCCGGGCGCGTCCCCGCGGCGG - Intergenic
1132488652 16:212003-212025 CACCGCGCCCGGCCCCTCTGCGG - Intronic
1132495356 16:260596-260618 CCACGAGGCCGGCTCCGCTGGGG - Intronic
1133073748 16:3264131-3264153 ACTCGCGCCGGTCTCCGCTCGGG - Intronic
1133121562 16:3611698-3611720 GCCCGCGCCCGGCGCCGCAGAGG - Intergenic
1135342922 16:21664227-21664249 CCCCGCGCGCGCCTCACCTGCGG - Intergenic
1136027207 16:27476359-27476381 GCCCCTGCCCTTCTCCGCTGTGG - Intronic
1137531734 16:49282328-49282350 CCTCGCGCCCGCGCCCGCTGGGG - Intergenic
1137708015 16:50548611-50548633 CCCCGCCGCCGTCGCCGCCGCGG + Intronic
1137988792 16:53131493-53131515 CCCCGCGCCTGTCATGGCTGCGG + Intronic
1139631826 16:68235982-68236004 CCCCGCGGCCGACCCCGCCGCGG - Exonic
1140500970 16:75433198-75433220 CCCCGCGGGCGTCTGCCCTGTGG - Intronic
1141430594 16:83968709-83968731 CCCAGCGCCCGGCCCTGCTGCGG - Exonic
1142115339 16:88353398-88353420 CCCGGCGCCCACCTCCGCTTGGG + Intergenic
1142753448 17:2001885-2001907 CCCCGTCCCCGGCTCCCCTGAGG + Intronic
1144021178 17:11241107-11241129 CCCCGCGCGCGGCTCGGCTCAGG - Intergenic
1146657019 17:34640505-34640527 CCCCGCGCCAAGCTCCCCTGTGG - Intergenic
1147425198 17:40342829-40342851 CCCCGCTCCGGACTCCGCTTTGG + Intronic
1147661928 17:42121313-42121335 CGCGGCGCCGCTCTCCGCTGCGG - Exonic
1147907112 17:43830639-43830661 CCCTGGGCCCTTCTCCACTGTGG - Intronic
1149454969 17:56780420-56780442 CCCCGCGCCCGCCCTCGCTCCGG + Intergenic
1151438473 17:74113398-74113420 CCCCGCCCCCGCCCCCGCCGTGG - Intergenic
1151657641 17:75503159-75503181 GCCGGCGCCCGCCTTCGCTGAGG + Exonic
1151682185 17:75628086-75628108 CCCCACGCCCGTCCTCCCTGGGG - Intronic
1151780175 17:76240342-76240364 CGCCGCGGCCGGCTCCGCTGCGG + Exonic
1151966933 17:77436459-77436481 CCCCGCCCCCGTCCCATCTGCGG - Intronic
1152625852 17:81387605-81387627 GCCCGCGCCCGGCCCCGCCGCGG + Intergenic
1152748517 17:82051998-82052020 CCCCGCGCCCCCCGCCACTGGGG + Exonic
1152924487 17:83080866-83080888 CCCCGCCCCCGCCCCCGCCGCGG + Intronic
1153480718 18:5543742-5543764 CCCCGCGCCCGGCGCGGCCGGGG - Intronic
1154354501 18:13614872-13614894 CACCACACCCGTCTCTGCTGAGG + Intronic
1154445322 18:14431146-14431168 CCCGTCCCCCGTCTCCTCTGGGG - Intergenic
1155081799 18:22418010-22418032 CCCCGCAGCCGGCTCCGCAGTGG - Intergenic
1158448795 18:57545082-57545104 CCCCTCTCCAGTCTCCCCTGCGG - Intergenic
1160698384 19:495252-495274 CCCCCCACCCTCCTCCGCTGTGG - Intronic
1160994753 19:1877477-1877499 CCCCGCCCCCGTCCCCGCCCGGG + Intronic
1161443348 19:4304788-4304810 CCCCGCCCCCGACGCCCCTGCGG - Intronic
1162412430 19:10514567-10514589 GCCCGCGCCCGTCTCCAGTCGGG - Exonic
1163415623 19:17184809-17184831 CCCCGTGCCCGTGTGGGCTGTGG + Intronic
1163597061 19:18226364-18226386 CCCCGGGCCCGGCTCCCCTCGGG - Intronic
1163662828 19:18588912-18588934 CCCCGCGCCCGTTCCCGCTTGGG - Intronic
1164625441 19:29724495-29724517 CCCCGCGCCCGGCACAGATGGGG - Intergenic
1165157130 19:33795736-33795758 CCCCTCCCCAGTCTCCGCTTCGG - Intergenic
1165157750 19:33798073-33798095 CCCCCCTCCCGCCTCCGCCGCGG - Intronic
1166193694 19:41193162-41193184 CCCCGCGCCTGACTTCGTTGGGG + Exonic
1166800070 19:45451165-45451187 CCCCGGGACCGCCTCCGCTCGGG + Intronic
1167781436 19:51601512-51601534 CCCGGCGCCTGCCCCCGCTGTGG + Intergenic
926914411 2:17878701-17878723 CCCCGCGCCTGCCGCCGCGGCGG - Intronic
927472269 2:23385399-23385421 CCCCGCGGCCGCCGCGGCTGCGG + Exonic
931487343 2:62706152-62706174 GCCACCGCCTGTCTCCGCTGGGG + Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
937221609 2:120345688-120345710 AGCCGCGCCCGGCTCCGCTCCGG + Intergenic
938407364 2:131039944-131039966 CCCCGCGCCCTGCGCCGCAGCGG - Intronic
947754321 2:232550791-232550813 CCCCGCGCCCGCCCCCGCTGGGG + Intronic
949074513 2:242046652-242046674 CCCGGCGTCTCTCTCCGCTGTGG - Intergenic
949074532 2:242046728-242046750 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074551 2:242046804-242046826 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074562 2:242046842-242046864 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074573 2:242046880-242046902 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074584 2:242046918-242046940 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074595 2:242046956-242046978 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074606 2:242046994-242047016 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074617 2:242047032-242047054 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074628 2:242047070-242047092 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074639 2:242047108-242047130 CCCGGCGTCTGTCTCCGCTGCGG - Intergenic
949074650 2:242047146-242047168 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074661 2:242047184-242047206 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074672 2:242047222-242047244 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074683 2:242047260-242047282 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074694 2:242047298-242047320 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074705 2:242047336-242047358 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074716 2:242047374-242047396 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074727 2:242047412-242047434 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074738 2:242047450-242047472 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074749 2:242047488-242047510 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074760 2:242047526-242047548 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074771 2:242047564-242047586 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074780 2:242047602-242047624 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
949074791 2:242047640-242047662 CCCGGCGTCTCTCTCCGCTGCGG - Intergenic
1170163962 20:13343584-13343606 CCCCGCCCCCGCCCCCACTGTGG + Intergenic
1171299574 20:24048504-24048526 CCAGGCGCACGTCTCAGCTGCGG - Intergenic
1174736721 20:52972221-52972243 CCCCCAGCCCCTCTCCCCTGCGG + Intergenic
1175149861 20:56925246-56925268 CCCCGCGCCCGCCGCCGCTCCGG - Intergenic
1175914568 20:62419665-62419687 GCCCGGGCCCCTCTGCGCTGGGG + Exonic
1176016799 20:62938111-62938133 CCCCGCCCCCGCCTCCGCCGCGG + Exonic
1176062289 20:63177757-63177779 TCCCGCGCCCTTCTCCGCCCAGG + Intergenic
1176121719 20:63457083-63457105 GCCCGCGCCCGTCACTTCTGAGG - Intronic
1176281619 20:64316735-64316757 CGCCGCGCCCCGCCCCGCTGAGG - Intergenic
1177431641 21:20998060-20998082 CCCCACGCCCTTCTCGGCTCAGG + Intergenic
1178839872 21:36130054-36130076 CTCCGCGCCCGCCCCCGCCGCGG - Intergenic
1179654644 21:42837697-42837719 CCCCGCCCCCGTCTCCCCGAGGG + Intergenic
1179674836 21:42974446-42974468 CCCCGCGCCCGCCGCCGCGCAGG + Intergenic
1181078050 22:20394439-20394461 CCCCGCGCCCGGCTGAGGTGGGG - Intronic
1182296975 22:29315613-29315635 CCCCGCGCCCCGCACCGCTGCGG - Exonic
1184510181 22:44928878-44928900 CCCCCCACCCCTCACCGCTGAGG + Intronic
1185037874 22:48489289-48489311 GCGCGCGCCCGCCACCGCTGGGG - Intergenic
1185229539 22:49672275-49672297 CCCCGCCCCCACCCCCGCTGGGG - Intergenic
952416841 3:33097209-33097231 CCCCGCGCCCCGCCCCGCTGTGG + Exonic
961681733 3:128604138-128604160 CCCCCCGCCCTGCTCCTCTGCGG - Intergenic
966696409 3:182793907-182793929 CCCCGCGCCCGTCTCCGCTGCGG - Intronic
969444279 4:7235258-7235280 GCCCGCGCCAGGCTCAGCTGAGG + Intronic
969559851 4:7939906-7939928 CTGGGCGCCCGGCTCCGCTGGGG - Exonic
969619065 4:8269881-8269903 CCCGGCGCCCGGCCCCGCAGCGG + Exonic
969748107 4:9089759-9089781 CCCCACGCCAGTCAACGCTGTGG - Intergenic
972740359 4:41881725-41881747 CCGCGCGCTCCTCTCCGCAGGGG + Intergenic
973613561 4:52658903-52658925 CCCGGCGCCCGTCTCAGCCCCGG - Intronic
973993677 4:56435954-56435976 CCCCGGCCCCTTCTCGGCTGCGG - Intronic
975166944 4:71187453-71187475 GCCCGCGCCCGCCTCCGCCTTGG - Intronic
978903284 4:113978870-113978892 CCACGCGCCCCGCGCCGCTGCGG + Exonic
989368239 5:40679780-40679802 CCCCCCGCCAGTCTTCCCTGCGG + Exonic
996761673 5:126992353-126992375 CCCTGAGCCTGTCTCCTCTGAGG - Intronic
997319182 5:132963693-132963715 CTCTGCGCCCCTCCCCGCTGGGG + Intergenic
997582970 5:135028727-135028749 GCCCGCGCCCTTCCCCGCTCCGG + Exonic
997899923 5:137754695-137754717 CCCCTCGCCCAACTCCGCAGTGG + Intergenic
998119153 5:139561744-139561766 CCCCGCCCCCGTCCCCGCCCCGG + Exonic
999462923 5:151772219-151772241 TCCCGCTCCCGTCCCGGCTGGGG + Intronic
999722028 5:154405439-154405461 CCCCCCGCCCGTGTCGGATGGGG - Intronic
1001617918 5:173057068-173057090 CCCCTCGCCCGTCGCCTCTGAGG - Intronic
1002093497 5:176817856-176817878 CCCCGCGCCCGGCTGCCCCGCGG - Intronic
1002771336 6:292662-292684 CTCCGCGCCCGTCCCCACCGCGG - Intronic
1002925802 6:1605086-1605108 CCCGGCGCCTGGGTCCGCTGCGG + Intergenic
1002928747 6:1619674-1619696 CCCCGCGCCCGGCGCTGCCGGGG + Intergenic
1003072890 6:2958568-2958590 CTCCGTGGCCTTCTCCGCTGGGG - Intronic
1004274161 6:14221091-14221113 CCCCCTGCCCTTCTCCCCTGGGG - Intergenic
1004432006 6:15553876-15553898 CCCCTTGCCCTTCTCCCCTGAGG + Intronic
1004880694 6:20004343-20004365 CCCCGCCCCCGTCTCCTATGTGG + Intergenic
1006043285 6:31271949-31271971 CCCCTCGCTCCTCTCCGCAGAGG + Intronic
1006502370 6:34466749-34466771 CCCCGCTCCCATCCCAGCTGTGG - Intronic
1006908254 6:37547277-37547299 CCCCGCGCCCGGCCCAGCTGTGG - Intergenic
1011099905 6:83709110-83709132 CCCCGCCCCCACCTCAGCTGTGG + Exonic
1011470256 6:87701522-87701544 CGCCGCCTCCTTCTCCGCTGCGG - Exonic
1016923180 6:149316980-149317002 CCCGGCGCCAGCCTCCGCCGCGG + Intronic
1018686628 6:166308421-166308443 CCCGGCCCGCGTCTCAGCTGTGG - Intronic
1019343764 7:520062-520084 CCCCGCGCCCGGCTCCGCGCCGG + Intronic
1019472703 7:1229843-1229865 CTCCGCGCCCGCCTCGGCTCGGG - Intergenic
1019532516 7:1510863-1510885 CACCGCACCCGTCTCCCCTCGGG - Intergenic
1022722935 7:32957307-32957329 CCCAGCCCCCCTCCCCGCTGCGG + Intergenic
1023352202 7:39331797-39331819 CACCGCGCCCGGCCTCGCTGTGG + Intronic
1023773578 7:43582963-43582985 CCCCGCGCCCGACCCCGCCCCGG - Intronic
1025078768 7:55964769-55964791 CCCGGCGCCGGTCTCCGCCCCGG + Intronic
1029109022 7:98202702-98202724 CCCCACCCCGGTCTCCCCTGAGG + Intronic
1035168253 7:157004054-157004076 CCCGTCGCCCGTCTCCTCCGGGG + Intronic
1035352470 7:158256314-158256336 CCCCGCGGCTGCCTCTGCTGAGG + Intronic
1038633040 8:29263230-29263252 TCCCGCCCCCGCCTTCGCTGCGG - Intergenic
1040471243 8:47737586-47737608 CCCCGCGCCCGGCCCCGCCCGGG - Exonic
1043428466 8:80171570-80171592 CGCCGCGCCCGACGCCTCTGGGG - Intronic
1045305166 8:100951773-100951795 GCCGCCGCCCGTGTCCGCTGAGG + Intronic
1047951484 8:129939425-129939447 CCCCGGGCCCGCTTCCTCTGTGG - Intronic
1052824900 9:33167382-33167404 CCCCGCCCCCGCCTTCGCCGGGG - Intergenic
1052997655 9:34559740-34559762 CCCCGCTCCTGCCACCGCTGGGG + Intronic
1055630509 9:78218900-78218922 ACCCGTGCCCATCTCCACTGGGG + Intergenic
1057752522 9:97803881-97803903 GCCGCCGCCCGTCACCGCTGGGG + Intergenic
1057900346 9:98943680-98943702 CCCCGCGCCCGCGTTCGTTGGGG - Exonic
1058467553 9:105244599-105244621 CCGCCCGCCCCTTTCCGCTGGGG + Intergenic
1060263126 9:122093032-122093054 TTCCGCCACCGTCTCCGCTGTGG + Exonic
1060599511 9:124868885-124868907 GCACGCGCCCGGCCCCGCTGAGG + Exonic
1060757268 9:126222992-126223014 TCTCGCCCCCGTCTCCCCTGTGG + Intergenic
1061382509 9:130266675-130266697 CCCCTCGCCTGTCTTCCCTGGGG + Intergenic
1062118743 9:134822725-134822747 CCCCGCGGCTGTCTGAGCTGGGG + Intronic
1062362261 9:136193619-136193641 CCCCGCTCCCCTCCCCGCGGCGG + Intergenic
1190266889 X:48831969-48831991 CCCCGCGCCCGTCCCCGCCGCGG - Exonic
1199772522 X:150983817-150983839 GCCCGCGACGGACTCCGCTGGGG + Intronic
1200155442 X:153972428-153972450 CCCCGCCCCCGGCTCCCCCGCGG - Exonic