ID: 966700206

View in Genome Browser
Species Human (GRCh38)
Location 3:182841027-182841049
Sequence CAGGATGAGCTAGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966700206 Original CRISPR CAGGATGAGCTAGAGGTGGA AGG (reversed) Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
901642374 1:10699195-10699217 GAGGATGAGCTGGAAGTGCAGGG - Intronic
902361596 1:15945133-15945155 CAAGAGGAGCAAGAGGAGGAGGG - Exonic
903367699 1:22815237-22815259 CAGGACAGGCTAGAGATGGAAGG + Intronic
903581914 1:24377399-24377421 TAGGATGAGCAAGAGGAGAAGGG - Intronic
903707780 1:25299590-25299612 GAGGATGAGCAAGTGGAGGAGGG + Intronic
904014661 1:27410115-27410137 GAGGAGGAGCTGGTGGTGGATGG + Exonic
905543348 1:38777836-38777858 CATGATGCGCTAAGGGTGGAAGG + Intergenic
905726894 1:40259711-40259733 AAGGCTGAGGTGGAGGTGGAGGG - Intronic
906717996 1:47984512-47984534 CAAGGTGAACTGGAGGTGGAGGG + Intronic
909492619 1:76242321-76242343 TGGGATGAGCTAGAGTTGGGGGG + Intronic
911258520 1:95660530-95660552 CAGGATGAGCTAAAAGGAGATGG - Intergenic
912449520 1:109760586-109760608 CAGGCAGAGCAAGAGGAGGATGG - Intronic
912564030 1:110572309-110572331 GAGGACGAGCTAGAGCTAGAAGG + Intergenic
913572365 1:120133485-120133507 CAGGATATGCTAGAGGCTGAGGG + Intergenic
915135566 1:153728767-153728789 AAGGATGAGTTAGAGGAGGTAGG + Exonic
916587691 1:166162943-166162965 CAGGGTGTTCTAGAGGTGAATGG - Intronic
916746330 1:167687623-167687645 CAGGCTGAGCTACAGGAGTATGG - Intronic
917734064 1:177904544-177904566 TAGAAAGAGCTGGAGGTGGAGGG - Intergenic
918048383 1:180954568-180954590 GAGGATGAGCTGGAGCTGGCCGG + Intergenic
919341923 1:196321229-196321251 CAGGGTGAGAGAGATGTGGAGGG - Intronic
919579967 1:199359090-199359112 CAAGATGAGTAAGAGGTGGCTGG - Intergenic
919668025 1:200311201-200311223 CAATATGAGCAAGAGGTGCAAGG - Intergenic
919914451 1:202130892-202130914 CAGCAGGAGGGAGAGGTGGAGGG - Exonic
920240225 1:204541582-204541604 CAGGAAGACCTATAGGTAGAAGG + Intronic
922677625 1:227562184-227562206 CAGAAAGAGCACGAGGTGGAGGG - Intergenic
922765091 1:228152408-228152430 CAGGATGAGCAGGAGCTTGATGG + Intronic
922905329 1:229169572-229169594 CAGCATGAGCCAGAGGGGCAGGG + Intergenic
922968678 1:229715839-229715861 TAGGAGCAGCTAAAGGTGGAGGG + Intergenic
923148903 1:231216878-231216900 CAGGTGGAGCTGGAGGTGGCAGG - Exonic
1064837803 10:19554325-19554347 GAGCAGGAGCAAGAGGTGGAGGG + Intronic
1067065589 10:43102363-43102385 CAGGAAGACCTTGAGGTAGACGG - Exonic
1068459354 10:57306932-57306954 CAGGATGAGGTACAGGGGAAGGG + Intergenic
1069557404 10:69407206-69407228 CAGGATGAAGTAGAGGTGGTAGG + Exonic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069808774 10:71143215-71143237 CAAGAGCAGCTACAGGTGGAAGG + Intergenic
1070309223 10:75261270-75261292 CAGGACAAGCTAGAGGTGCTAGG - Intergenic
1073354556 10:102843561-102843583 AAGGTTGAGGAAGAGGTGGAGGG + Intergenic
1073459429 10:103658193-103658215 CAGGCAGAGCCAGAGGTGGCTGG + Intronic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076634727 10:131874892-131874914 GAGGAGGAGCTCGAGGAGGAGGG + Intergenic
1077063104 11:626348-626370 CAGGATGGGGGAGAGGGGGAGGG - Intergenic
1077137146 11:1006178-1006200 CAGGCTGGGCTACAGCTGGAGGG - Intronic
1077607228 11:3620446-3620468 CAGGGAGACCTAGAGGTGGCAGG - Intergenic
1077699278 11:4425147-4425169 TGGGATGAGGTAAAGGTGGAAGG + Intergenic
1078578790 11:12523257-12523279 CAGGATGAGATAGAGGCGCAGGG + Intronic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1080205536 11:29724754-29724776 GAGGGAGAGATAGAGGTGGAGGG + Intergenic
1080565015 11:33500073-33500095 CAGGTTGAGTGAGAGGTAGAAGG - Intergenic
1080589266 11:33707491-33707513 GGGGATGAGCTAGGGGTGCAAGG - Intronic
1081858518 11:46318839-46318861 GAGGATGAGCTAGACGTTGAGGG + Intronic
1082857689 11:57823592-57823614 AAGGATGTCCTTGAGGTGGAAGG + Intergenic
1083272145 11:61577986-61578008 CAGGATGAACCAGAGGGTGAAGG + Intronic
1083287005 11:61666530-61666552 CAGGACCGGCTAGAGGAGGAGGG - Intergenic
1083350204 11:62022602-62022624 CAGGATGACATATAGGGGGAGGG - Intergenic
1083663712 11:64263792-64263814 CAGGGTGAGCTGGGGGTGGGCGG + Exonic
1083803273 11:65058681-65058703 CAGGATGTGGTGGATGTGGATGG - Intergenic
1085017104 11:73181277-73181299 CATGCTGAGCTGGAGGTGCACGG + Intergenic
1085021578 11:73213450-73213472 CAGGAGGAGCTAGGGGGAGATGG + Intergenic
1085179418 11:74521032-74521054 CAGGATGAGGGAGAGCAGGACGG + Intronic
1085661977 11:78376705-78376727 CATGATGAGGGAGAGTTGGAGGG + Intronic
1086453350 11:86938501-86938523 CAGGAGGAGCTGGAAGTGGCTGG + Intronic
1087811745 11:102615900-102615922 CAGCCTGAGGTAGGGGTGGATGG - Intronic
1088809069 11:113377725-113377747 CAGGATGATCTAGAAGAGAAAGG - Intronic
1089250860 11:117160015-117160037 CAATATGAGGTAAAGGTGGAAGG + Exonic
1089459392 11:118643866-118643888 GAGGAAGAGCCAGAGGAGGAGGG - Exonic
1090269839 11:125378405-125378427 ATGGATGATCCAGAGGTGGAAGG - Intronic
1093019075 12:14186462-14186484 GAGGCTGAGGTGGAGGTGGAAGG - Intergenic
1095889026 12:47218590-47218612 CAGGAGGAGGCTGAGGTGGAAGG - Intronic
1096323233 12:50634058-50634080 CAGAATGAGCAAGAGATGGGAGG - Intronic
1097237734 12:57551168-57551190 CATGATGAGGTAGAGCTGGATGG - Intronic
1097244669 12:57600907-57600929 GAGGATGAGTCAGAGGTGGATGG + Exonic
1099438694 12:82673955-82673977 CAGGATGTGATACAGGTGGAGGG - Intergenic
1099970215 12:89492661-89492683 CAGGATGAGGTGCAGGTGTATGG - Intronic
1100684146 12:96967271-96967293 CAGGGTGAACTAGAGGTAGAAGG - Intergenic
1101262723 12:103049014-103049036 GAGAATGAGTTAGAGGTGCAAGG - Intergenic
1102954818 12:117052636-117052658 TGGGCTGAGCTAGAAGTGGAGGG - Intronic
1104197818 12:126558122-126558144 CAGGAGGTGCTAGTGCTGGAGGG - Intergenic
1104617810 12:130285010-130285032 CAGGCTGAGGTGGAGGTGGGGGG + Intergenic
1105590770 13:21790913-21790935 CAGGATGGGGTAGGGCTGGAGGG + Intergenic
1106071214 13:26412859-26412881 TGGGATGAGGTACAGGTGGAAGG + Intergenic
1107172341 13:37357826-37357848 AAGGATAAGCTAGAGTTAGAAGG - Intergenic
1112629317 13:101143132-101143154 CAGGAGGAGGAAGAGGTGGTCGG + Exonic
1112887852 13:104195411-104195433 CAGGATGAGGCAGAAGAGGAAGG - Intergenic
1113149466 13:107246054-107246076 CAGAATGAGATAGAGGAGGGTGG - Intronic
1113366443 13:109681080-109681102 CAGGATGAGGGACAGGTGGCTGG - Intergenic
1113435989 13:110291411-110291433 CGGGATGTGCTAGGGGTGCACGG + Intronic
1113604262 13:111594488-111594510 GAGGAGGAGCTAGAGATGGGAGG + Intronic
1114190463 14:20436315-20436337 CTGTATGACCTACAGGTGGAAGG - Intergenic
1116462769 14:45196867-45196889 CAGGATTAGCAAGAGTTGGTGGG + Intronic
1117273695 14:54170727-54170749 CTGGATGAGTTGGAGATGGATGG - Intergenic
1117274901 14:54183148-54183170 CAAGATGAGCTAGAAGCAGAAGG + Intergenic
1118038360 14:61892299-61892321 GAGTAGCAGCTAGAGGTGGAGGG - Intergenic
1118416627 14:65544127-65544149 AAGAATGAGCCAAAGGTGGAAGG + Intronic
1120192297 14:81450325-81450347 CAGGAGGAGCTGCAGGTTGATGG + Intergenic
1121651491 14:95562260-95562282 CAGGATGAGTTACAGGTGTGTGG - Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1122885763 14:104709669-104709691 CAGGAGGAGGTAGAAGTGGTCGG - Exonic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1125027634 15:35046504-35046526 GAGGATGAGATAGAAATGGATGG - Intergenic
1125686917 15:41568875-41568897 CAGGATGAGCTGACAGTGGAGGG + Exonic
1127508161 15:59614733-59614755 CAGGATGAGATAGAGGAGATAGG - Intronic
1129834407 15:78692930-78692952 GAGGAGGAGCAAGAGGAGGAAGG + Intronic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131605402 15:93898590-93898612 CATGATGTCCTAGAGGTAGAAGG + Intergenic
1132311380 15:100860530-100860552 CATGAAGAGCTGGGGGTGGAGGG - Intergenic
1132617559 16:849365-849387 AAGGTCGAGCCAGAGGTGGAAGG + Intergenic
1133635829 16:7664454-7664476 CAGTATGGGCTAGAGCTGAATGG - Intronic
1133958295 16:10467130-10467152 CAGAGTGAACTAGAGGTAGAAGG - Intronic
1135814773 16:25622558-25622580 CAGGTGGAGGCAGAGGTGGATGG - Intergenic
1135961259 16:26996313-26996335 CAGTAAGTGCCAGAGGTGGAGGG - Intergenic
1136183824 16:28573256-28573278 GAGGAGGAGCTGGAGGTGGGTGG + Intronic
1137665794 16:50248223-50248245 CAGGAAGAGGGAGAGGTGGGCGG - Intronic
1138434378 16:56989127-56989149 CAGGATGAACTAGGGGAGAAGGG - Intergenic
1138676177 16:58653122-58653144 AACCATGAGCTAGAGTTGGATGG - Intergenic
1138945383 16:61843009-61843031 CAGGACCTGCTGGAGGTGGATGG + Intronic
1139188916 16:64839063-64839085 CAAGATGAGCAAGAGGTGGCTGG - Intergenic
1139228284 16:65254590-65254612 CAGGATGAGCTAGAGAACGAAGG - Intergenic
1139344270 16:66292486-66292508 CAGGATGATTGAGAGGAGGAGGG - Intergenic
1139562135 16:67749864-67749886 CAGTCTGAGCTAGACCTGGAGGG - Intronic
1140834586 16:78781404-78781426 GAGGGTGGGCTAGAGGTGGGAGG - Intronic
1140983339 16:80132873-80132895 AAGGGTGAGGTGGAGGTGGAAGG - Intergenic
1142988747 17:3714745-3714767 CAGGATGATCTAGAGCAGCATGG - Exonic
1142994177 17:3751195-3751217 CATGAGGAGCTGGAGGTGGGTGG + Intronic
1143250769 17:5521545-5521567 TGGGATCAGGTAGAGGTGGAAGG + Exonic
1143331875 17:6143371-6143393 ATGGAGGAGCTAGAGATGGATGG - Intergenic
1143391491 17:6561523-6561545 GAGGATGAGGAAGAGGAGGAGGG - Intergenic
1143615103 17:8044987-8045009 CAGGCTGAGCTAGAGGTGAGGGG + Exonic
1143689072 17:8545415-8545437 AAGGACGAGCTAGAGGAAGAGGG + Intronic
1144422347 17:15109916-15109938 CAGGATGAGGTTGAGGAGGTGGG - Intergenic
1144646354 17:16976827-16976849 CAGGAAGAGACAGAGATGGATGG - Intergenic
1144841631 17:18190113-18190135 CAGGATGAACCAGAGATGGAGGG - Intronic
1145058931 17:19720331-19720353 CAGGATGAGGCAGAGGGGCATGG - Intergenic
1145214441 17:21041978-21042000 CGCGAGGAGCTGGAGGTGGAGGG - Intronic
1145802140 17:27694462-27694484 AAGGTTGAGGAAGAGGTGGAGGG + Intergenic
1146008905 17:29179269-29179291 CAGAATGAGCTAGAGGTGGGGGG - Intronic
1146300030 17:31680653-31680675 CAGGAGGAGGATGAGGTGGAAGG + Intergenic
1147266702 17:39238607-39238629 CAGGGTGAGCTGGAGGTGGTAGG + Intergenic
1148548344 17:48533630-48533652 CGGGATGAGGAAAAGGTGGAAGG - Intergenic
1148667247 17:49383879-49383901 CAGGTGGAGGTAGAGGTGGAAGG - Intronic
1150048736 17:61938161-61938183 CAAGCTGAGCTGGGGGTGGAGGG + Intergenic
1150067856 17:62126349-62126371 CAGGAAGAGCAGGAGGTAGAAGG - Intergenic
1150647458 17:66988202-66988224 CAGGATGAGCTCCAGGCAGATGG - Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151284104 17:73097302-73097324 CAGGATGAGAGAGAGGGAGAGGG - Intergenic
1152571178 17:81121933-81121955 GAGGATGAGCTAGAGGAGGTGGG - Exonic
1153354575 18:4121310-4121332 CAGGATGGGCAAGAGGATGAAGG + Intronic
1153522169 18:5963480-5963502 GAGGATGAGGTGGAGGTGGCAGG - Intronic
1155544456 18:26901265-26901287 CAGGATGAGGTTCAAGTGGAAGG - Intergenic
1155610259 18:27659043-27659065 AAAGATGTGCTAGAGGAGGAAGG + Intergenic
1156631461 18:38974387-38974409 CAGGGTGAGCTAGAGAGAGATGG + Intergenic
1156869494 18:41929101-41929123 CAGGAAGAGCTAGAGGAGTTGGG + Intergenic
1158423153 18:57313609-57313631 CAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1158890590 18:61868356-61868378 CAGGATCAGCTGGGGGTGGCTGG - Intronic
1158900154 18:61954770-61954792 GAGGATGAGCTAGATGGGGCTGG + Intergenic
1160099524 18:75906990-75907012 CAGGCTGAGCTGGAGGAAGAAGG + Intergenic
1160894208 19:1395153-1395175 CGGGATGAGCCACGGGTGGAGGG + Intronic
1163174096 19:15552177-15552199 CTGGCTGAGCTAGGGGTGGAGGG - Exonic
1163517739 19:17775101-17775123 CAGGCTGGGCTACAAGTGGAAGG + Intronic
1163770728 19:19189536-19189558 AAGGAAGAGCCAGGGGTGGAGGG - Intronic
1165135066 19:33662644-33662666 ACGGATGAGGTAAAGGTGGAGGG + Intronic
1166060023 19:40320381-40320403 CAGCATGAGGCAGAGGTGGGTGG - Exonic
1167285337 19:48596062-48596084 GGGGATGAGCTGGAGGGGGATGG + Intronic
1167601101 19:50455358-50455380 AAAGATGGGCCAGAGGTGGACGG - Intronic
1167661800 19:50799665-50799687 CAGGCTGAGCTGGATGGGGAGGG - Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168199722 19:54805810-54805832 CAGGAAGAGTTGGGGGTGGAGGG + Intronic
1168462430 19:56570321-56570343 CAGGAAGAGGTAGAGGTGGCAGG + Exonic
1168669621 19:58230704-58230726 CAGGATGGGCAAGATGAGGAGGG + Intronic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
927236166 2:20876859-20876881 GAGGATGACGGAGAGGTGGATGG + Intergenic
927291827 2:21412326-21412348 CAGGGTGAGCTTCAAGTGGAAGG - Intergenic
928349797 2:30539356-30539378 CAGGAGGAGGGTGAGGTGGAAGG - Intronic
928894693 2:36247268-36247290 GAGAATGAGCTAGAGGTGGCTGG - Intergenic
929388730 2:41442904-41442926 CTGGAGGGGCTGGAGGTGGAGGG - Intergenic
929905611 2:46043621-46043643 GGGGATGTGGTAGAGGTGGAAGG + Intronic
929916620 2:46142148-46142170 CAGGATGCAGTGGAGGTGGAAGG - Intronic
932515304 2:72341008-72341030 GAGGAGGAGGTGGAGGTGGAAGG + Intronic
935795586 2:106637919-106637941 CAGGATGAACTATTTGTGGAAGG + Intergenic
936003992 2:108865799-108865821 CGTGATGAGCCAGAGGTAGAGGG + Intronic
937031862 2:118747518-118747540 CTGGAAGAGGAAGAGGTGGAGGG - Intergenic
937264432 2:120607070-120607092 CAGGCTGAGCCAGAGGAGGCTGG + Intergenic
938083143 2:128380882-128380904 CAGGATGAACTGGAGGGTGAGGG - Intergenic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
939094948 2:137823831-137823853 CAGGAAGAGGTAGGCGTGGATGG + Intergenic
940482733 2:154255654-154255676 CATGTTGAGCTAGAGATTGAAGG + Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941962927 2:171271308-171271330 AAGGATGACCTACAAGTGGATGG - Intergenic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
942916073 2:181308662-181308684 CAGGAAGAGTTAGAGGAAGAGGG + Intergenic
944052384 2:195485270-195485292 CAGGATGATATAAGGGTGGATGG + Intergenic
944274218 2:197817759-197817781 CAAGATGTGCTAGAGGGGAATGG + Intronic
946398218 2:219454061-219454083 CATGAAGAGCAAGAGGGGGAGGG - Intronic
946880981 2:224176892-224176914 CAGGAAGAACTCGTGGTGGATGG - Intergenic
947738089 2:232468900-232468922 CAGCATGAGGTTGAGGTGGGCGG - Intergenic
948113071 2:235472455-235472477 CATGATGAGCTGGAGTTGCAGGG - Intergenic
1169379744 20:5096195-5096217 TGGGATGAGGCAGAGGTGGAGGG - Intronic
1169967993 20:11238459-11238481 CAGGCTGAGTGAGAGGAGGATGG + Intergenic
1170229589 20:14030139-14030161 GAGGCTGAGCTAGGAGTGGAAGG - Intronic
1172044698 20:32071871-32071893 CAGGGTGAGCTTGGGGTGAAAGG + Intronic
1173118456 20:40268781-40268803 TAGGATGAACTAGAAGTGGGAGG + Intergenic
1173515527 20:43663062-43663084 GAGGATGCTCTGGAGGTGGAGGG + Intergenic
1173899969 20:46580580-46580602 CAGTAAAAGCCAGAGGTGGAAGG + Intronic
1175363236 20:58431677-58431699 GAGGCTGAGATTGAGGTGGAAGG - Intronic
1175415165 20:58796219-58796241 CATGAGGAGCAAGAGGTGGACGG - Intergenic
1176218163 20:63957882-63957904 CTGGAGGAGCCGGAGGTGGAGGG - Exonic
1179618591 21:42597928-42597950 CAGGATGAGCTAGAACGAGAAGG + Intergenic
1181406313 22:22687320-22687342 GAGGATGAAATAGAGGGGGAGGG - Intergenic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181886087 22:26023514-26023536 CAGGAGGAGGAAGAGGAGGAGGG - Intronic
1182639557 22:31755645-31755667 GAGGTTGAGGTTGAGGTGGAAGG - Intronic
1182883804 22:33756291-33756313 CAGTAGGTGCTAGAGGTGGAAGG + Intronic
1184117205 22:42429094-42429116 CAGGATGAGCTGGAGGCCGTGGG + Intronic
1184744864 22:46450316-46450338 CAGGCTGACATAGAGATGGAGGG + Intronic
1185044376 22:48521868-48521890 CAGGATGAGCTTCATGTGGAGGG + Intronic
949371889 3:3344170-3344192 CAGGATGAGCAAGGGGTAGAGGG - Intergenic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
956698293 3:71937150-71937172 CAGGTGGAGGTGGAGGTGGAAGG - Intergenic
956820415 3:72949081-72949103 AAGGATGACCTAGAGGTGTCTGG + Intronic
956942647 3:74181498-74181520 CAGGAGGAGCTTGAGGTGTAAGG + Intergenic
957353312 3:79053219-79053241 AAGGTTGAGGAAGAGGTGGAGGG - Intronic
958258009 3:91347458-91347480 CACAGTGTGCTAGAGGTGGAAGG - Intergenic
959817448 3:110691601-110691623 TAAGATGAGGCAGAGGTGGAGGG - Intergenic
960334431 3:116399082-116399104 CAAGAGAAGGTAGAGGTGGAAGG + Intronic
960794859 3:121474584-121474606 CAAGTTGAGCCAGGGGTGGAAGG + Intronic
961201046 3:125045677-125045699 CAGGAAGAGGTAGACATGGAAGG - Intronic
962929749 3:140025421-140025443 CAGGATGAGCAACTTGTGGAAGG - Intronic
963726344 3:148926155-148926177 GAGAATGGGATAGAGGTGGAAGG - Intergenic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
964718326 3:159746224-159746246 TAGGATGAGGTAGAGAAGGATGG - Intronic
966591748 3:181691427-181691449 CAGGAGGAGATAGAGGAGGAAGG + Intergenic
966594263 3:181712129-181712151 CAGGATCGGCCAGAGGAGGAGGG + Exonic
966700206 3:182841027-182841049 CAGGATGAGCTAGAGGTGGAAGG - Intronic
967649767 3:191972740-191972762 AAGGATGAGCCAGGCGTGGAGGG + Intergenic
967660219 3:192098358-192098380 TAGGATCTGCTTGAGGTGGAAGG + Intergenic
968312769 3:197697662-197697684 CAGGAAGAGCGAGAGCTGGGAGG + Intronic
968856199 4:3125674-3125696 CAGGAAGGGCAAGGGGTGGAAGG - Intronic
968978715 4:3835296-3835318 CAGGATGAGGTGGAGGTGACAGG + Intergenic
969111889 4:4849491-4849513 CAGGAGAAGCTAGAGGGGGTTGG + Intergenic
970110792 4:12635893-12635915 CAAGATGAGGTTGAAGTGGAAGG + Intergenic
971150065 4:24022107-24022129 AGGGCTGAGCTACAGGTGGATGG + Intergenic
971352443 4:25865369-25865391 CATCCTGAGCTAGAGGTGGTGGG + Intronic
972436983 4:39044611-39044633 CAAGAGGAGCTAGTGGGGGAAGG - Intergenic
973212365 4:47631003-47631025 TGGGGTGAGCTAGAGGAGGAGGG + Intronic
973297811 4:48545423-48545445 TAGGATGCATTAGAGGTGGAAGG - Intronic
973790573 4:54374435-54374457 CAACAGGAGTTAGAGGTGGAAGG + Intergenic
974630031 4:64477620-64477642 CATCATGAACTAGAGTTGGATGG - Intergenic
975190849 4:71460397-71460419 CTGGATGAGCAAGACATGGAGGG - Intronic
975293045 4:72699910-72699932 CAGGCTGAGGTGGAAGTGGAAGG - Intergenic
975321670 4:73015474-73015496 AAGGAATAGCTACAGGTGGAGGG - Intergenic
976805424 4:89040929-89040951 CAGAATGGGAGAGAGGTGGAGGG - Intronic
977511192 4:97965048-97965070 CAGGAAGCGCAAGAGGTTGAGGG + Intronic
978037714 4:104016474-104016496 GAGAAAGAGCAAGAGGTGGAGGG + Intergenic
979101986 4:116629552-116629574 CAGGAGGAGGAAGAGGTGGATGG - Intergenic
979119097 4:116870868-116870890 CAGGATGAGTGAGAGCAGGAGGG + Intergenic
979844656 4:125491866-125491888 CAGTATGGACTAGTGGTGGAGGG + Exonic
981244366 4:142516709-142516731 CAGAATCAGTTAGAGGTGAAAGG + Intronic
981624823 4:146743431-146743453 CAGGTTGAATTAGAGGTGGATGG + Intronic
981809662 4:148759493-148759515 GAGGAGGAGCAAGAGGAGGAGGG + Intergenic
981925703 4:150137256-150137278 CAGGATGAGAGACATGTGGAGGG - Intronic
983228204 4:165104919-165104941 GAGAATGAGCTAGAGGCAGAGGG - Intronic
985802481 5:2013796-2013818 CAGGCTGAGACAGAGGAGGACGG + Intergenic
986286784 5:6365146-6365168 GAGAATGTGCTAGAGGTGGAGGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
991194301 5:63914370-63914392 AAGGATGGGCTAGAGGTGAAGGG - Intergenic
992478616 5:77128179-77128201 TGGGATGAGGTACAGGTGGAAGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
994589318 5:101754240-101754262 CTGGCTGAGCTACAGGTGGCAGG + Intergenic
997931663 5:138077719-138077741 TAGGAAGAGTTAGAGTTGGAGGG - Intergenic
999370504 5:151052314-151052336 CAGGCTGAGCTAGAGGATGGTGG + Intronic
999674301 5:153983493-153983515 CAGGATGCACCAAAGGTGGAAGG - Intergenic
1000627426 5:163555216-163555238 AAGGATGAGCAGGAGGTGAAGGG - Intergenic
1001244627 5:170096705-170096727 CAGGATGATTTATAGGTGCAAGG - Intergenic
1003456185 6:6284850-6284872 GAGGATCAGCTAGAGTTGAAGGG - Intronic
1003482402 6:6545937-6545959 CAGGCTGAGCTGGGGGTGGGGGG + Intergenic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1004335470 6:14760449-14760471 CATGATGAGGCAAAGGTGGAGGG + Intergenic
1004698799 6:18059177-18059199 GAGGATGAGCAAGAGGAGGAAGG - Intergenic
1006897734 6:37481585-37481607 CAGCTTGAGCCAGAGGTGAAGGG + Intronic
1006923799 6:37643235-37643257 CAGGATGAGATGGAAGTGGAGGG - Intronic
1008807948 6:55454581-55454603 GAGTATGGGCTAGAGTTGGATGG + Intronic
1009400394 6:63247901-63247923 CAGGATGAGGAAGAGCAGGAAGG + Intergenic
1009423737 6:63491363-63491385 CAGGAATTGCTAGAAGTGGATGG - Intergenic
1010664056 6:78606067-78606089 CAGGATGAGTCAGAAGGGGAGGG - Intergenic
1013474498 6:110495015-110495037 CAGGATGGAAGAGAGGTGGAGGG - Intergenic
1014416405 6:121190249-121190271 AAGGATGAGGTGGAGGGGGAAGG - Intronic
1014528074 6:122524219-122524241 GAGGATGAGGAAGAGGAGGAGGG - Intronic
1016827983 6:148405617-148405639 GAGGATGGGCTCTAGGTGGATGG - Intronic
1016932813 6:149426790-149426812 TAGGAAGAGCTAAAGGTGGCAGG - Intergenic
1018215104 6:161518765-161518787 CAGGGGCTGCTAGAGGTGGATGG - Intronic
1019566226 7:1680352-1680374 CAGGATGGTCAAGACGTGGATGG + Intergenic
1019707572 7:2503822-2503844 GAGGATCAGCTGGGGGTGGATGG - Intergenic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020130735 7:5557152-5557174 GAGCATGAGCTGGGGGTGGAGGG + Intronic
1021905903 7:25332810-25332832 CACGAGGAGCTAGAGGTGGTAGG + Intergenic
1021993804 7:26160845-26160867 CAGGAAGAGGTGGAGCTGGATGG - Intronic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1022664176 7:32394703-32394725 GAGGTTGAGGTGGAGGTGGAAGG + Intergenic
1023607491 7:41943451-41943473 CAGGGGGAGCTAGAGCTGGCAGG + Intergenic
1023760817 7:43463740-43463762 CAGGAGGAGGCGGAGGTGGAGGG + Exonic
1024026396 7:45413504-45413526 CAAGTTGAGCTAGGGGTGGCTGG + Intergenic
1024196436 7:47063928-47063950 GAGGAGGAGGAAGAGGTGGAGGG - Intergenic
1024525884 7:50348961-50348983 CAGCATGGCCTAGAGGTGGCAGG + Intronic
1025115062 7:56250626-56250648 CAGCATGAGGTAGAGATGGCAGG - Intergenic
1026321328 7:69269906-69269928 CCGGAGGAGGTGGAGGTGGAGGG + Intergenic
1026811258 7:73467735-73467757 CAGGATGCTCTAGAAGTGAAGGG + Intronic
1026878640 7:73894215-73894237 CAGGGTGAGGTTGGGGTGGAGGG + Intergenic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1032982583 7:137300946-137300968 CAGCTTAAGGTAGAGGTGGAAGG - Intronic
1033446373 7:141425907-141425929 CAGGAAGAGATAGGGGGGGAAGG - Intronic
1035724161 8:1814120-1814142 CAGGAGGTGCTAGGGGAGGATGG - Intergenic
1035724171 8:1814163-1814185 CAGGAGGTGCTAGGGGAGGATGG - Intergenic
1036665229 8:10733242-10733264 AGGGCTGAGCTAGAGGGGGAGGG + Intronic
1037781281 8:21870846-21870868 CAGGATCAGATACAGGGGGAGGG + Intergenic
1038168980 8:25111410-25111432 CCAGGTGAGCTAGAGGTGAAAGG - Intergenic
1038389548 8:27182581-27182603 CAAGGTGAGATACAGGTGGAGGG - Intergenic
1038688960 8:29743710-29743732 CAGGAAAAGCGAGAGATGGATGG + Intergenic
1039346596 8:36712000-36712022 CAGAATGGGATACAGGTGGAAGG - Intergenic
1040079734 8:43274773-43274795 GAGGAGGAGGTAGAGGAGGAGGG - Intergenic
1040352377 8:46582204-46582226 AAGGTTGAGGAAGAGGTGGAGGG - Intergenic
1040447654 8:47511873-47511895 GAGGATGAGGAAGAGGAGGAAGG - Intronic
1041326195 8:56667877-56667899 CAGTGTGAGCAAGAGGTGAAGGG - Intergenic
1043844034 8:85143392-85143414 GAGGTTGAGGTTGAGGTGGAAGG + Intronic
1044630776 8:94276648-94276670 CAGCATGGGCTAGAGGCAGATGG + Intergenic
1047180847 8:122586322-122586344 CAGGAGCAGATAGAGATGGATGG - Intergenic
1047813277 8:128433931-128433953 GAGAAGGAGCAAGAGGTGGAAGG - Intergenic
1048405790 8:134118989-134119011 GAGGCTGGGCTAGGGGTGGAGGG + Intergenic
1049404321 8:142444944-142444966 CAGGCTGAGCTGGGGGTGGGAGG + Intergenic
1049553263 8:143270373-143270395 CAGGGTGAGTTAGAGGAGCAGGG + Intronic
1050622776 9:7472281-7472303 TAGGCTGAGCTAGAGGAGGCTGG + Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1060290882 9:122301326-122301348 CAGGCTGAGGTAAATGTGGAGGG + Intronic
1060812520 9:126617895-126617917 CAGGATGTGCTGGGGGTGGGGGG + Intronic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1203782330 EBV:107576-107598 CAGGATGAGGAAGAGGTTCACGG - Intergenic
1185814997 X:3146430-3146452 AAGGATGAGGAAGAGGAGGAGGG - Intergenic
1186174192 X:6907794-6907816 CAGGATGGGCAAGAGGGTGAAGG + Intergenic
1187393293 X:18899943-18899965 CAGCATGAAATAGAGGCGGAAGG + Intronic
1188705955 X:33330713-33330735 GAAGATGAGCAACAGGTGGAAGG + Intronic
1188816566 X:34722245-34722267 CAGAATGAGCTTGATGGGGAAGG + Intergenic
1189318111 X:40069974-40069996 AGGGATGAGCTGGAAGTGGAGGG + Intronic
1190136506 X:47804189-47804211 GAGGAGGAGCTGGTGGTGGATGG - Intergenic
1190725623 X:53188781-53188803 TAAGATGAGCTAGAGATAGAAGG - Intergenic
1192216667 X:69164165-69164187 AGGGATGTGCTTGAGGTGGATGG + Intronic
1194744444 X:97612962-97612984 CATGGTGAGCTTGAGGTGGCTGG - Intergenic
1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG + Intergenic
1200775285 Y:7164967-7164989 CAGGATGGGATGGAGGTTGAAGG + Intergenic
1201289612 Y:12410296-12410318 CAGGATTAGATAGAGGTGGTGGG - Intergenic