ID: 966700238

View in Genome Browser
Species Human (GRCh38)
Location 3:182841404-182841426
Sequence CTGTCGACAAATACACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966700238_966700239 19 Left 966700238 3:182841404-182841426 CCTTACTGTGTATTTGTCGACAG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 966700239 3:182841446-182841468 ATACCCTTTGATTGAATTACAGG 0: 1
1: 0
2: 2
3: 8
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966700238 Original CRISPR CTGTCGACAAATACACAGTA AGG (reversed) Intronic
900716242 1:4146734-4146756 CTTTCAACAGATACACAGTGTGG + Intergenic
901466300 1:9423498-9423520 CTGTAGAGAAATACAAAGGAAGG - Intergenic
902129141 1:14243600-14243622 ATCTTAACAAATACACAGTACGG - Intergenic
907264534 1:53249374-53249396 CTGTCGTCAAATCCAAGGTAGGG - Exonic
910520150 1:88111839-88111861 CTGCAGACAAATACACAAGATGG - Intergenic
915151526 1:153836144-153836166 CTTTAGAAAAGTACACAGTAAGG + Intronic
917407970 1:174729062-174729084 CTGTCTTCAAATATACTGTAAGG + Intronic
923245375 1:232125887-232125909 CTGTCAAAAAAGACACAGAAGGG - Intergenic
924297554 1:242603659-242603681 TTGTTAACAAATACACACTAAGG + Intergenic
1070212018 10:74334189-74334211 CTGTCAACAAAAACAGAGCAGGG - Intronic
1070895541 10:79980773-79980795 CTGCAGCCAAATACACAATAGGG - Intronic
1076265383 10:129105687-129105709 CTGTCCACAAATATAAAGAAGGG + Intergenic
1087891946 11:103545441-103545463 CTGTCCACAAATCCACAGGGCGG + Intergenic
1087928285 11:103946182-103946204 CTTTCAACAAAAACAAAGTATGG + Intronic
1091284055 11:134398276-134398298 CTGTTGACAAATCCACAATTGGG + Intronic
1091844028 12:3641474-3641496 CTCTCTGCAAACACACAGTAGGG + Intronic
1093620219 12:21279137-21279159 CTGTTTGAAAATACACAGTAAGG + Intronic
1094085161 12:26582791-26582813 CTATCCACAGATACACAGGATGG + Intronic
1096107426 12:49004695-49004717 CTGTTGAGCAATACACTGTATGG - Intronic
1100608396 12:96170407-96170429 GTGTGGACATATACACACTACGG - Intergenic
1105760904 13:23513633-23513655 CTGTCTAGAAATACAGAGGAGGG + Intergenic
1108023342 13:46152082-46152104 TGGTAGACACATACACAGTAAGG + Intronic
1109584477 13:64380630-64380652 CTTTGGATAAATACTCAGTAAGG + Intergenic
1109922222 13:69080398-69080420 CTGAAAACAAATACACAGTTTGG + Intergenic
1111623157 13:90749746-90749768 GAGTCTACAAATACACAGTTAGG - Intergenic
1114291634 14:21293376-21293398 CTGTCTTCAAAAACCCAGTAAGG - Intronic
1116118705 14:40694159-40694181 CTTTTGACACATTCACAGTAAGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1124117681 15:26862577-26862599 CTTTAGATAGATACACAGTATGG - Intronic
1125734689 15:41916435-41916457 CTGTTGACAACTACACAGTTGGG - Intronic
1130655217 15:85787832-85787854 CTGTGGACAGATACAAAGGAGGG + Intronic
1139145618 16:64321216-64321238 CTGTCAACAACTATTCAGTATGG + Intergenic
1148354787 17:46968558-46968580 CTCTCGACAAACACAGAGGATGG + Intronic
1160144125 18:76350116-76350138 CTCGTGACAAATACACAGTTAGG - Intergenic
1165197834 19:34119267-34119289 CTGTCTACAATTACACATCAAGG + Intergenic
925031974 2:657801-657823 CTGTTGAGAAATACAGAGAAAGG - Intergenic
932946787 2:76243246-76243268 CTTTGGATAAATACTCAGTATGG + Intergenic
937108432 2:119341469-119341491 GTGCCCACAGATACACAGTATGG + Intronic
943983386 2:194586992-194587014 CTGTCTACCAATATACTGTATGG + Intergenic
944570665 2:201041804-201041826 CTGAGGACATATAAACAGTATGG - Intronic
1168908436 20:1425629-1425651 CTGTAAATAAATACACAGCAAGG - Intergenic
1169109758 20:3024687-3024709 CTGTTGGCAAATGCACAGTCAGG - Intronic
1173467528 20:43295293-43295315 CTGTCTACAATCACACAGTTAGG + Intergenic
957125692 3:76157275-76157297 CTATAGACAAAAATACAGTATGG - Intronic
962167483 3:133064371-133064393 CTGTCCACAAGGAGACAGTAAGG - Intronic
963803750 3:149702115-149702137 CAGATGACAAATACAGAGTACGG - Intronic
964288692 3:155151143-155151165 CTGTCTAAACATACACAGCAAGG - Intronic
966700238 3:182841404-182841426 CTGTCGACAAATACACAGTAAGG - Intronic
974390917 4:61266519-61266541 CTGTCCACAAACATCCAGTAAGG - Intronic
975525089 4:75340268-75340290 CTTTAGATAAATACAAAGTATGG - Intergenic
977547416 4:98400204-98400226 CTTTTGATAAATACCCAGTAAGG - Intronic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
984440141 4:179758785-179758807 CTATTGACAAATAGACAATAAGG + Intergenic
987391423 5:17379476-17379498 TAGTCAACAAAGACACAGTATGG + Intergenic
988631633 5:32937532-32937554 CTATACACTAATACACAGTATGG + Intergenic
995973304 5:118000123-118000145 CTATGGACAAATACAGTGTAAGG - Intergenic
1000204576 5:159046696-159046718 CTGGTGACAAAGACATAGTATGG + Intronic
1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG + Intergenic
1003621657 6:7706064-7706086 CTGAGGAAAAATACCCAGTACGG - Intergenic
1009349989 6:62662096-62662118 ATTTTGACAAATAAACAGTATGG + Intergenic
1012688835 6:102288126-102288148 CTTTTGATAAATACCCAGTAGGG - Intergenic
1017712495 6:157182983-157183005 CTGTGGACACAGTCACAGTAAGG - Intronic
1018718466 6:166553933-166553955 CTGCTGAAAAATACACAGTTAGG + Intronic
1021367412 7:19796906-19796928 CTTTGGATAAATATACAGTATGG + Intergenic
1024232542 7:47373618-47373640 CTGTGGACAAAAACTCAGTGAGG - Intronic
1027942293 7:84698549-84698571 CTGTGGATAAATACACATGATGG + Intergenic
1030697834 7:112604845-112604867 CTGGCTACAAATACCCAGTATGG - Intergenic
1034877393 7:154737619-154737641 CTGTGGACAAACAACCAGTAGGG + Intronic
1041273661 8:56134933-56134955 CTGTAGACAAAGACAAAGCAAGG - Intergenic
1048672004 8:136732957-136732979 ATGTCCACAAGGACACAGTATGG + Intergenic
1059097700 9:111436323-111436345 CTGATGACACAGACACAGTAAGG + Intronic
1062504087 9:136864249-136864271 CTGTTGAGAAAGACACACTAGGG + Intronic
1190808672 X:53863344-53863366 CTGATGAAAAATACTCAGTAGGG + Intergenic
1196491815 X:116276348-116276370 CCGTCTAGAAATAAACAGTAAGG - Intergenic
1198041930 X:132861089-132861111 CTGTCGAAAGATACACATGAGGG - Intronic