ID: 966704044

View in Genome Browser
Species Human (GRCh38)
Location 3:182891169-182891191
Sequence CACTTCCACCTGAAATAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966704039_966704044 26 Left 966704039 3:182891120-182891142 CCATCAGTGCAAGTGCCACCAAA 0: 1
1: 0
2: 2
3: 10
4: 152
Right 966704044 3:182891169-182891191 CACTTCCACCTGAAATAGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 110
966704040_966704044 11 Left 966704040 3:182891135-182891157 CCACCAAATATATAGACATATGA 0: 1
1: 0
2: 1
3: 47
4: 536
Right 966704044 3:182891169-182891191 CACTTCCACCTGAAATAGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 110
966704041_966704044 8 Left 966704041 3:182891138-182891160 CCAAATATATAGACATATGAGTG 0: 1
1: 0
2: 1
3: 23
4: 337
Right 966704044 3:182891169-182891191 CACTTCCACCTGAAATAGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966704044 Original CRISPR CACTTCCACCTGAAATAGTG GGG Intronic
900182745 1:1319501-1319523 CACTTCCACCTGGACCACTGCGG - Exonic
902121917 1:14173588-14173610 CACTCCCAGCTGAAAAAGAGAGG - Intergenic
904289187 1:29472881-29472903 CACTTCCACCTGCAATGCAGAGG + Intergenic
904909196 1:33921489-33921511 CAGTTCCACCTGGTGTAGTGAGG - Intronic
909615440 1:77603476-77603498 CTCTTCCACCTGCAAAAGTAGGG + Intronic
912394909 1:109335084-109335106 AACTTCCTCCAGGAATAGTGTGG + Intronic
916001460 1:160620327-160620349 CAATTCCCCCAGAAATAGGGAGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
923410039 1:233698974-233698996 CCTTTCCACCTGATATAGTTAGG - Intergenic
1066592867 10:37014676-37014698 CGCTTCCACCTGAAAATGTTAGG - Intergenic
1068801723 10:61148288-61148310 CACTCCCACCCAAAATATTGGGG + Intergenic
1068927304 10:62553776-62553798 CCCTGCCACCTGAAAGAGTCTGG - Intronic
1069831864 10:71286675-71286697 CCATTCCACCTGCAAGAGTGGGG - Exonic
1071924747 10:90393044-90393066 CACACTCACCTGAAATACTGAGG + Intergenic
1072382032 10:94882725-94882747 CACTGCAACCTGATATAGTGGGG - Intergenic
1075298749 10:121301246-121301268 CACTTTCTGCTGAAATAGAGGGG + Intergenic
1078034024 11:7783865-7783887 CACTGCAACCTGATATAGTGGGG - Intergenic
1080320212 11:30999705-30999727 CACTTCCATCTTAAAAAGGGTGG + Intronic
1083225252 11:61280931-61280953 CACCTCCCCCTGAAGGAGTGAGG + Exonic
1086742119 11:90380556-90380578 CACCTTCAACTGAAATATTGAGG - Intergenic
1087698702 11:101411828-101411850 CACTTCCAGCTGCTATAATGTGG + Intergenic
1089174257 11:116536874-116536896 CGCTGCCACCGGAAATGGTGGGG + Intergenic
1089468706 11:118703893-118703915 GACTTCCACCTGATTTAGTCAGG + Intergenic
1098549340 12:71746129-71746151 CACTTCCATCTGATATAATTAGG + Intergenic
1098802681 12:74982033-74982055 CACTTCCACCTGACATCATTTGG + Intergenic
1100813989 12:98367829-98367851 TACTTCCAGCTGGAATACTGGGG + Intergenic
1101080331 12:101174784-101174806 TACCTCCACCTGAAGTAATGAGG + Intronic
1111101896 13:83598579-83598601 CACTTTCACCTGAAACATTCAGG - Intergenic
1111784584 13:92770929-92770951 CACTTCTACCATAAATAATGAGG - Intronic
1115991774 14:39157231-39157253 CACTGCAACCTGATATAGCGGGG - Intronic
1117985511 14:61382559-61382581 CTCTTCCACCTGAAACTGTCTGG - Intronic
1118690967 14:68339336-68339358 CGCTGCAACCTGATATAGTGGGG + Intronic
1123020147 14:105394214-105394236 CACTTCCACCTGCACAGGTGTGG - Intronic
1123435545 15:20251525-20251547 CTCTCCCACCTGAAATAGAAGGG + Intergenic
1126349610 15:47730744-47730766 CGCTGCAACCTGATATAGTGGGG + Intronic
1132856416 16:2047097-2047119 CAGTTCCTCCTGACATAGTCTGG + Intronic
1133244629 16:4439865-4439887 CACTTCCACCTAGAATGGAGGGG - Intronic
1134349912 16:13427379-13427401 CACTTCCATCTGTAACAGAGAGG - Intergenic
1136849061 16:33599470-33599492 CTCTCCCACCTGAAATAGAAGGG - Intergenic
1137650175 16:50113350-50113372 CACTTTCACCTTAAATAATAAGG + Intergenic
1137870193 16:51942887-51942909 CACATCCACCTTAAGCAGTGGGG + Intergenic
1140793728 16:78415827-78415849 CACTACCACCTTAACTACTGAGG + Intronic
1203110768 16_KI270728v1_random:1448120-1448142 CTCTCCCACCTGAAATAGAAGGG - Intergenic
1148128661 17:45249418-45249440 CAGTTCCACCTGAGTTAGAGTGG - Intergenic
1155743425 18:29319368-29319390 CAGTTCCACCTGAAATAAGATGG - Intergenic
1156714619 18:39992363-39992385 CACTTTCACCTGATATAGTCAGG - Intergenic
1159222913 18:65488602-65488624 CACTCCCACGTGGAATAGAGAGG - Intergenic
1159708556 18:71724343-71724365 CCCTTCCACTTTAAATATTGAGG - Intergenic
1164940928 19:32251877-32251899 CACTTCCACCTCCAATGTTGGGG - Intergenic
1165031704 19:33002395-33002417 CTCTCCCACCTGAAATAGAAGGG + Exonic
924986810 2:278692-278714 CACTTCCACATGGTACAGTGGGG - Intergenic
927850936 2:26498854-26498876 CTCTGCCACCTGGAAAAGTGGGG - Intronic
928737305 2:34307022-34307044 TACTTCCACCTGAAGTCATGGGG + Intergenic
928767029 2:34659805-34659827 CACTTCCAGCTGAAATGCTGGGG - Intergenic
929663583 2:43815215-43815237 CAGTTTCACCTGAAATAGATTGG - Intronic
931199328 2:60081955-60081977 AACTTCCACCTAAAACAGGGTGG - Intergenic
933859530 2:86451284-86451306 CAGTTGAACCTTAAATAGTGTGG + Intronic
937136971 2:119562212-119562234 TCCTTCCACCTGAAATAGACTGG + Intronic
938149676 2:128871346-128871368 CATTTTCACCTGGAAAAGTGTGG - Intergenic
938962991 2:136359777-136359799 CACCTCCTCCTGATATACTGTGG + Intergenic
943268662 2:185770631-185770653 TACTTCAACATGAAATATTGAGG + Intronic
1181306127 22:21918255-21918277 CCCTTCCACCAGGAACAGTGAGG + Intergenic
1181654603 22:24286154-24286176 GACTTCCATCTGATAAAGTGGGG + Intronic
1183540186 22:38425271-38425293 CACTTCCACCTGAGTTAGGAAGG + Intergenic
949957177 3:9278756-9278778 CACTTGCAACTGAAAGAGTCTGG - Intronic
951538425 3:23760682-23760704 CACTTTGGCCTGCAATAGTGAGG - Intergenic
953274010 3:41476791-41476813 CACATCTACTTGAAAGAGTGAGG + Intronic
953432928 3:42854507-42854529 CACTTCCACCTCACGTTGTGAGG + Intronic
959140377 3:102479065-102479087 CACTTCCTCCTGAAATATTCAGG - Exonic
959588107 3:108045112-108045134 CAATGCCACCAGAGATAGTGGGG - Intronic
959792768 3:110384075-110384097 CACATCCACTTGGAATAGTAGGG - Intergenic
960360953 3:116710440-116710462 CACTTCCTCCTGATATATTTGGG - Intronic
961068513 3:123898073-123898095 CATTTCTACCTCAAATTGTGTGG + Intronic
962063674 3:131957013-131957035 CACCTCATCCTGAATTAGTGTGG - Intronic
963464262 3:145658652-145658674 CTCTTCCACCTTCAATACTGTGG + Intergenic
966576217 3:181505689-181505711 CACGGCAACCTGATATAGTGGGG + Intergenic
966704044 3:182891169-182891191 CACTTCCACCTGAAATAGTGGGG + Intronic
968906104 4:3451503-3451525 TAATTCCACCTGAAACACTGAGG - Intergenic
975270764 4:72430234-72430256 CACTTGCAACTGAAAGAATGTGG + Intronic
976191513 4:82491442-82491464 CACTGCAACCTGATATAGCGGGG + Intronic
976831893 4:89324480-89324502 CAGTGCGACCTGAAAAAGTGAGG - Intergenic
985045592 4:185937686-185937708 CACTTCCAGCTAAAATAAAGTGG - Intronic
985153463 4:186966494-186966516 CTCTTCCATGTGAAATGGTGGGG - Intergenic
992363112 5:76062992-76063014 CCCTTCCTCCTGAGATGGTGAGG + Intergenic
1003180213 6:3784586-3784608 CACATCCACCTGTGATAGGGAGG - Intergenic
1004181123 6:13381393-13381415 CTCTTCCACCTAATACAGTGAGG + Intronic
1005677109 6:28165833-28165855 CTCTTCCATCTCAAATAGTATGG + Intergenic
1009429387 6:63549315-63549337 CGCTGCAACCTGATATAGTGGGG + Intronic
1009814160 6:68709575-68709597 CACCTCCAGCTGAAATGTTGAGG - Intronic
1013987595 6:116214424-116214446 CACTTCTAGCCGAAATAGTGAGG + Intronic
1014675162 6:124354984-124355006 CACTTCAACCTGAAAGAAAGAGG + Intronic
1016066959 6:139693796-139693818 CACTTTCACCTGAAGTAGTGGGG - Intergenic
1017727873 6:157288058-157288080 CACTTCCACCTGCCAGGGTGGGG - Intergenic
1020412489 7:7908497-7908519 AACTTCCAGCTGAACTGGTGGGG + Intronic
1026440434 7:70439055-70439077 CACTTCCACGTTAATTAGTAAGG - Intronic
1027583658 7:80029260-80029282 AATTTCAACCTGATATAGTGTGG + Intergenic
1029792597 7:102860600-102860622 CAATTCCAGATGAAAAAGTGTGG - Intronic
1031051090 7:116946489-116946511 CAGTTGCACTTTAAATAGTGTGG - Intergenic
1031102131 7:117494218-117494240 TAATTCCACCTGATATAGTTTGG - Intronic
1033516262 7:142109832-142109854 CACTGATACCTGAAATGGTGTGG + Intergenic
1034109308 7:148521020-148521042 CACATGCACCAGGAATAGTGTGG + Intergenic
1034523256 7:151637363-151637385 CAATTTCACCTGTAATCGTGAGG + Intronic
1037091322 8:14922652-14922674 CACTTACAAATGAAATAGTTTGG + Intronic
1037805614 8:22056735-22056757 CACTTCCAGCTGATAGCGTGTGG - Intronic
1038608797 8:29039465-29039487 CACTTTCTCCTGAGATAGTCTGG + Intronic
1042741975 8:72059185-72059207 CACTTCTAACTGTAATAGTTTGG + Intronic
1047902993 8:129443994-129444016 CCCTTCCACCACAAATAGTGAGG + Intergenic
1048794651 8:138138529-138138551 CACTTCCACATGACAGAGAGAGG + Intronic
1051501409 9:17781850-17781872 AAATTCCACCTGAAAGAGTAAGG - Intronic
1055026034 9:71722606-71722628 CACTTCTACCAAAAAAAGTGGGG + Intronic
1056899907 9:90588503-90588525 CAATTCAAGCTGAAATAGTCAGG + Intergenic
1056959840 9:91113405-91113427 CACTTCCACCACCAATAGGGAGG + Intergenic
1057387698 9:94619039-94619061 CAGTTCCTCCTGCATTAGTGAGG - Intronic
1060716651 9:125936861-125936883 CACTTCCATATGAAATATGGAGG + Intronic
1186322850 X:8449076-8449098 GATTTCCAACTGGAATAGTGAGG + Intergenic
1189021007 X:37339788-37339810 CACTTCTACCTATAATAGTTTGG - Intergenic
1192367962 X:70490706-70490728 GACTTCTACCTGCAATACTGTGG - Intronic
1197673397 X:129303407-129303429 CACTGTCATCTGAAATGGTGTGG + Intergenic
1199810834 X:151347001-151347023 CACTTCCACCTGGAGTAGCAGGG + Intergenic