ID: 966704727

View in Genome Browser
Species Human (GRCh38)
Location 3:182899634-182899656
Sequence GATTTGAACTGAGATCTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 9, 3: 68, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966704727_966704729 -6 Left 966704727 3:182899634-182899656 CCTGATAGATCTCAGTTCAAATC 0: 1
1: 0
2: 9
3: 68
4: 289
Right 966704729 3:182899651-182899673 CAAATCCCAGGTCTTCCACTTGG 0: 1
1: 0
2: 8
3: 43
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966704727 Original CRISPR GATTTGAACTGAGATCTATC AGG (reversed) Intronic
900861030 1:5231540-5231562 GATTAGAATGGATATCTATCAGG - Intergenic
901667253 1:10833251-10833273 GATTTGAACTCAGAGCCATCAGG - Intergenic
902403428 1:16170623-16170645 GATTTGAAGCCAGATCTATGTGG + Intergenic
902708619 1:18223447-18223469 GATCTGAACCCAGAGCTATCTGG - Intronic
903368654 1:22820182-22820204 GATTTGAACCCAGGTCTTTCTGG + Intronic
904200437 1:28815907-28815929 GCTTTGAACTCAGATATGTCTGG - Intronic
904316990 1:29671946-29671968 GAGTAGAACTGAGAGCTTTCTGG - Intergenic
904657710 1:32061865-32061887 GATTTGAATTCAGATCTGTTTGG - Intergenic
904807959 1:33145045-33145067 GATTTGAGCTGAGGTCTGTGTGG + Intergenic
905009894 1:34740176-34740198 GATTTGAACCCGGATCTGTCAGG + Intronic
905421320 1:37847293-37847315 GATTTGAACTGAGGACTTTCTGG - Intronic
905536537 1:38726699-38726721 CAATTAATCTGAGATCTATCTGG - Intergenic
905937011 1:41832834-41832856 GATTTTAAATGAGATCTGTCTGG + Intronic
906949372 1:50322168-50322190 GATTTGAACTCAGTTCTCTATGG - Intergenic
907373285 1:54016637-54016659 AATGTGAACTGAGGTCTCTCTGG - Intronic
907444698 1:54500047-54500069 GATTGGAACCTAGATCTGTCTGG - Intergenic
907590201 1:55659420-55659442 GAATTAAACTCAGATCTGTCTGG - Intergenic
907749706 1:57250914-57250936 GATTTGAACTTACATCTTTCTGG + Intronic
908092589 1:60701552-60701574 GATTTGAACACAGATCTATATGG - Intergenic
908499217 1:64726199-64726221 AATTTGAACTGACATCTATAGGG - Intergenic
910596423 1:88985554-88985576 ATTTTGAACTAAGATCTATCTGG - Intronic
911473207 1:98343752-98343774 GATTTAAACTTAGATTTACCTGG - Intergenic
911634365 1:100217704-100217726 GATTTGAACACAAATCTGTCTGG - Intronic
912073513 1:105842937-105842959 GACTGGAACTGAGATCTTTTTGG - Intergenic
912253258 1:108032600-108032622 GATTTGGATTGAGATAAATCTGG - Intergenic
912535093 1:110361939-110361961 GATTTGAACCGAGATTAATTTGG + Intergenic
912722700 1:112033308-112033330 GCTTGCAATTGAGATCTATCTGG - Intergenic
913083633 1:115413594-115413616 GATTTGAACTCAACTCTATCTGG - Intergenic
913556606 1:119973515-119973537 GATTTGCAGTCAGATCAATCCGG - Intronic
915109469 1:153553801-153553823 GATCTGAACTGAGATCAAAGAGG + Intergenic
916530520 1:165652293-165652315 AATTTGAACTCAGGTCTGTCTGG + Intronic
917628674 1:176871970-176871992 GAAAAGAACTGAGATCTCTCAGG + Intronic
918134769 1:181661852-181661874 AATTTGGACTGAGATCTACTAGG + Intronic
918521214 1:185416856-185416878 GATTTGAACCAAGGTCTGTCTGG - Intergenic
918534036 1:185554499-185554521 AATTTGAACTAAGAACTAACAGG - Intergenic
918648435 1:186929195-186929217 GATTTGAACTGAGGTATGTCTGG - Intronic
919902571 1:202055142-202055164 GATTTGAACTGAGACCTGTCTGG + Intergenic
921972785 1:221168568-221168590 GATTTGAACTCATGTCTCTCTGG + Intergenic
922643426 1:227260110-227260132 GATTAAAACTCAGATCTATCAGG + Intronic
922962667 1:229662063-229662085 TATTTGAACTGAGACCTGCCTGG + Intergenic
923003925 1:230029856-230029878 GATTGGATCTGAGATTAATCAGG - Intergenic
1063702987 10:8403755-8403777 GATTTGAACTGAGGTATCTCAGG + Intergenic
1064708923 10:18103037-18103059 GATTTGAAGTGAAGTCAATCTGG - Intergenic
1065502517 10:26396117-26396139 AATCTGAACTCAGTTCTATCAGG + Intergenic
1066127903 10:32360601-32360623 GATTTGATCTCACATGTATCAGG + Intronic
1066226198 10:33386050-33386072 GATTTGTGCTGATATCTGTCAGG - Intergenic
1068696306 10:59971438-59971460 CATTTAAACTGAGACCTAACAGG - Intergenic
1068770514 10:60815317-60815339 GATTTAAACTCAGTTCTATTGGG - Intergenic
1069407550 10:68118433-68118455 AATTTGGAATTAGATCTATCTGG + Intronic
1069672282 10:70217442-70217464 GATTTGAACTCTGGTCTGTCTGG + Intronic
1070740386 10:78899361-78899383 GATTTGAACGCAGGTCAATCTGG - Intergenic
1070786210 10:79163636-79163658 GATTTGAACCGAGGTCCATCAGG + Intronic
1073003669 10:100304875-100304897 GATTTGAACCTAGATCTGTCTGG - Intronic
1075298843 10:121302315-121302337 CATTTGAAGTGAGATCTGACTGG - Intergenic
1078665365 11:13320441-13320463 GATTTGAACCCAGGTCTGTCTGG - Intronic
1078734284 11:14005843-14005865 GATTTGAACCCAGGTCTCTCAGG - Intronic
1078885788 11:15498511-15498533 GATTGGAACTTAGATCTCTCAGG - Intergenic
1079387773 11:19996165-19996187 GATTTGAATTAAGGTCTCTCTGG + Intronic
1079453895 11:20620740-20620762 GATTTGAACCCAGGTCTATCTGG + Intronic
1079519573 11:21310206-21310228 GATTTGAAACCAGATCTACCTGG + Intronic
1079676260 11:23230681-23230703 GATTTGAACTCAGATGTGTCTGG + Intergenic
1080050773 11:27856610-27856632 GATTTGAACCCAGGTCTTTCTGG - Intergenic
1080658831 11:34279522-34279544 AATCTGAACTCAGATCTATTTGG + Intronic
1080815033 11:35747428-35747450 GATTAGAACCCAGATCTATCAGG + Intronic
1081402864 11:42662893-42662915 GAATTGATCTTAGATCAATCTGG - Intergenic
1081673449 11:44954659-44954681 GACTTGAACCCAGATCTGTCAGG - Intergenic
1082030292 11:47598699-47598721 GATTTAAACTCAGAGCTATCTGG + Intergenic
1082890913 11:58137681-58137703 GATTTGAACTGTGGTCTGTCAGG - Intronic
1084183320 11:67457313-67457335 GATTTGAACCGGGCACTATCTGG + Intronic
1085268866 11:75257863-75257885 GATTTGATCTGAGATCAAACAGG - Intergenic
1086051569 11:82597880-82597902 GATTTAAACTAATATCTGTCTGG + Intergenic
1087088573 11:94244765-94244787 GATTTGAACTCAGGTCCATGTGG - Intergenic
1087104366 11:94395471-94395493 GATTAGGACTGAGGTCTGTCTGG - Intronic
1087788271 11:102380056-102380078 GATTTGAACACAGATCTGCCTGG + Intergenic
1088324687 11:108589608-108589630 AATTTGAACCTAAATCTATCTGG - Intronic
1088544419 11:110945545-110945567 GATTTGAACTCAAATCTGTTTGG + Intergenic
1088890332 11:114038961-114038983 GATTTGAACTCACATCTGTCTGG + Intergenic
1088971446 11:114778182-114778204 GATTTCAGCTGAGATCTAGTGGG + Intergenic
1089838697 11:121394704-121394726 GATTTGAACCCAGATTTGTCTGG + Intergenic
1089867740 11:121646712-121646734 GTTTTGAGCCCAGATCTATCTGG + Intergenic
1090955560 11:131510478-131510500 GATTTGAACTGAAATCTGTCTGG - Intronic
1093832646 12:23782997-23783019 CATTTGAACTGAGAACTCACAGG - Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1094172473 12:27508184-27508206 GATTTGAATCTAGATTTATCTGG + Intergenic
1095864218 12:46954059-46954081 GATTTGAACTAAAGTCTGTCTGG + Intergenic
1096719503 12:53510503-53510525 GATTACAACTGAGTTCTGTCTGG - Intronic
1097278430 12:57829022-57829044 GATTTGAACTTAGATTTCTCTGG - Intronic
1098535444 12:71589239-71589261 GATTTGAACCCAGGTCTGTCTGG - Intergenic
1099093150 12:78338933-78338955 GATATGCACTGTGATGTATCTGG + Intergenic
1099106459 12:78502721-78502743 AATTTGAATCCAGATCTATCTGG + Intergenic
1100093573 12:91003359-91003381 GATTTGAACTCAGAACCAACAGG + Intronic
1100728465 12:97436099-97436121 GATTTGAATTTAGAATTATCTGG - Intergenic
1101157511 12:101941711-101941733 GATTTGAACTTAGGTCTATTTGG + Intronic
1101597711 12:106181886-106181908 GATTTGAACTGAGGTCTGTCAGG - Intergenic
1102009114 12:109607126-109607148 GATTCGAACCCAGTTCTATCTGG - Intergenic
1102193430 12:111006729-111006751 GATTTGAGCTCAGATCTCTCTGG - Intergenic
1102685336 12:114720259-114720281 GATTTGAACTGAGGTCTGTCTGG + Intergenic
1103003691 12:117405497-117405519 GATTTGAACTCAGCTCTTCCTGG + Intronic
1103160888 12:118728359-118728381 AATTTGAACTGAAGTCCATCTGG + Intergenic
1103231907 12:119338531-119338553 GATTTGAATTCATATCTGTCTGG + Intronic
1103235039 12:119365175-119365197 GATTCGAACCCAGCTCTATCTGG + Intronic
1106464159 13:29997895-29997917 GGTTTGAACTCACATCTTTCTGG + Intergenic
1107194911 13:37638967-37638989 GATTTTAAATGTGCTCTATCTGG + Intronic
1108234436 13:48388619-48388641 GATTTGAACCCAGGTCTTTCTGG + Intronic
1110366769 13:74695592-74695614 GAATTGAACTGAGCTCCAGCTGG - Intergenic
1110715672 13:78701263-78701285 CATTTGAAATGAAATCTACCAGG + Intergenic
1111947189 13:94678136-94678158 GATTGGAGCTGAGAGCTAGCTGG + Intergenic
1112807044 13:103174294-103174316 GATTTGAACTTGGTTCTGTCTGG + Intergenic
1114901874 14:27071544-27071566 GATCTGAATGGAGAACTATCTGG + Intergenic
1115448527 14:33519501-33519523 GATTTGAAGTCAGAGCCATCTGG + Intronic
1118610753 14:67537730-67537752 AATTTGACCTGGGATCTCTCTGG - Intronic
1118729623 14:68657245-68657267 GATTTGAACCTAGATCTCTGTGG - Intronic
1119677708 14:76568297-76568319 GATTTGAACCTAGGTCTGTCTGG - Intergenic
1119780459 14:77273616-77273638 GATTTGACCTCAGGTCTCTCTGG + Intergenic
1120019095 14:79508043-79508065 GATTTGAACTCATATCTATTTGG + Intronic
1120373838 14:83674399-83674421 AATTTGGTCTGTGATCTATCTGG + Intergenic
1121516041 14:94550445-94550467 GATTTGAACTCAGAAATTTCTGG - Intergenic
1122250873 14:100438892-100438914 GATTTGAACTCAGAACTGCCTGG + Intronic
1125681430 15:41533019-41533041 GATTTAAACCCAGATCTACCTGG - Intronic
1126187495 15:45844638-45844660 TATTTGAATTGAGATAAATCTGG + Intergenic
1127828608 15:62728985-62729007 GTTTAGAACTTTGATCTATCTGG + Intronic
1128218821 15:65953340-65953362 GATTTGAACTTAGATTTGTCTGG + Intronic
1128305463 15:66595344-66595366 GATTTGAATTAAGAACCATCTGG - Intronic
1129464103 15:75714137-75714159 GATTTGAACCCAGGTCTCTCTGG - Intergenic
1129638591 15:77350101-77350123 GCTTTGAACAGAGACCTATTTGG - Intronic
1129699141 15:77757630-77757652 GACTTGAAATGACATCTTTCTGG - Intronic
1131529469 15:93179523-93179545 GATTTGAACTCAGGACTATCTGG + Intergenic
1131818394 15:96246357-96246379 GAGTTGACCAGAGATCTCTCAGG + Intergenic
1133384840 16:5361160-5361182 GATTTGAACCCAGGTTTATCTGG + Intergenic
1133396216 16:5449530-5449552 GATTTGAACCCACATCTATCTGG + Intergenic
1133835972 16:9367508-9367530 GAATTAAATTGAGATCTATCTGG + Intergenic
1133907210 16:10033237-10033259 GATTTGAACCCAGACCTATTTGG - Intronic
1134325686 16:13205480-13205502 GATTTGAACTCACATCTGTTTGG - Intronic
1134331118 16:13251937-13251959 GATTTGAACTCAGTTCTCGCTGG - Intergenic
1134386368 16:13777210-13777232 GCTTTAAACTGGGGTCTATCTGG + Intergenic
1134400783 16:13907844-13907866 GAATGGACCTGAGATATATCTGG - Intergenic
1135237325 16:20769705-20769727 GATTTGAACCCAGAACTATCAGG - Intronic
1135269581 16:21057548-21057570 GATTTGAACTCAAGTCCATCAGG + Intronic
1137849826 16:51730684-51730706 GGTTTGAACTCAGATCTGGCTGG + Intergenic
1137888866 16:52137107-52137129 CATTTGAACTGATATTAATCTGG - Intergenic
1138130250 16:54473230-54473252 GATTAGAACGCAGATCTATCTGG + Intergenic
1138184310 16:54964484-54964506 GATTTGAACCAAGGCCTATCTGG + Intergenic
1138722922 16:59102793-59102815 GAATTGAACTCAGATCTATTAGG + Intergenic
1140782655 16:78310811-78310833 GAATTGAACTGGGTTCTCTCAGG - Intronic
1143500547 17:7336361-7336383 GATTTGAACCTAGATCTGCCAGG + Intergenic
1143599974 17:7938702-7938724 GATTTGAACCCAGGTCTACCTGG + Intronic
1143737498 17:8923236-8923258 GATTCGAACTAAGGTCTCTCTGG + Intronic
1143985925 17:10914158-10914180 AATTTGAACTGAGATCTGTCTGG - Intergenic
1145816683 17:27799890-27799912 GATTTGAACCCAGGTCTATGGGG - Intronic
1145975389 17:28981206-28981228 GATTTGAGCTCAGGTCTATCTGG + Intronic
1146012294 17:29205649-29205671 GATTTGAACCCAGGTCTGTCTGG - Intergenic
1146874359 17:36396487-36396509 GATTTGAACCCAGATCTCTCTGG - Intronic
1146881710 17:36447402-36447424 GATTTGAACCCAGATCTGTCTGG - Intergenic
1147065027 17:37916384-37916406 GATTTGAACCCAGATCTCTCTGG + Intergenic
1148284660 17:46377173-46377195 GATTTGAACTCAGATCAGCCTGG + Intergenic
1148306881 17:46595094-46595116 GATTTGAACTCAGATCAGCCTGG + Intronic
1150083064 17:62258844-62258866 GGTTTGAACTGAGATCTGCCAGG + Intergenic
1150123809 17:62623766-62623788 GATTTGAACTCAGGTTTCTCTGG + Intergenic
1150625727 17:66839997-66840019 GATTTGAACTCAGTTCTGTGTGG - Intronic
1150691613 17:67371863-67371885 GATTTGAACTAAGATCAAGGTGG + Intergenic
1153804594 18:8701580-8701602 GATTTGAACCCAGATTTACCTGG + Intergenic
1155187611 18:23401240-23401262 AATTTGAATTGAGGTCTGTCTGG + Intronic
1155847115 18:30721820-30721842 AATTTGCACTGAAATTTATCTGG - Intergenic
1156646480 18:39168217-39168239 GATTTAAACTCAGGTCTATCTGG - Intergenic
1157129781 18:44995975-44995997 GATTTGAACTGATATTTTTTAGG + Intronic
1157445092 18:47738483-47738505 GATTGGAATTGAAATCTGTCAGG - Intergenic
1158856542 18:61548321-61548343 GATTTGAACTCTGGTCTCTCTGG - Intronic
1160522643 18:79517165-79517187 GATTTGGCCTGAGATATTTCTGG + Intronic
1163171444 19:15534319-15534341 GATTTGAACTCAGACCTGGCTGG + Intronic
1166366310 19:42280252-42280274 GATTTGAACCCAAATCTATCTGG - Intronic
1167752609 19:51389716-51389738 AATTGGAACTGAGTTCTGTCTGG - Intronic
926482108 2:13412191-13412213 GATTTAAACTATGGTCTATCTGG + Intergenic
926871291 2:17420658-17420680 AATTTAAAGTGAGATCCATCAGG - Intergenic
927872173 2:26630606-26630628 GATTTGAATGTAGATCTGTCCGG - Intronic
931347023 2:61455939-61455961 GATTTGAACTCAGGTCTACCAGG + Intronic
931419926 2:62117496-62117518 GTTTTAAACCCAGATCTATCTGG - Intronic
931929262 2:67110720-67110742 TATTTGCCCTGAGATCTATTGGG - Intergenic
932645789 2:73500086-73500108 CATTTGAGCTGAGATTTTTCTGG + Intronic
933208863 2:79542004-79542026 GCTTTCAACTGAGAGCTTTCTGG + Intronic
933558509 2:83862255-83862277 GATTTGAACTCAGATAGTTCTGG - Intergenic
933568030 2:83975207-83975229 GATTTGAACCCAGATCTGTTTGG + Intergenic
935577834 2:104729305-104729327 GATTTGAAGTGGGACCCATCTGG - Intergenic
936414084 2:112288586-112288608 AATTTGAACACAGATCTTTCTGG + Intronic
936981223 2:118267237-118267259 GATTTGAACTCTGGTCTGTCCGG - Intergenic
937272736 2:120663848-120663870 AATTTGAACTCATATCTAACTGG + Intergenic
939291109 2:140195758-140195780 GATTTGAACTGAAATCAAAGTGG + Intergenic
939616397 2:144366249-144366271 GATTTGCACTCAGATTTGTCAGG + Intergenic
940497628 2:154453493-154453515 TATTTGAACTGAGATCACTAAGG - Exonic
941964040 2:171283214-171283236 GATTTGAACTTATGTCTATCTGG + Intergenic
942843948 2:180400345-180400367 CACTTGAATTGAGATCTAACAGG + Intergenic
944066201 2:195621973-195621995 GATTTAGACTGAAATCTGTCTGG + Intronic
944633558 2:201652781-201652803 CAGTGGAAGTGAGATCTATCGGG - Intronic
946831092 2:223728787-223728809 GATTTGAACTAAGTTCAGTCTGG + Intergenic
948172782 2:235918925-235918947 GATTTCAGCTGAGACATATCAGG + Intronic
948545020 2:238721742-238721764 GATTTGAACCCAAATTTATCTGG - Intergenic
1168845172 20:939712-939734 GGTTTGAACTCAGGTCTGTCTGG - Intergenic
1168846606 20:949530-949552 CATTTGAACTGAGATGTAGAGGG + Intergenic
1168846622 20:949633-949655 CATTTGAACTGAGATGTAGAGGG + Intergenic
1171949933 20:31412380-31412402 GATTTGAACCCAGATTTGTCTGG - Intronic
1172356308 20:34282678-34282700 GATTTGAACCCAGGTCTATCTGG + Intronic
1172357947 20:34292666-34292688 GGTTTGAACTCAGATCTATCTGG - Intronic
1172699403 20:36843644-36843666 GATTTGAACACAGATCCATCTGG - Intronic
1172884133 20:38220017-38220039 GCTTTGAACCCAGATCTGTCCGG - Intronic
1173199964 20:40947193-40947215 GATTTGAACTCAGGTCTGCCTGG + Intergenic
1173476576 20:43364073-43364095 GATTTGAACTCAGAACTTCCTGG + Intergenic
1173615982 20:44403248-44403270 GATTTGAGCCCAGATCTTTCTGG - Intronic
1174909050 20:54586725-54586747 GATTTAAACTGAGACCCATGTGG + Intronic
1177162111 21:17559168-17559190 GATTTGGACTAAGATCTAGTAGG + Intronic
1181823007 22:25490446-25490468 GATTTGAACTCAGGTCTGTGGGG + Intergenic
1181869796 22:25888720-25888742 GATTTGAACTCAGACCAGTCAGG - Intronic
1182091203 22:27596094-27596116 GATTTGAACCTAGGGCTATCTGG - Intergenic
1182563461 22:31180045-31180067 GACTTGAACTCAGAACTTTCAGG + Intronic
1182785130 22:32901252-32901274 GATTTGAACTCAGATCTCACTGG - Intronic
1183867180 22:40713138-40713160 GATTTGAACCTGGGTCTATCTGG + Intergenic
1183960431 22:41408483-41408505 GACTCAAACTGAGATCTATCTGG + Intergenic
949844281 3:8354145-8354167 GATTTGAACTCAGGTCTGCCTGG + Intergenic
950231571 3:11280457-11280479 GATTTGAACTCAGGTCTCTCTGG + Intronic
952788449 3:37178021-37178043 AATTTGAACTCAGATCTCTCTGG + Intronic
953118899 3:40019921-40019943 GTTTTGAACTGACATCTTTTAGG + Intronic
954164171 3:48742831-48742853 TAATGGTACTGAGATCTATCAGG - Intergenic
954808347 3:53232960-53232982 GATTTAAACTCAGATCCGTCTGG - Intronic
954904276 3:54046536-54046558 GATTTGAACTCAGGGCTATCTGG + Intergenic
955141061 3:56270518-56270540 GACCAGAACTGAGATCTATCTGG + Intronic
955819950 3:62886127-62886149 GATTTGAACCCAAACCTATCTGG - Intergenic
956095692 3:65713635-65713657 GACTTGAACTGAGGTCTCTTTGG - Intronic
956554357 3:70501654-70501676 GATTGGAACTCAAATCCATCTGG + Intergenic
958097803 3:88970392-88970414 GATTTGAACTGAGTAGTATGGGG + Intergenic
958424216 3:93962979-93963001 GATTTGAACTTTGAACTAGCTGG - Intronic
958500472 3:94900591-94900613 GATTTGAACCCAGATTTATGTGG - Intergenic
960260429 3:115561764-115561786 GATTTGAACTCACATTCATCTGG - Intergenic
960525346 3:118703686-118703708 CATTTGAGCTGAGATCTAAGTGG - Intergenic
961829824 3:129617751-129617773 GATTTGAACCCAGATCCTTCTGG - Intergenic
962530163 3:136272458-136272480 GAATTCAACTGTGATCCATCTGG + Intronic
962657657 3:137565125-137565147 AATTAGAACTCAGATCTAGCTGG + Intergenic
963785859 3:149533667-149533689 GATTTGAACTCCAATCTTTCTGG - Intronic
964100168 3:152979339-152979361 TATTTAAACTGAGATCTAAGTGG - Intergenic
964524686 3:157606012-157606034 GATTCGAACCGAGGTCTCTCTGG + Intronic
966241886 3:177763416-177763438 GATTTAAACTCAGGTCTACCAGG - Intergenic
966704727 3:182899634-182899656 GATTTGAACTGAGATCTATCAGG - Intronic
966740860 3:183232057-183232079 CATATGAACTCAGATCTATATGG + Intronic
967189541 3:186973573-186973595 AATTGGAACTCAGATCTGTCAGG - Intronic
967537251 3:190620688-190620710 AATTTGAACACAGATCTGTCTGG - Intronic
967610331 3:191498447-191498469 AATTTGAACTCAGCTCTATAAGG + Intergenic
969475677 4:7421343-7421365 GACTGGAACTCAGATCTATCAGG - Intronic
969491953 4:7504567-7504589 GATTTGAACCCACATCCATCTGG + Intronic
970014856 4:11502217-11502239 TGTTTGAACTGAAATCTAACGGG + Intergenic
970162689 4:13205157-13205179 GATTTGAACTCAGACCCATTGGG - Intergenic
970656039 4:18230771-18230793 CATTTGAACTGAGATCTGAGTGG - Intergenic
971378419 4:26074094-26074116 GATTTGAACTCATATCTCTGGGG + Intergenic
972409781 4:38781997-38782019 GATTTGAACCCAGACCTGTCTGG + Intronic
974108757 4:57501575-57501597 GATTTGAACTCAGATTTTTGTGG + Intergenic
975155351 4:71066217-71066239 GATTTGAACCAGGATCTCTCTGG + Intergenic
975477787 4:74843264-74843286 GATTTCAGCTGAGATTGATCTGG - Intergenic
975599110 4:76080893-76080915 GATTTGAACTCTGATCTGCCTGG + Intronic
976580924 4:86735969-86735991 GATTTGAACCCATGTCTATCTGG + Intronic
977632027 4:99253555-99253577 GATTTGAACCCAGATCTATTAGG - Intergenic
979219469 4:118205679-118205701 GATTTAATCTCAGGTCTATCTGG - Intronic
979802639 4:124929459-124929481 TATTTTAACTGATATCTATTTGG + Intergenic
981808342 4:148743355-148743377 GATTTTAACTGAGATCCAGAAGG + Intergenic
982096312 4:151926629-151926651 CATTTGAGCTGAGATCCAACGGG - Intergenic
982306481 4:153936920-153936942 AATGTGAATAGAGATCTATCTGG - Intergenic
983774584 4:171591456-171591478 TATTTGAATTGATGTCTATCAGG + Intergenic
983942623 4:173551700-173551722 GATTTGAACCCAGATCTGTCTGG - Intergenic
984584768 4:181550840-181550862 CATTTGAATTCAGATCTATCAGG + Intergenic
984888405 4:184472113-184472135 GACTTGAACTGGGATCTCTAGGG - Intronic
985200645 4:187481565-187481587 GATTTGAACGGAGCACTCTCTGG - Intergenic
985371872 4:189293602-189293624 GATTTGAAATGAGATTTGGCTGG - Intergenic
987193783 5:15504790-15504812 CACTTGAACTGAGATTTATTTGG - Intronic
988642947 5:33061776-33061798 GATTAGGACTCAGATCTCTCTGG + Intergenic
988888846 5:35591315-35591337 AATCTGAAATGAGATCCATCTGG + Intergenic
989430694 5:41351808-41351830 CATTTAAACTGAGATCTGTTTGG - Intronic
991368545 5:65894453-65894475 GATTTGAGCTGAGATCTGAATGG - Intergenic
992377343 5:76200951-76200973 GTTTTAAACTGAGATCTACTTGG + Intronic
992711827 5:79466202-79466224 AATTTTAAATGTGATCTATCAGG - Intronic
993408508 5:87544412-87544434 AATTTGAACTGACATATATATGG - Intergenic
994123981 5:96149847-96149869 GATTTAAACTTAGGTCTTTCAGG + Intergenic
995756169 5:115506665-115506687 TGTTTGAACTGAGATCTAAGAGG - Intergenic
995903477 5:117095481-117095503 GATTAGAAATGAGATATCTCAGG - Intergenic
996209768 5:120793421-120793443 GCTTTGAACTGAGATCTGAAGGG + Intergenic
996340445 5:122432673-122432695 GATTGCAACTGAGAGCCATCTGG - Intronic
999292403 5:150434809-150434831 GATTTGAACTTAGCTCTGCCTGG - Intergenic
999997425 5:157105669-157105691 GATGTAAACTCAGCTCTATCTGG + Intronic
1000436643 5:161218804-161218826 GATTTGAAGTGAGATTATTCTGG + Intergenic
1000950019 5:167469985-167470007 TATTTGAAGTGAGTTATATCTGG - Intronic
1001214239 5:169840381-169840403 GATTTGACCTGAGATTTCGCCGG + Intronic
1001338355 5:170820790-170820812 GATTTGAACCCAGGTCTATTTGG + Intergenic
1001530880 5:172460827-172460849 GATTTGAACTCAGATCTGTCTGG + Intergenic
1001759794 5:174197847-174197869 GATCTGAACTGAGATCCTTTGGG - Intronic
1001951107 5:175817234-175817256 AATTTGAACCCAGATCTTTCTGG - Intronic
1003657527 6:8027046-8027068 GATTTGAAGTCAGATCTTTCTGG + Intronic
1003970352 6:11293317-11293339 GATTTGAACCCAGACCTTTCTGG + Intronic
1006450761 6:34104558-34104580 GATTTGAACCCAGGTCTGTCTGG + Intronic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1008701177 6:54102134-54102156 GATTTGAACTCAGGTCCACCTGG - Intronic
1008883649 6:56408906-56408928 GAATTGAACTGATATGTATCAGG + Intergenic
1009721893 6:67482479-67482501 GATTTGATCTGAGCTCTAATAGG - Intergenic
1012979708 6:105816596-105816618 GATTTGAACTCAGAATAATCTGG - Intergenic
1013961023 6:115900285-115900307 GATTTGAACTCAGCTCTAAGCGG - Intergenic
1014272151 6:119348257-119348279 GATTTGACCTTAGATCTTACTGG + Intronic
1014522670 6:122464423-122464445 GATTTAAACTCAGACTTATCTGG + Intronic
1016001003 6:139041065-139041087 GATTTCAACTGAGGACTATTAGG + Intronic
1016063257 6:139652433-139652455 GATTTGAACTTAGATCTACTTGG + Intergenic
1016350975 6:143166885-143166907 GATTTGAACCCAGGCCTATCTGG + Intronic
1016945377 6:149527449-149527471 GATTTGAACCTACATTTATCTGG + Intronic
1019063425 6:169275038-169275060 GATGAGAACTGAGCTGTATCTGG - Intergenic
1019802604 7:3099427-3099449 GTTTTGAACTCAGATCTCTCTGG - Intergenic
1021369552 7:19825919-19825941 AATTGGAAATGAGAACTATCAGG + Intergenic
1023330981 7:39116602-39116624 GTTTTGAACTCAGGTCTCTCTGG + Intronic
1023455014 7:40329147-40329169 CACCTGAACTGAGATCTATCAGG - Intronic
1023627945 7:42135426-42135448 GATTTGACCTGAGATATATCTGG - Intronic
1024109121 7:46127378-46127400 GAATTGAACTCAGGTCTATGTGG - Intergenic
1026126983 7:67587652-67587674 GATTTGAACCCAGATCTGTTTGG - Intergenic
1026305011 7:69133153-69133175 GATTTGAATTGAAGTCTTTCTGG + Intergenic
1026379717 7:69787056-69787078 AATTTGAACTCAGCTCTTTCTGG + Intronic
1027137023 7:75631783-75631805 GGTTTGAACTGGGACCTCTCTGG + Intronic
1030116666 7:106066823-106066845 GATTTGACCTGAGATATATTTGG - Intergenic
1030339993 7:108366787-108366809 GAGTTGGACTCAGATATATCTGG - Intronic
1030536919 7:110779468-110779490 GACTTGAACTGAGGTCTGGCAGG + Intronic
1031140360 7:117936030-117936052 GAATGTAACTGAGATCTATAAGG - Intergenic
1034849254 7:154478682-154478704 GATTTGAACCTAGGTCTGTCTGG + Intronic
1036669205 8:10769449-10769471 GCTTTGAACTGAGATGACTCTGG + Intronic
1036916000 8:12804524-12804546 GATTTGAACTGAGTCATACCGGG - Intergenic
1037122522 8:15306019-15306041 GTTTTGAAATGATATCTAACTGG - Intergenic
1038406750 8:27327744-27327766 GATTTGAACCCAGATCTGTCTGG - Intronic
1039286111 8:36042519-36042541 GATTCAAACTAAGAACTATCTGG + Intergenic
1040577798 8:48669479-48669501 ACTTTGAAGTGAGATCTATCAGG + Intergenic
1040862844 8:52018044-52018066 GTTTTCAACTGAGATCTTCCAGG - Intergenic
1042176282 8:66039834-66039856 AATTTGGAATGAAATCTATCAGG + Intronic
1042176960 8:66046560-66046582 GTTTTGAATTTAGAGCTATCTGG - Intronic
1044687247 8:94838657-94838679 GATTTGAACTTAGTTTTGTCTGG - Intronic
1046686566 8:117234386-117234408 GATTTGAACCCAGACCTATTGGG + Intergenic
1047797238 8:128270101-128270123 GATTTGAATCCAGATCTGTCTGG + Intergenic
1047809969 8:128397742-128397764 GTTTTGACATGAGCTCTATCTGG + Intergenic
1048288217 8:133158908-133158930 GATTTGAACCTGTATCTATCTGG - Intergenic
1048507664 8:135035399-135035421 GATTTGAACTCTGGTCTGTCTGG + Intergenic
1050142541 9:2531413-2531435 GAGTTGAACCCAGATCTGTCTGG + Intergenic
1051722759 9:20055585-20055607 GATTTGAACTTAGACATACCAGG + Intergenic
1052275297 9:26668595-26668617 GATTTGAACATAGAACTCTCTGG + Intergenic
1055645725 9:78359676-78359698 GATTGGAACTCAGGTCTCTCTGG - Intergenic
1056942653 9:90968666-90968688 GATTTGAACCCAGTTGTATCTGG - Intergenic
1057389473 9:94630743-94630765 AATTTGAACTGAGGTCTTTCTGG - Intronic
1058939556 9:109800448-109800470 GATTCAAACTCAGATCTGTCTGG + Intronic
1060080779 9:120642397-120642419 GATTTGAGCCCAGATCTGTCCGG - Intronic
1060099761 9:120829262-120829284 AACTTAAAATGAGATCTATCAGG - Intronic
1060246688 9:121952476-121952498 GATTTGAACCTAGGTCTGTCAGG + Intronic
1060409143 9:123388787-123388809 GATTTGAACCCAGATCTGCCTGG - Intronic
1060886022 9:127153024-127153046 GATTTGAACAGAGATCCCTCAGG + Intronic
1060887213 9:127162893-127162915 AATTTGAACCCAGGTCTATCAGG - Intronic
1060909526 9:127338527-127338549 GATTCGAACTCAAATCTATTTGG - Intronic
1061699794 9:132407229-132407251 CATTTGAACTGAGTTCTAAATGG + Intergenic
1062227268 9:135459945-135459967 GATTTGAACTCAGACCTGGCTGG + Intergenic
1187509494 X:19904862-19904884 GTTTTGAACTAAGGTCTATGAGG + Intergenic
1188534321 X:31179652-31179674 GATTTGTACTCAGGTCTGTCTGG + Intronic
1188646858 X:32579442-32579464 GATTTGACCTCAGATCCATTTGG + Intronic
1189381048 X:40502410-40502432 GATTTGCACTGAAATCTCTCTGG + Intergenic
1192183816 X:68932398-68932420 GATTTGAACAGCGTTCTGTCTGG + Intergenic
1192246938 X:69380467-69380489 GATTTCAATTCAGATCTGTCTGG + Intergenic
1192556365 X:72092812-72092834 GATTTGAACTCAGATCTGTTGGG - Intergenic
1194012785 X:88583125-88583147 GTTGTGAACAGAGATCTTTCAGG - Intergenic
1194815174 X:98432228-98432250 GATTTGAACACAAATCTATTGGG + Intergenic
1196976396 X:121162330-121162352 AATTTGAACATAGATCTGTCTGG + Intergenic
1197085320 X:122467195-122467217 GATTTGAACTCCAATCTATCTGG - Intergenic
1197121359 X:122897183-122897205 GATTTGAACTGAGGTCTATATGG - Intergenic
1197735431 X:129847309-129847331 GATTTGAACCGAGGCCTGTCTGG - Intergenic
1197867188 X:131031524-131031546 GATTTGAGTTCAGGTCTATCTGG - Intergenic
1198675991 X:139131228-139131250 GATTTGAACCCAGATTTATCTGG - Intronic
1201676333 Y:16588959-16588981 GAATTGAACAGAGAGCAATCTGG + Intergenic