ID: 966705272

View in Genome Browser
Species Human (GRCh38)
Location 3:182906737-182906759
Sequence AAAATTTATGAGCCAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966705272_966705275 26 Left 966705272 3:182906737-182906759 CCCACACCTGGCTCATAAATTTT 0: 1
1: 0
2: 1
3: 31
4: 277
Right 966705275 3:182906786-182906808 AAAAAAGAAGAAGAAGAAGAAGG 0: 104
1: 407
2: 1338
3: 3905
4: 16682
966705272_966705276 30 Left 966705272 3:182906737-182906759 CCCACACCTGGCTCATAAATTTT 0: 1
1: 0
2: 1
3: 31
4: 277
Right 966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966705272 Original CRISPR AAAATTTATGAGCCAGGTGT GGG (reversed) Intronic
901913762 1:12481626-12481648 AGAATTAATGATCCAGGTGGTGG - Intronic
902275961 1:15339521-15339543 AAAACTTATGAGCCAGGCCCAGG + Intronic
904972470 1:34429804-34429826 TAAATAAATTAGCCAGGTGTGGG - Intergenic
905760843 1:40556782-40556804 AAAATTTATTAGAAAGGTTTTGG + Intergenic
907000904 1:50854670-50854692 AAAAATAATGTGCCAGGTCTGGG + Intronic
908767665 1:67569062-67569084 AAAAGTTATCAGCCAGGTGGGGG - Intergenic
908794471 1:67817472-67817494 AAAGATTATGATCCAGGTTTTGG - Intronic
909490601 1:76221895-76221917 AAACTTTATTATCCAGGTCTTGG + Intronic
909699123 1:78500777-78500799 TAAATATATGAGCTATGTGTAGG + Intronic
910257304 1:85260450-85260472 AAAATGTAAGATCCAGGTGGTGG - Intergenic
911573278 1:99543431-99543453 ACCCTTTATGAGCCAGGCGTGGG - Intergenic
912119274 1:106450148-106450170 AAAAAATATTAGCCAGGTATGGG - Intergenic
912426462 1:109596812-109596834 AAAATGTCTGAGCCAGGTCATGG + Exonic
915282471 1:154831995-154832017 AAACTTTAGAACCCAGGTGTTGG + Intronic
916749540 1:167712143-167712165 CAAAAATATTAGCCAGGTGTGGG + Intergenic
917864434 1:179179954-179179976 AAAAAAAATTAGCCAGGTGTTGG + Intronic
919507268 1:198415055-198415077 AAAATTTATGAGGTAGGTAGTGG - Intergenic
923208818 1:231784562-231784584 AAAATTTATGTGCCTGATTTTGG + Intronic
923607000 1:235453146-235453168 AAACTTTATGGGCCATGTATAGG - Exonic
1064620524 10:17212163-17212185 AAATTTCATTAGCCAGGTGTGGG + Intergenic
1064970425 10:21060553-21060575 AAAATATATGAGCCAGTAGAGGG - Intronic
1065313917 10:24443230-24443252 TAAACTTTTGAGCCAGGTCTTGG + Intronic
1065972105 10:30813791-30813813 AAAATTTAAGAAGCAGGTCTAGG - Intergenic
1066552238 10:36571934-36571956 AAAATTTATCAAGCAGGTTTTGG - Intergenic
1066953687 10:42145782-42145804 AGACTCTCTGAGCCAGGTGTGGG + Intergenic
1067931979 10:50571152-50571174 AAAATTTATTAGGCAGCTATTGG - Intronic
1068539912 10:58280613-58280635 AAAACTGATGAGTCAAGTGTAGG + Intronic
1068674796 10:59759844-59759866 TAAAGTTAGGAGCCAGGAGTCGG - Intergenic
1069732745 10:70629736-70629758 AAAAACAATTAGCCAGGTGTTGG + Intergenic
1070629546 10:78075284-78075306 AAAAAAAATTAGCCAGGTGTGGG - Intergenic
1073370475 10:102984063-102984085 AAATTTTATGAGCCTACTGTTGG + Intronic
1075582027 10:123626075-123626097 ACAATTTTTGAGTCAGGTATAGG - Intergenic
1076483244 10:130798660-130798682 ACAAAATATTAGCCAGGTGTGGG + Intergenic
1078151687 11:8764994-8765016 AGAATTTAGGGGCCAGGCGTTGG - Intronic
1078173782 11:8952698-8952720 AAAATCTGTGGGCCAGGTGTGGG - Intronic
1078551967 11:12287383-12287405 ATAATTCCTGAGCCAGGGGTGGG - Intronic
1080925119 11:36748211-36748233 AATATTTATGTGCCATGTGCTGG - Intergenic
1082912497 11:58392322-58392344 AAAATTTTTTAGCCAGATCTGGG + Intergenic
1083808867 11:65091248-65091270 AAAAATTAGGAGCTAGGGGTAGG - Intronic
1084610467 11:70199364-70199386 GAAATTTCTGGGCCAGGTGCAGG - Intergenic
1085187285 11:74586520-74586542 AAAGTTTTTGAGTCAGGTGTTGG - Intronic
1085488872 11:76894919-76894941 AAAATTTATCAGACAGATCTTGG - Intronic
1085820182 11:79784102-79784124 AAAAGTTGAGAGCCAGCTGTGGG - Intergenic
1086255314 11:84868826-84868848 AAAATTTATCAGCAAGGTGCTGG + Intronic
1086512170 11:87570804-87570826 ATAAATTATTAGCCAGGCGTGGG - Intergenic
1087478551 11:98669363-98669385 AAAATTTATGTGGCTGTTGTTGG - Intergenic
1088436486 11:109818710-109818732 AACATTTATCAGCCATGTGCAGG - Intergenic
1089234547 11:117012126-117012148 AAAAATAATTAGCCAGGTGTGGG - Intronic
1089509087 11:118984559-118984581 AAAATACATTAGCCAGGCGTGGG + Intergenic
1090792428 11:130102987-130103009 AAAATTAATGCCCCATGTGTTGG - Intronic
1090987712 11:131786190-131786212 AAAATTTTTAAGACAGGTCTTGG + Intronic
1091385111 12:89005-89027 AAAATAAATAAGGCAGGTGTAGG + Intronic
1092474707 12:8808671-8808693 AAAGTATATGCGTCAGGTGTGGG - Intergenic
1092508933 12:9133033-9133055 AAACTTTATGAAAAAGGTGTGGG + Intergenic
1092692758 12:11132029-11132051 AAAATACATGAATCAGGTGTGGG + Intronic
1094393729 12:29981702-29981724 AAAATTAATCAGCCAACTGTTGG + Intergenic
1095948947 12:47771103-47771125 AAAATTTAATAGGCAGGGGTGGG + Intronic
1096484890 12:51973072-51973094 AAAAATAATGAGCCACGTGTGGG + Intronic
1096965071 12:55619501-55619523 ACAATTTATGAGCCAGGTTAAGG + Intergenic
1098103881 12:67048977-67048999 AAAAAAAATTAGCCAGGTGTGGG - Intergenic
1098222659 12:68286471-68286493 AACATTTGTGGGCCAGGTGTGGG + Intronic
1098847272 12:75553086-75553108 AAAAGTCATAAGCCAAGTGTTGG - Intergenic
1100217531 12:92467873-92467895 AACATTAAAGAGCCAGGTATAGG + Intergenic
1100333171 12:93604811-93604833 AAAAAATATCAGCCAGGTGTGGG - Intergenic
1101653499 12:106698262-106698284 AAAATTAATTGGCCAGGTGTAGG - Intronic
1101771512 12:107756103-107756125 AAAGAAAATGAGCCAGGTGTAGG + Intronic
1103435022 12:120918432-120918454 AAAAGTTATGACTCAGATGTTGG - Intergenic
1105287552 13:19018147-19018169 AAAATTTATGATCAAGGTAAGGG - Intergenic
1106177595 13:27344486-27344508 AAAAATTATGAGAGAGGAGTGGG - Intergenic
1107064133 13:36194518-36194540 AAACATGATGAGCCAGATGTGGG + Intronic
1107453826 13:40536396-40536418 AAAAAAAAAGAGCCAGGTGTGGG - Intergenic
1109197451 13:59394238-59394260 AAATTTGATGAACCGGGTGTGGG + Intergenic
1109732135 13:66426683-66426705 AAAATTACTTAGCAAGGTGTTGG - Intronic
1110305016 13:73976166-73976188 ATAATGTATGGGCCAGCTGTGGG - Intronic
1111266192 13:85818006-85818028 TTAATTTATGAGCAAGATGTAGG + Intergenic
1112071313 13:95853470-95853492 AAAGTTTATGAGCACGGAGTTGG + Intronic
1113093060 13:106635294-106635316 AAATTATATGAGCCTGGGGTTGG + Intergenic
1114366057 14:22028058-22028080 AAAAGAGATGACCCAGGTGTTGG + Intergenic
1115064580 14:29242121-29242143 AAAATAGAGGAGCCAGCTGTGGG - Intergenic
1115316035 14:32026214-32026236 AAAATTTAACATCCAGGTATTGG + Intergenic
1117464219 14:55976136-55976158 AAAATTAATGGGCCTGGTGGTGG - Intergenic
1118017392 14:61674113-61674135 AACATTTATTGGCCAGGTGCGGG + Intergenic
1118303024 14:64632178-64632200 AAAATTTAACAGCCAGCTCTTGG + Intergenic
1119166295 14:72496991-72497013 AATATTTATGATCCAGGTACTGG - Intronic
1119734559 14:76973672-76973694 AAAAAAAATTAGCCAGGTGTAGG - Intergenic
1120252380 14:82074356-82074378 ACAATTTATGCCTCAGGTGTGGG - Intergenic
1120814232 14:88837186-88837208 AAAAGTCAGGAGCCAGGTGATGG - Intronic
1121965222 14:98297257-98297279 ACAATCTCTGAGGCAGGTGTTGG - Intergenic
1123009950 14:105344400-105344422 AAATTTTCTGGGCCGGGTGTGGG - Intronic
1123848152 15:24325626-24325648 AAAATAAAATAGCCAGGTGTGGG - Intergenic
1123867190 15:24532976-24532998 AAAATAAAATAGCCAGGTGTGGG - Intergenic
1127123383 15:55789952-55789974 AAAATTCATGGGGCAGGTGGTGG - Intergenic
1130034730 15:80347936-80347958 TAAATTTATTAGCCAGGGTTTGG - Intronic
1131574723 15:93576607-93576629 AAAACATATGACACAGGTGTTGG - Intergenic
1133048922 16:3105800-3105822 GAGATTTGTGAGCCAGGTTTAGG + Intergenic
1133241214 16:4415809-4415831 AGAATTGCTGAGCCAGGTGCCGG - Intronic
1134443837 16:14315643-14315665 AAAATATATTGGCCAGGTGTGGG - Intergenic
1135300507 16:21322704-21322726 AAAATTTAAGAGCTAGATGCTGG - Intergenic
1135741106 16:24975999-24976021 AAAGTCTATGAGCTAGGAGTAGG + Intronic
1137664745 16:50243525-50243547 AAAATTTTTAGGCCAGGTGCAGG + Intergenic
1137681474 16:50349859-50349881 AAACTTTATGAGCTTGGTGATGG - Intronic
1138028898 16:53543454-53543476 AACATTTATGAGCTTGTTGTGGG + Intergenic
1139587419 16:67913030-67913052 AATTTTTTTTAGCCAGGTGTGGG + Intronic
1140217045 16:73017070-73017092 AAAATAAATCAGCCAGGCGTGGG + Intronic
1141146625 16:81535235-81535257 AAAAATTATGGGCCACGTGGTGG - Intronic
1141532315 16:84655002-84655024 AAAATTTAAAAGCCCGGTGTAGG + Intronic
1142329076 16:89438852-89438874 AAAATAAACTAGCCAGGTGTGGG + Intronic
1144691782 17:17271272-17271294 AAAATAAATTAGCCAGGCGTGGG + Intronic
1144829918 17:18125546-18125568 AAAAAAAATTAGCCAGGTGTAGG + Intronic
1145055055 17:19697140-19697162 AAAAAAAATTAGCCAGGTGTAGG + Intronic
1147050763 17:37792979-37793001 AGAATTTATAAGCCAGCTGGTGG - Intergenic
1148377083 17:47158343-47158365 AAAGTTTATGATACAGGTTTTGG - Intronic
1148689528 17:49519343-49519365 AAAAATATTGAGCCAGGCGTGGG - Intergenic
1148840254 17:50490991-50491013 ACAAAAAATGAGCCAGGTGTGGG - Intergenic
1154044073 18:10887806-10887828 AGAATTCATGAGCCAGGTTGAGG - Intronic
1156007092 18:32454877-32454899 AAAATTTTTGATCCATCTGTTGG + Intronic
1156673250 18:39496369-39496391 AAAATTTATGAACCACTTGAGGG - Intergenic
1156884195 18:42115164-42115186 AAAAAATATCAGCCATGTGTTGG + Intergenic
1157008723 18:43620292-43620314 AAAAAAAATTAGCCAGGTGTGGG - Intergenic
1157084511 18:44565479-44565501 GAAATTTATGAATTAGGTGTAGG - Intergenic
1158341242 18:56468909-56468931 AAAATGTATGAGCCAAGTGCTGG + Intergenic
1158771149 18:60518819-60518841 AAAATGTTTCAGCCAGGTGCTGG + Intergenic
1159269081 18:66125674-66125696 AAATGTTATGAGCCAGATGGTGG + Intergenic
1159762206 18:72442089-72442111 AAAGTTTATGAGACAGTAGTAGG - Intergenic
1160973869 19:1782924-1782946 GAAAATGATGAGCTAGGTGTAGG + Exonic
1161351104 19:3792340-3792362 AAAATTTATCAGTCAGGGTTGGG + Intronic
1162858962 19:13491180-13491202 AAACTTTATGAGACAGGTGAAGG - Intronic
1163270589 19:16250996-16251018 AAAAAAAATTAGCCAGGTGTGGG + Intergenic
1164264621 19:23602700-23602722 AAAAAAAATGAGCAAGGTGTTGG - Intronic
1166781939 19:45347590-45347612 AAAATCTCTGAGCCAGGGGATGG + Intronic
1166824376 19:45600154-45600176 AGAATTTAGGGGCCAGGTGGAGG - Intronic
1166826071 19:45610025-45610047 AAAAAGAATTAGCCAGGTGTGGG - Intronic
1167353078 19:48987789-48987811 AAAAAAAATTAGCCAGGTGTGGG - Intronic
1167653096 19:50744133-50744155 AAAATAAATTAGCCAAGTGTGGG + Intergenic
1167971314 19:53189192-53189214 AAAACTGAAGAGCCAGCTGTAGG + Intronic
1168642932 19:58041719-58041741 AAAAAAAATGAGCCAGGTGTAGG + Intronic
926402087 2:12507650-12507672 TGAATTTATGAGCCAGGTGAAGG + Intergenic
928006006 2:27562361-27562383 AAAAAAAATTAGCCAGGTGTGGG + Intronic
928978255 2:37111701-37111723 AAAAAAAATTAGCCAGGTGTTGG + Intronic
929148566 2:38728070-38728092 AAAATATATGAGACAGCTCTGGG + Intronic
933554068 2:83810010-83810032 ATAATAAATTAGCCAGGTGTTGG + Intergenic
937105630 2:119309715-119309737 AAAAGTTATTAGCCTGGGGTCGG - Intronic
940781272 2:157936703-157936725 AACACTGATGAGCCAGGTCTTGG + Intronic
941638794 2:167965069-167965091 GAAATTTATTAGCCAGGAGAGGG + Intronic
943873375 2:193030993-193031015 ATCATTTATGAGCAAGTTGTTGG - Intergenic
944224633 2:197337713-197337735 GAAATTTAAGATCAAGGTGTTGG - Intergenic
944991453 2:205241724-205241746 AAAATAAATGGGCCTGGTGTGGG - Intronic
945141422 2:206690669-206690691 TGACTTTATGAGCCAGGTGTTGG + Intronic
946740628 2:222797584-222797606 AAAATTTAAAAGCCAGTTCTTGG + Intergenic
947509916 2:230742462-230742484 AAGATTTATTGGCCAGGCGTGGG - Intronic
947548956 2:231032911-231032933 CACAGTTATGTGCCAGGTGTTGG + Intergenic
947766869 2:232643537-232643559 AAAAAAAATTAGCCAGGTGTTGG - Intronic
1169134319 20:3187742-3187764 AAAAATTAAAGGCCAGGTGTAGG + Intergenic
1170030210 20:11936317-11936339 AAATAAAATGAGCCAGGTGTTGG + Intergenic
1170466677 20:16628592-16628614 AAAATATATGAACCCAGTGTTGG + Intergenic
1172237338 20:33387110-33387132 AAAAAAAATTAGCCAGGTGTGGG + Intronic
1172475172 20:35231741-35231763 AATGTTTATGAGCTATGTGTGGG - Intronic
1172790858 20:37504586-37504608 ACATTTGAGGAGCCAGGTGTGGG - Intronic
1173354178 20:42271314-42271336 AACAGTTATCAGCCAGGTGAAGG - Intronic
1174245054 20:49172995-49173017 AAAAAACATTAGCCAGGTGTTGG - Intronic
1174361928 20:50034387-50034409 AAAATTTAATAGCCAGGTGTGGG - Intergenic
1175102001 20:56585909-56585931 AAAAAAAAAGAGCCAGGTGTTGG + Intergenic
1175355717 20:58365814-58365836 AAAAAATATTAGCCGGGTGTGGG - Exonic
1176920145 21:14678434-14678456 AAAATTTGTAAGCCACGTGTTGG - Intergenic
1176983534 21:15410094-15410116 AACTTTTTTAAGCCAGGTGTAGG + Intergenic
1177607591 21:23401541-23401563 AAGATTTCTGGGTCAGGTGTGGG - Intergenic
1177649077 21:23937281-23937303 AAAATTTGTTAACCAGGTTTTGG - Intergenic
1177675715 21:24295730-24295752 AGAATTTATGAGTGAGCTGTTGG + Intergenic
1177707026 21:24719822-24719844 AAAGTCTAAGAGCAAGGTGTAGG + Intergenic
1177909088 21:27008698-27008720 AAAATTTCAGAACCAGGTTTTGG - Intergenic
1178512422 21:33216612-33216634 AAAATATCTGAGACAGGTCTCGG + Intergenic
1179614403 21:42572409-42572431 AAAATGTATTAGTCAGATGTAGG + Intronic
1180557122 22:16587061-16587083 AAAATAAATTACCCAGGTGTGGG - Intergenic
1182701633 22:32244680-32244702 AAAATTATTTAGCCAGGTATGGG - Intronic
1182872851 22:33663916-33663938 GAAATTATTGAGCCAGGTGTTGG - Intronic
1183073020 22:35409417-35409439 AAAATTTATTAGCTGGGTGTTGG + Intronic
1183287212 22:36974496-36974518 AAAAAAAATTAGCCAGGTGTTGG - Intergenic
1183760404 22:39811347-39811369 AAGTTATATGATCCAGGTGTCGG - Intronic
1184998112 22:48225377-48225399 TAAAAATATTAGCCAGGTGTGGG - Intergenic
1185187909 22:49413894-49413916 AAAATTCAAGATCCAGATGTGGG + Intergenic
951752245 3:26049803-26049825 AAAATGGAGGAGCCAGGTTTGGG + Intergenic
951934536 3:28007050-28007072 AAAAAAAATTAGCCAGGTGTTGG - Intergenic
952591680 3:34962774-34962796 AAAATCTATGTGACTGGTGTGGG - Intergenic
955053805 3:55438378-55438400 AAAAGTCATTAGCCAGGTGTGGG - Intergenic
955276080 3:57548548-57548570 AATATTTCTTAGCCAGGCGTTGG + Intergenic
955680236 3:61492403-61492425 AAAGTTTTTGAGGCAGCTGTGGG - Intergenic
955915046 3:63899350-63899372 AACATTAATGTGCCAGGCGTTGG - Intronic
958774312 3:98462934-98462956 AAATTTTAAGAGCCATGTTTTGG - Intergenic
961582964 3:127898369-127898391 AAAATTTTTGAAACAGGAGTGGG + Intergenic
962790661 3:138808524-138808546 AAAAATACAGAGCCAGGTGTGGG + Intronic
963186761 3:142427176-142427198 AAAAATTATTAGCCAGGTACAGG + Intronic
964548788 3:157863992-157864014 CAAAATAATGAGGCAGGTGTGGG + Intergenic
966155371 3:176910519-176910541 ACAGGTGATGAGCCAGGTGTTGG - Intergenic
966705272 3:182906737-182906759 AAAATTTATGAGCCAGGTGTGGG - Intronic
967162412 3:186750655-186750677 AAAATTAACTAGCCAGGTGCTGG + Intergenic
967535610 3:190599130-190599152 AAAATTTATGCACCAGGGCTTGG - Intronic
968399476 4:279881-279903 AAAATTTATAAACCAGGTAGGGG + Intronic
968409561 4:377874-377896 AAAATTTTTAGGCCAGGTGGCGG + Intronic
968790744 4:2659492-2659514 AAAAATAATGAGCCATGTCTCGG + Intronic
968843351 4:3024569-3024591 AAAAATTGTAGGCCAGGTGTGGG + Intronic
969367938 4:6710345-6710367 CAAAAGTATGAGCCAGGGGTGGG - Intergenic
970083742 4:12321321-12321343 AGAATTTGTGAGCCTGGTTTTGG - Intergenic
970700066 4:18725819-18725841 AAAATTCAAGATCAAGGTGTAGG - Intergenic
972490230 4:39580333-39580355 AAAATTTAAAAACCGGGTGTTGG - Intronic
974027573 4:56747110-56747132 AAAGTTTGTGATCCAGGTTTTGG - Intergenic
976324904 4:83760164-83760186 AAAATTTAAGTGCCAAATGTTGG - Intergenic
977844395 4:101751464-101751486 AAAATTTCTGGGCCAGGTTCAGG - Intronic
978506958 4:109468537-109468559 AAAGTTTATAAGCAAGGTGTTGG + Intronic
978647874 4:110962112-110962134 TAAATTTATGTGCCAGTTGATGG + Intergenic
978828054 4:113048416-113048438 AAAAAAAATTAGCCAGGTGTGGG - Intronic
978848802 4:113308413-113308435 AAAATTCATGAGAGAGGTCTGGG + Intronic
978995276 4:115143718-115143740 AAAATTTGTGAGCTTGGTGGTGG - Intergenic
979749329 4:124257935-124257957 AAAATTTTAGAGCCATGGGTAGG - Intergenic
980615689 4:135221245-135221267 AAAATTTATATGTCATGTGTAGG + Intergenic
981396617 4:144257135-144257157 AAAGTTTATAATCAAGGTGTCGG - Intergenic
981870209 4:149476757-149476779 AAACTTTAGGAGTCAGGTATAGG + Intergenic
984139631 4:175987286-175987308 TAGAATTAAGAGCCAGGTGTTGG - Intronic
987813433 5:22869524-22869546 AAAATTTATTTGCGAGGTGAGGG + Intergenic
988560833 5:32279666-32279688 AAACTTTTGGAGCTAGGTGTTGG + Intronic
988904668 5:35774083-35774105 GCAATTGATGAGCCAGTTGTGGG - Intronic
988921792 5:35949143-35949165 AAACTGTATCAGCCAGGAGTTGG + Intergenic
988998404 5:36736647-36736669 ATAATTTATGAGGCGGCTGTGGG + Intergenic
989322020 5:40145789-40145811 AATATTTATGAGACAATTGTAGG - Intergenic
989580783 5:43031184-43031206 AAAAAAAATGAGCCAGGTATGGG + Intergenic
990015326 5:51054491-51054513 AAACTGTATCAGCCAGCTGTTGG - Intergenic
990893436 5:60672220-60672242 AAATTGAATGAGCCAGTTGTTGG - Intronic
991096185 5:62742054-62742076 AAAATATTTGAGACGGGTGTTGG + Intergenic
991300983 5:65128881-65128903 GAAATATTTGTGCCAGGTGTTGG + Intergenic
991406455 5:66305265-66305287 AAAATATATGAGACAGTTGTTGG + Intergenic
992901177 5:81298446-81298468 AAAATTAATGACCCTGCTGTTGG - Intergenic
994492143 5:100461046-100461068 AAAATTAATGATCCAGGAGCTGG - Intergenic
995524848 5:113042318-113042340 AAAAAAAATTAGCCAGGTGTGGG + Intronic
995610489 5:113904787-113904809 AAAATTTAAAAGCCAGATGCAGG - Intergenic
998681241 5:144470013-144470035 ACAATTGATTAGCCAGATGTGGG - Intronic
999336543 5:150723299-150723321 CAACTTTATGAGCTAGGTATAGG + Intronic
1000431580 5:161158916-161158938 AAAATTAAGGAACCAGGTGAAGG - Intergenic
1002585399 5:180243744-180243766 AATATGTATGAACCAGGAGTAGG - Intronic
1002769920 6:282031-282053 GAAATTCAAGAGGCAGGTGTAGG + Intergenic
1003635668 6:7829333-7829355 AAAATTTATTGGCCAGGTAAGGG + Intronic
1006821449 6:36899552-36899574 AAAATTTATCAGACAGCTGCTGG + Exonic
1010110456 6:72223120-72223142 TAAAGTTATGAGCGAGGTGCTGG + Intronic
1014914843 6:127134195-127134217 AAAATTTATGAGCAATGAATAGG + Intronic
1015841883 6:137486185-137486207 AAAATATAGGAGGCAGGTTTGGG - Intergenic
1016675887 6:146767621-146767643 AAAAAATATTAGCCGGGTGTGGG - Intronic
1017125906 6:151064716-151064738 AAAAGTTATGAGCTATGAGTTGG - Intronic
1019832482 7:3346643-3346665 AAACTAAATTAGCCAGGTGTGGG - Intronic
1020066674 7:5193727-5193749 AAAAAAAATTAGCCAGGTGTGGG - Intronic
1020982420 7:15088014-15088036 AGAATCTATCAGCCAGCTGTAGG - Intergenic
1022272412 7:28822297-28822319 AATATTGATAAGCCAAGTGTTGG - Exonic
1022865462 7:34414109-34414131 AAAAAAAATTAGCCAGGTGTGGG + Intergenic
1023019719 7:36000333-36000355 AAATTTAATGGGCCATGTGTTGG - Intergenic
1023616209 7:42022833-42022855 AAAATTTCTGAACCTGGTTTGGG + Intronic
1026438930 7:70425786-70425808 AGCATACATGAGCCAGGTGTTGG - Intronic
1026470010 7:70687073-70687095 GAAATAGAGGAGCCAGGTGTTGG + Intronic
1026483227 7:70796629-70796651 TAAAAGAATGAGCCAGGTGTGGG - Intergenic
1028689613 7:93636876-93636898 AATATTTAGTAGCCAGGTGGAGG + Intronic
1029089929 7:98040224-98040246 AACCTTTATCAGCCAGGTGTGGG + Intergenic
1029177649 7:98676173-98676195 TAAATAAATTAGCCAGGTGTGGG - Intergenic
1030821955 7:114104241-114104263 AATATTTATGAGTCAGGGCTTGG + Intronic
1030898533 7:115092543-115092565 TAAATTTATCTGTCAGGTGTTGG - Intergenic
1032011162 7:128349117-128349139 AGAATTTCTGAGCCAGGTGATGG + Intergenic
1032461534 7:132114943-132114965 ATAATTTGTGAGCAAGTTGTGGG - Intergenic
1036160094 8:6379711-6379733 AAACTTTATGAGTGAGGTGGAGG - Intergenic
1039557640 8:38488054-38488076 AAAATTTATGAGCCAGTGCCTGG - Intergenic
1039967827 8:42296495-42296517 AAACTAAATTAGCCAGGTGTGGG + Intronic
1040584883 8:48729667-48729689 AAAATTTGTGGGCCAGATATGGG - Intronic
1041307095 8:56472776-56472798 ATACTATATGAGCCATGTGTGGG - Intergenic
1041688930 8:60670506-60670528 AAAATACAGGAGCCAGGGGTAGG - Intergenic
1042339527 8:67664523-67664545 GTTATTCATGAGCCAGGTGTGGG - Intronic
1042911508 8:73832144-73832166 TATATATATTAGCCAGGTGTAGG + Intronic
1045085880 8:98684764-98684786 ATAATTACTGAACCAGGTGTTGG - Intronic
1046506895 8:115147870-115147892 AAAATTCAAGGGCCAGGTGCAGG + Intergenic
1048082614 8:131145613-131145635 ACAATTTATGATCTAGGTTTGGG + Intergenic
1049976279 9:863161-863183 AAAAAAAATTAGCCAGGTGTGGG + Intronic
1050009757 9:1173363-1173385 ATGATTTCTGAGCCACGTGTGGG - Intergenic
1050368068 9:4890891-4890913 AAAAAAAATTAGCCAGGTGTGGG + Intergenic
1050781111 9:9337298-9337320 AAAATCTGAGAGGCAGGTGTTGG + Intronic
1051573367 9:18584859-18584881 GAAATTCATGATCCAGGTGCCGG - Intronic
1055531727 9:77191448-77191470 AAAAAAAATTAGCCAGGTGTAGG - Intronic
1055920658 9:81457224-81457246 AATATTTTTGACCCAGGTTTTGG + Intergenic
1057362912 9:94391596-94391618 AAAATATTTTGGCCAGGTGTGGG + Intronic
1057660426 9:96996503-96996525 AAAATATTTTGGCCAGGTGTCGG - Intronic
1058175544 9:101732355-101732377 AAAACTTATGAGCAATGTGAAGG + Intronic
1058582327 9:106471947-106471969 CATATTTATGTGCCATGTGTTGG + Intergenic
1059370073 9:113823339-113823361 AAAATTTCTAAGCAAAGTGTTGG + Intergenic
1059710904 9:116866737-116866759 ACAATATAGTAGCCAGGTGTGGG + Intronic
1060233951 9:121848050-121848072 AAAATAAATTAGCCAGGTGTGGG + Intronic
1062431062 9:136527066-136527088 GAAAGTTTTGAGCCAGGTGTGGG + Intronic
1185882325 X:3752336-3752358 ATAATTTACAAGCCAGGTGCTGG - Intergenic
1186271975 X:7898677-7898699 TTAATTTATCACCCAGGTGTTGG - Exonic
1186652926 X:11580345-11580367 TAAATCTATGAGACACGTGTTGG + Intronic
1187130759 X:16500526-16500548 AAAATTAATGAACCAGGAGCTGG + Intergenic
1187717370 X:22116114-22116136 AAAATTTAAGAGGTAAGTGTTGG - Intronic
1188037857 X:25338504-25338526 AAAATTTATGAACGGGGTGGCGG - Intergenic
1188119525 X:26287121-26287143 AAACTTGCTGAGCCAGGTGCGGG + Intergenic
1188514593 X:30971734-30971756 AAAATTTCTTATCCAGGTTTTGG + Intronic
1189260525 X:39675443-39675465 GAAATTTATGTGCGATGTGTGGG - Intergenic
1190139286 X:47828205-47828227 AAAATTTATGAAACTGGTCTGGG + Intergenic
1191062473 X:56314291-56314313 AACATTTATCAGCCATGTGCAGG + Intergenic
1191911160 X:66151686-66151708 AAAAAAAATTAGCCAGGTGTGGG - Intergenic
1194113838 X:89872248-89872270 AAAATATGTGAGACAGGTCTCGG + Intergenic
1194426156 X:93740916-93740938 AAAGGTTATGAGCCAAGTGTAGG + Intergenic
1194627413 X:96241984-96242006 AGACTTCATGAGCCAGGAGTAGG - Intergenic
1196661424 X:118274378-118274400 AAAAAAAATTAGCCAGGTGTGGG + Intergenic
1198104743 X:133451393-133451415 CAAAAAAATGAGCCAGGTGTAGG - Intergenic
1199199424 X:145069873-145069895 AAAATATATGAGCCAGTTGCAGG - Intergenic
1200315386 X:155127191-155127213 ACAATTTAGGAGCAAGGTGTAGG + Intronic
1200466575 Y:3527603-3527625 AAAATATGTGAGACAGGTCTCGG + Intergenic
1200475102 Y:3633084-3633106 AGAATAGATGACCCAGGTGTGGG - Intergenic
1200921293 Y:8615678-8615700 CACATTTATGAGACAGGTTTGGG - Intergenic