ID: 966705273

View in Genome Browser
Species Human (GRCh38)
Location 3:182906738-182906760
Sequence GAAAATTTATGAGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1423
Summary {0: 1, 1: 0, 2: 5, 3: 149, 4: 1268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966705273_966705276 29 Left 966705273 3:182906738-182906760 CCACACCTGGCTCATAAATTTTC 0: 1
1: 0
2: 5
3: 149
4: 1268
Right 966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924
966705273_966705277 30 Left 966705273 3:182906738-182906760 CCACACCTGGCTCATAAATTTTC 0: 1
1: 0
2: 5
3: 149
4: 1268
Right 966705277 3:182906791-182906813 AGAAGAAGAAGAAGAAGGCCGGG 0: 4
1: 24
2: 113
3: 928
4: 3747
966705273_966705275 25 Left 966705273 3:182906738-182906760 CCACACCTGGCTCATAAATTTTC 0: 1
1: 0
2: 5
3: 149
4: 1268
Right 966705275 3:182906786-182906808 AAAAAAGAAGAAGAAGAAGAAGG 0: 104
1: 407
2: 1338
3: 3905
4: 16682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966705273 Original CRISPR GAAAATTTATGAGCCAGGTG TGG (reversed) Intronic
901308284 1:8249462-8249484 AAAAAAATATCAGCCAGGTGTGG + Intergenic
901340661 1:8496005-8496027 AAAAATATATTAGCCAGGTATGG + Intronic
901401155 1:9015877-9015899 AAAAAAAAATGAGCCAGGTGCGG - Intronic
901543580 1:9938321-9938343 AAAAATAAATTAGCCAGGTGTGG - Intronic
901592552 1:10357575-10357597 AAAAATTAATTAGCCGGGTGTGG + Intronic
901608979 1:10481975-10481997 CAAAAATAATTAGCCAGGTGTGG - Intronic
901614455 1:10527227-10527249 GAAAATTTGTGGGCCAGGCATGG + Intronic
902005673 1:13230071-13230093 TAAACTTTATAAGCCAGGTGCGG + Intergenic
902024994 1:13376357-13376379 TAAACTTTATAAGCCAGGCGCGG + Intergenic
902198678 1:14817631-14817653 GAAAATTTAGAAGTCACGTGAGG + Intronic
902317638 1:15635071-15635093 TAAAATAAATTAGCCAGGTGTGG + Intronic
902629823 1:17698047-17698069 GAAAATTAATTAGCCACCTGTGG - Intergenic
903039575 1:20518697-20518719 AAAAATTCTTGGGCCAGGTGTGG + Intergenic
903111386 1:21137297-21137319 TAAAATTAATTAGCCAAGTGTGG - Intronic
903197322 1:21700781-21700803 GACAATTTATGGGCCGGATGCGG + Intronic
903491667 1:23733464-23733486 AAAGATTTATTGGCCAGGTGTGG + Intergenic
903802334 1:25978619-25978641 GACAATTTATGGACCAGGTCTGG - Intronic
904219840 1:28958196-28958218 AAAAATTAATGAGCCAGGCATGG + Intronic
904549848 1:31306821-31306843 GAAAAAAAATCAGCCAGGTGTGG - Intronic
904796789 1:33062315-33062337 CAAAAATTATTAGCCAGGCGTGG + Intronic
904820070 1:33236384-33236406 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
904885442 1:33734494-33734516 GAAAATACAGGGGCCAGGTGTGG + Intronic
905056238 1:35096464-35096486 GAAAATTTAAAAACCAGGTGTGG + Intronic
905058318 1:35118083-35118105 CAAAAAAAATGAGCCAGGTGTGG + Intergenic
905088890 1:35410642-35410664 AAAAAAAAATGAGCCAGGTGTGG - Intronic
905098312 1:35495080-35495102 GAAACTTTTATAGCCAGGTGCGG + Intronic
905101602 1:35528241-35528263 CAAAAATAATTAGCCAGGTGTGG - Intronic
905247143 1:36623012-36623034 GACAATTCATGAGGCAAGTGGGG + Intergenic
905671350 1:39792386-39792408 AAAAATATATTAGCCAGGCGTGG - Intergenic
905845904 1:41231730-41231752 GAAATTTTATAGGCCAGGTGTGG + Intronic
906093198 1:43200329-43200351 TAAAAAATATTAGCCAGGTGTGG + Intronic
906549258 1:46648685-46648707 TTACATTTATGGGCCAGGTGCGG + Intronic
906656616 1:47552908-47552930 CAAAAAATATTAGCCAGGTGTGG - Intergenic
906882158 1:49603367-49603389 GAACAGTTATTAGCCAGGTGTGG + Intronic
907063984 1:51461220-51461242 GAAAGTTTATGAGCTAGGAATGG + Intronic
907131885 1:52104479-52104501 GAAAGAAAATGAGCCAGGTGTGG - Intergenic
907717434 1:56940412-56940434 AAAATTTAATTAGCCAGGTGTGG + Intronic
907944276 1:59119670-59119692 AAAAAATAATTAGCCAGGTGTGG - Intergenic
908107456 1:60859890-60859912 AAAAATCAATTAGCCAGGTGTGG + Intergenic
908192823 1:61720928-61720950 GAAAATTGAACAGCCAGGTGTGG + Intronic
908701125 1:66901935-66901957 AAAAATAAATTAGCCAGGTGTGG - Intronic
908752325 1:67436046-67436068 TTAATTTTATGGGCCAGGTGCGG + Intergenic
908767666 1:67569063-67569085 CAAAAGTTATCAGCCAGGTGGGG - Intergenic
908891547 1:68854446-68854468 CAAAAATTCTGGGCCAGGTGTGG - Intergenic
909018209 1:70402576-70402598 GAATATGTATGTGCCAGGTAAGG + Intergenic
909044555 1:70693136-70693158 GAAAAAATATTAGACAGGTGTGG + Intergenic
909162341 1:72168742-72168764 AAAAATTAATTCGCCAGGTGTGG + Intronic
909264608 1:73540329-73540351 CAAAAATTATTAGCCAGGCGTGG + Intergenic
909623429 1:77689927-77689949 AAAAATAAATTAGCCAGGTGTGG + Intergenic
909668770 1:78165082-78165104 AAAAAATAATTAGCCAGGTGTGG + Intergenic
909930022 1:81487110-81487132 GAAAGTAAATCAGCCAGGTGTGG + Intronic
910021247 1:82592248-82592270 GAAAATAAATTAACCAGGTGTGG - Intergenic
910069628 1:83196193-83196215 GGAAATTTATGACACAGGTCTGG - Intergenic
910183849 1:84513995-84514017 CAAAAAAAATGAGCCAGGTGTGG - Intergenic
910312576 1:85841600-85841622 TAATATAAATGAGCCAGGTGCGG + Intronic
910631770 1:89362840-89362862 GTAAAATTCTGGGCCAGGTGCGG - Intergenic
910930365 1:92437200-92437222 AGTAATTTTTGAGCCAGGTGCGG - Intergenic
910990869 1:93054507-93054529 AAAAATAAATTAGCCAGGTGTGG - Intergenic
910994491 1:93089966-93089988 GAAAAAAAATTAGCCAGGTGTGG - Intronic
910995759 1:93102839-93102861 GAAATTTTATGGGCCAGGCACGG + Intronic
911134498 1:94424576-94424598 CAAAAAATATTAGCCAGGTGTGG - Intronic
911403971 1:97412971-97412993 AAGAATTTATGAGACATGTGGGG - Intronic
911623432 1:100093333-100093355 GAAAATATTTTGGCCAGGTGTGG - Intronic
911639190 1:100268683-100268705 GAATATTTATTGGACAGGTGTGG - Intronic
911926819 1:103843193-103843215 GAAAAGTTAAGGGCCAAGTGAGG - Intergenic
913365709 1:118036030-118036052 CAAAAATAATTAGCCAGGTGTGG + Intronic
913400183 1:118423203-118423225 GAAAATTTATCGGCCGGGCGCGG - Intergenic
914723618 1:150309285-150309307 AAAAATTTACCAGCCAGGTATGG - Intergenic
914763834 1:150620920-150620942 AAAAAATAATTAGCCAGGTGTGG + Intronic
915370047 1:155341464-155341486 TAAAATTTGTGAGCCAGGCGCGG - Intronic
915379362 1:155426489-155426511 AAAAATTAATGGGCCAGGCGCGG - Intronic
915397249 1:155594739-155594761 AAAAACTTGGGAGCCAGGTGTGG - Intergenic
915600108 1:156917224-156917246 GAAAATTTAGAAGCCAGCAGAGG + Intergenic
915606255 1:156953281-156953303 AAAAATAAATTAGCCAGGTGTGG + Intronic
916133114 1:161629135-161629157 TAAAAATTATTGGCCAGGTGTGG + Intronic
916220280 1:162437298-162437320 CAAAATATATTAGCCGGGTGTGG + Intergenic
917092649 1:171369265-171369287 AAAAAAAAATGAGCCAGGTGTGG + Intergenic
917283695 1:173403140-173403162 GCAAATTCTTGGGCCAGGTGTGG - Intergenic
917551090 1:176030105-176030127 AAAAATATATTAGCCAGGCGTGG - Intronic
917684137 1:177398733-177398755 AAAAATGGATGAGGCAGGTGAGG - Intergenic
917994624 1:180422496-180422518 GAAAAGGGATGGGCCAGGTGTGG - Intronic
918061916 1:181069160-181069182 AAAAATTTACTAGCCAGGTGCGG - Intergenic
918494920 1:185124532-185124554 TAAAAAATATTAGCCAGGTGTGG + Intronic
918814595 1:189166738-189166760 AAAAATAAATTAGCCAGGTGTGG + Intergenic
919006041 1:191900749-191900771 GAAAAGTTTGGGGCCAGGTGTGG - Intergenic
919532425 1:198740424-198740446 AAAAAAATATTAGCCAGGTGTGG + Intronic
919624520 1:199898284-199898306 TAAAATAAATTAGCCAGGTGTGG - Intergenic
919714929 1:200766297-200766319 AAAAAAATATTAGCCAGGTGGGG - Intronic
919720484 1:200828865-200828887 AAAAACTTATGGGCCAGGTGCGG + Intronic
919757159 1:201073425-201073447 GGAGAGTTATCAGCCAGGTGAGG - Intronic
919873271 1:201840359-201840381 TAAAATTTTTTGGCCAGGTGTGG - Intronic
920174547 1:204092299-204092321 AAAAAGTTCTGGGCCAGGTGTGG - Intronic
920322652 1:205136395-205136417 AAAAATTTGCCAGCCAGGTGTGG - Intergenic
920686275 1:208111204-208111226 TTAAATTAATTAGCCAGGTGTGG - Intronic
921400457 1:214716910-214716932 GAAAATTTTTCAGCCAACTGTGG - Intergenic
922058890 1:222068683-222068705 GAAAATACAAGGGCCAGGTGCGG + Intergenic
922235929 1:223722578-223722600 TAAAAATTATTTGCCAGGTGTGG - Intronic
922338360 1:224635865-224635887 AAAAAAAAATGAGCCAGGTGTGG - Intronic
922606528 1:226893086-226893108 AAATATAAATGAGCCAGGTGTGG - Intronic
923130416 1:231070040-231070062 GAAAGTCTGTCAGCCAGGTGCGG + Intergenic
923164249 1:231344349-231344371 GAAAAAAAATTAGCCAGGTGTGG + Intronic
923240742 1:232083087-232083109 TAAAATTTATCAGCCAGGCATGG + Intergenic
923455943 1:234165674-234165696 AAAAAAGAATGAGCCAGGTGTGG - Intronic
923565157 1:235070899-235070921 ATAAAATTATTAGCCAGGTGTGG - Intergenic
923623755 1:235597779-235597801 GAAAAAAAATTAGCCAGGTGTGG - Intronic
923796856 1:237165110-237165132 AAAAATTAATTAGCCAGGTATGG - Intronic
923804807 1:237246068-237246090 GAAAACAGATCAGCCAGGTGTGG - Intronic
923862386 1:237904663-237904685 CAAAAATTAGGAGCCGGGTGCGG + Intergenic
924088545 1:240479240-240479262 AAAATTTTAATAGCCAGGTGTGG + Intergenic
924228235 1:241940877-241940899 AAAAATTATTGGGCCAGGTGTGG - Intergenic
924229702 1:241953215-241953237 AAAATTTAATTAGCCAGGTGTGG + Intergenic
924253644 1:242160165-242160187 AAAAATTAATTAGCCAGATGTGG - Intronic
924430710 1:243994246-243994268 AAAAAGAAATGAGCCAGGTGTGG + Intergenic
924754070 1:246925907-246925929 GAAAAATAATTAGCCAGGTGTGG + Intronic
924803706 1:247346431-247346453 AAACATAAATGAGCCAGGTGTGG + Intergenic
924822399 1:247505809-247505831 AAATATATATTAGCCAGGTGTGG - Intergenic
924862020 1:247935483-247935505 TAAAATGTATGGGCCAGGCGCGG + Intergenic
924952646 1:248898442-248898464 TAAAAATGTTGAGCCAGGTGCGG - Intergenic
1062790323 10:300258-300280 GACAATGGATGAGCCAAGTGTGG + Intronic
1063096039 10:2909933-2909955 GATAATTTTTGGGCCAGGTGTGG - Intergenic
1063191726 10:3701338-3701360 TAAAATAAATCAGCCAGGTGTGG - Intergenic
1063191781 10:3701919-3701941 TAAAATAAATTAGCCAGGTGTGG + Intergenic
1063353533 10:5377217-5377239 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1063683545 10:8213546-8213568 TAAAAATAATCAGCCAGGTGTGG - Intergenic
1063915491 10:10877982-10878004 GAAAATTCATAAACCAAGTGGGG + Intergenic
1064148367 10:12842982-12843004 CAAAAATAATTAGCCAGGTGTGG - Intergenic
1064249052 10:13693017-13693039 AAAAATTAATTAGCCAGGTGTGG - Intronic
1064316539 10:14263045-14263067 GAAAATTTCTGAGCAAGGATGGG - Intronic
1064321718 10:14311192-14311214 GGAAATTCAGGAGACAGGTGGGG - Intronic
1064355407 10:14613260-14613282 GAAAGTTTATGGGCTCGGTGAGG - Intronic
1064533480 10:16333689-16333711 AAAAATATATTAGCCAAGTGTGG + Intergenic
1064533881 10:16338453-16338475 GAAAATGTTTAGGCCAGGTGTGG + Intergenic
1064559972 10:16586245-16586267 AAAAATTTTTTAGCCAGATGTGG - Intergenic
1064620523 10:17212162-17212184 AAAATTTCATTAGCCAGGTGTGG + Intergenic
1064658652 10:17582917-17582939 AAATATTTTTGGGCCAGGTGTGG - Intergenic
1064661016 10:17608163-17608185 GAACAATAATGAGCCAGGTATGG - Intronic
1064725648 10:18276959-18276981 AAAAAATTATTAGCCTGGTGTGG + Intronic
1064970426 10:21060554-21060576 TAAAATATATGAGCCAGTAGAGG - Intronic
1064991231 10:21258721-21258743 TAAAAATAATTAGCCAGGTGTGG + Intergenic
1065031718 10:21593248-21593270 AAAAAATAATGAGTCAGGTGCGG - Intronic
1065095598 10:22277873-22277895 GTATACATATGAGCCAGGTGTGG - Intergenic
1065106635 10:22394860-22394882 AAAAATTAATTAGCCAGATGTGG - Intronic
1065126828 10:22581958-22581980 TAAAAGAAATGAGCCAGGTGTGG + Intronic
1065197082 10:23276981-23277003 GAAAAACTCTTAGCCAGGTGTGG - Intronic
1065210459 10:23397592-23397614 GAAATTTTATTAGCCTGGTGTGG + Intergenic
1065434579 10:25693822-25693844 GAAAAACTATTGGCCAGGTGTGG - Intergenic
1065566557 10:27016895-27016917 AAATATTTATCAGCCAGGTTTGG + Intronic
1065693227 10:28356476-28356498 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1066321403 10:34307178-34307200 TAAAACTTTTGAGCCGGGTGCGG - Intronic
1066333366 10:34449205-34449227 GATAATTTATCTGCCGGGTGCGG - Intronic
1066538508 10:36418251-36418273 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1066554271 10:36593889-36593911 GAAAGCTTAAAAGCCAGGTGCGG - Intergenic
1066573432 10:36799200-36799222 AAAAATTTTTAGGCCAGGTGTGG + Intergenic
1066589929 10:36983829-36983851 AAATATTTGTGGGCCAGGTGCGG + Intergenic
1066787400 10:39020382-39020404 GAAAATTTGTGAGCCAATTGAGG - Intergenic
1066790934 10:39062583-39062605 GAATATTTAGGAGCCACTTGAGG - Intergenic
1067410903 10:46063783-46063805 GAAACTTTCTCGGCCAGGTGCGG + Intergenic
1068213064 10:53947063-53947085 GGATATATATGGGCCAGGTGCGG - Intronic
1068468004 10:57420425-57420447 AAAAATGCATTAGCCAGGTGTGG - Intergenic
1068723248 10:60271358-60271380 AAAAATAAATTAGCCAGGTGTGG - Intronic
1069015368 10:63423253-63423275 AAAAAGTTTTGGGCCAGGTGCGG - Intronic
1069131658 10:64711785-64711807 ACAAATTTCTCAGCCAGGTGTGG + Intergenic
1069227961 10:65968234-65968256 AAAAATAAATTAGCCAGGTGTGG + Intronic
1069385635 10:67881261-67881283 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1069487287 10:68832053-68832075 CAAAACATTTGAGCCAGGTGCGG - Intronic
1069676241 10:70250199-70250221 GAAAATTTCCAGGCCAGGTGTGG - Exonic
1069726229 10:70581852-70581874 CAAGATTTTTGAGCCAGGAGTGG + Intergenic
1070066034 10:73035366-73035388 ATAAATTAATGAGCAAGGTGTGG + Intronic
1070071033 10:73089990-73090012 AAAAATTAAAAAGCCAGGTGTGG - Intronic
1070074602 10:73122870-73122892 CAAAATGTATAGGCCAGGTGTGG - Intronic
1070086632 10:73244339-73244361 GAAAAGAAATGAGCCTGGTGTGG + Exonic
1070102562 10:73401879-73401901 AAAAATAGATCAGCCAGGTGTGG - Intronic
1070108332 10:73458425-73458447 AAAAATTTTTTTGCCAGGTGCGG - Intronic
1070262672 10:74872666-74872688 AAAAATTAATTAGCCAGGAGTGG - Intronic
1072595209 10:96865582-96865604 GAACACTTCTGAGCCAGGCGCGG + Intronic
1072927438 10:99628663-99628685 AAAAATTAATTAGCCGGGTGTGG + Intergenic
1072966554 10:99978732-99978754 GTAAATAAATTAGCCAGGTGTGG - Intronic
1073200833 10:101733898-101733920 CAAAAATTATTAGCCAGGCGTGG - Intergenic
1073377374 10:103048075-103048097 CAAAATAAATTAGCCAGGTGTGG - Intronic
1073485485 10:103815598-103815620 GAAAAATACTGGGCCAGGTGCGG + Intronic
1073663033 10:105498788-105498810 AAAAATTTACAGGCCAGGTGCGG + Intergenic
1073701507 10:105932622-105932644 GAAAAAATATTAGCCAGGTGTGG + Intergenic
1073858382 10:107705731-107705753 AAAAAAATATTAGCCAGGTGTGG - Intergenic
1074271689 10:111959961-111959983 GAAAATGTTTGAGCCAGGCCTGG + Intergenic
1074356944 10:112794394-112794416 AAAAATAAATTAGCCAGGTGTGG + Intronic
1074504291 10:114054256-114054278 GACAAAATATGAGGCAGGTGTGG + Intergenic
1074553374 10:114466047-114466069 AAAATTTTAAGAGCCAGGTGTGG + Intronic
1075489420 10:122853749-122853771 GAAAATAAATTAGCCAGGTGTGG + Intronic
1076410778 10:130248142-130248164 GAGAAGTTATAGGCCAGGTGTGG + Intergenic
1076808426 10:132872407-132872429 AAAAATATATTAGCCAGGTATGG - Intronic
1077293009 11:1808357-1808379 TAAAATTTATTGGCCGGGTGCGG + Intergenic
1077314594 11:1912758-1912780 GAAAATAAATTAGCCAGGCGTGG - Intergenic
1077446620 11:2594563-2594585 GAAAATCTATGAGACAGCTGAGG - Intronic
1077611027 11:3643062-3643084 GAAAATTAATGAGCCAGACCAGG - Intergenic
1077620892 11:3722266-3722288 TAAAAGTAATTAGCCAGGTGTGG - Intronic
1078116109 11:8452630-8452652 AAAAATTAATTAGCCAGGTGTGG + Intronic
1078173783 11:8952699-8952721 AAAAATCTGTGGGCCAGGTGTGG - Intronic
1078213947 11:9295822-9295844 AATAATTTATAGGCCAGGTGCGG - Intronic
1079367638 11:19823198-19823220 TAAAATAAATTAGCCAGGTGTGG - Intronic
1079439207 11:20492989-20493011 AAAAATATAAAAGCCAGGTGTGG + Intronic
1079446650 11:20563193-20563215 AAAAATGAATGGGCCAGGTGTGG + Intergenic
1080470051 11:32536722-32536744 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1080525028 11:33107159-33107181 GAAAAAAAATCAGCCAGGTGTGG + Intronic
1080763924 11:35278429-35278451 CAAAAATAATTAGCCAGGTGTGG - Intronic
1080850462 11:36064462-36064484 AAAAATTAATTAGCCAGGTGTGG - Intronic
1081729620 11:45361092-45361114 GAAAATTTGAAAGCAAGGTGAGG + Intergenic
1082075373 11:47972164-47972186 CAAAAATCATGGGCCAGGTGCGG + Intergenic
1082077544 11:47985989-47986011 AAAAATGTCTGGGCCAGGTGCGG - Intronic
1082562052 11:54629602-54629624 AAAATTTAATTAGCCAGGTGTGG - Intergenic
1082792576 11:57357023-57357045 GAACATTTTAGAGCCAGGTGTGG + Intronic
1083074854 11:60026104-60026126 GAAAATTAATAAGCAATGTGGGG - Intergenic
1083194631 11:61078131-61078153 GAAACCTTATGAGGCAGGTGTGG - Intergenic
1083678141 11:64339246-64339268 GCAAAATAATTAGCCAGGTGTGG + Intergenic
1083740366 11:64707229-64707251 AAAAATACATTAGCCAGGTGTGG + Intronic
1084391744 11:68881815-68881837 AAAAATTAACTAGCCAGGTGTGG - Intergenic
1084501009 11:69535334-69535356 GAAAATGTTTGGGCCGGGTGCGG + Intergenic
1084636384 11:70395730-70395752 GAAAATATAGCAGCCAGGCGCGG - Intergenic
1084731943 11:71079468-71079490 GAAAGTTAATAGGCCAGGTGTGG + Intronic
1084928899 11:72538036-72538058 AAAAAATAATTAGCCAGGTGCGG - Intergenic
1085005694 11:73087414-73087436 AAAAGTTTTTGGGCCAGGTGTGG + Intronic
1085382915 11:76136786-76136808 GAAACCCTATGGGCCAGGTGTGG - Intronic
1085441108 11:76563319-76563341 GAACATTTGTGATCCATGTGAGG - Intergenic
1085502776 11:77038414-77038436 AAAATTTAATGACCCAGGTGTGG + Intronic
1085575440 11:77598868-77598890 AAAAAATAATTAGCCAGGTGTGG - Intronic
1085952411 11:81348119-81348141 TAAAATAACTGAGCCAGGTGTGG + Intergenic
1086381869 11:86262965-86262987 GAAAATAAATTAGCCAGGTGTGG - Intronic
1087013393 11:93533894-93533916 AAACAGTTATTAGCCAGGTGTGG + Intronic
1087064654 11:94016358-94016380 GAAAATTTATTGGCCTAGTGTGG - Intergenic
1087162369 11:94961242-94961264 TAACATTTATTGGCCAGGTGTGG - Intergenic
1087259255 11:95992600-95992622 GAGAATTTATCACCCAAGTGAGG + Intronic
1087443907 11:98221851-98221873 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1087748262 11:101974947-101974969 GAAAATTGATGAGCAAACTGAGG + Intronic
1087818979 11:102689826-102689848 AAAAAATAATTAGCCAGGTGTGG - Intergenic
1087840543 11:102916701-102916723 GAACATGTATTAGCCAGGTGTGG + Intergenic
1088055340 11:105569507-105569529 AAACAATTATGAGCTAGGTGCGG + Intergenic
1088283862 11:108165618-108165640 AAAAAAATATTAGCCAGGTGTGG - Intronic
1088506545 11:110532954-110532976 TAAAAAAAATGAGCCAGGTGTGG + Intergenic
1088854579 11:113736117-113736139 TAAAATAAATTAGCCAGGTGTGG + Intronic
1089234548 11:117012127-117012149 TAAAAATAATTAGCCAGGTGTGG - Intronic
1089404715 11:118187920-118187942 TAAAATTGATTAGCTAGGTGTGG - Intergenic
1089510475 11:118993670-118993692 GAAAATTTGTGAGGCAGGATTGG + Intergenic
1089545401 11:119220444-119220466 AAAAAAATATTAGCCAGGTGTGG + Intronic
1089601784 11:119620394-119620416 AAAAAGTAATTAGCCAGGTGTGG - Intergenic
1089749684 11:120642173-120642195 AAAAAGTTATTAGCCAGGTGTGG + Intronic
1089793313 11:120960038-120960060 AAGAATTTATCGGCCAGGTGTGG + Intronic
1090193757 11:124798257-124798279 AAAATTTAATGAGCCAGGTGTGG + Intronic
1090294512 11:125575069-125575091 AAAAATTTAAAAGCCAGGTGTGG + Intronic
1090968628 11:131620467-131620489 GATGATTTGTGAGCCAGATGGGG - Intronic
1091264229 11:134258003-134258025 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1091468015 12:702457-702479 TAAAATAAATTAGCCAGGTGTGG + Intergenic
1091492082 12:941606-941628 TAAAAATTTTGGGCCAGGTGTGG - Intronic
1092192205 12:6529317-6529339 GAAAATTCCTGAGCCGGGGGCGG + Intronic
1092289025 12:7147862-7147884 GAAATAATATGGGCCAGGTGCGG + Intronic
1092337989 12:7650860-7650882 GAAAATCTCAGAGCCAGGTATGG - Intronic
1092474708 12:8808672-8808694 GAAAGTATATGCGTCAGGTGTGG - Intergenic
1092693177 12:11138746-11138768 GAAAACTTTTGGGCCAGGTGTGG + Intronic
1092762937 12:11825987-11826009 CAAAATAAATTAGCCAGGTGTGG - Intronic
1092890164 12:12962390-12962412 GAAAATTTTGAAGCCAGGCGTGG + Intergenic
1093247146 12:16753820-16753842 GTTAATTAATTAGCCAGGTGTGG + Intergenic
1093471197 12:19503985-19504007 AAAAATAAATTAGCCAGGTGTGG - Intronic
1094156788 12:27345792-27345814 AACAAATTATCAGCCAGGTGTGG - Intronic
1094424027 12:30300433-30300455 AAAAATTTATTAGCCAGGTGTGG + Intergenic
1094458590 12:30667973-30667995 AAAAAATAATTAGCCAGGTGTGG + Intronic
1094593772 12:31845436-31845458 AAAAATTTGTGGGCCAGGCGTGG - Intergenic
1094648497 12:32351193-32351215 GAAAATTTTGTGGCCAGGTGTGG + Intronic
1094824284 12:34256465-34256487 GAGGTTTTATGGGCCAGGTGCGG - Intergenic
1095142053 12:38675958-38675980 AAAAAATAATTAGCCAGGTGTGG + Intronic
1095421232 12:42026530-42026552 GAAAATGTCTGAGCCAGGAGTGG + Intergenic
1095424147 12:42056996-42057018 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1095478831 12:42612863-42612885 TAAATATTATGAGCCAGGCGAGG + Intergenic
1095645498 12:44541093-44541115 GAAAAAAAATTAGCCAGGTGTGG + Intronic
1096185291 12:49576270-49576292 ATAAAATTATCAGCCAGGTGTGG + Intronic
1096350957 12:50901213-50901235 AAAAATTAATTAGTCAGGTGTGG + Intergenic
1096410808 12:51376014-51376036 AAAAAATAATTAGCCAGGTGTGG - Intronic
1096484889 12:51973071-51973093 CAAAAATAATGAGCCACGTGTGG + Intronic
1097056137 12:56250591-56250613 GAAAAATTGTGGGCTAGGTGTGG + Intronic
1097114123 12:56684963-56684985 AAAAATTTATTAGCCAGGCATGG + Intronic
1097695732 12:62773317-62773339 AAAAATAAATTAGCCAGGTGTGG + Intronic
1097748060 12:63321075-63321097 GAATATTTATGATCCAGGTTTGG + Intergenic
1097831483 12:64229123-64229145 AACAAATAATGAGCCAGGTGTGG - Intergenic
1097844017 12:64348120-64348142 AATAAAATATGAGCCAGGTGTGG + Intronic
1097875898 12:64643013-64643035 TAAAATACATTAGCCAGGTGTGG - Intronic
1098222658 12:68286470-68286492 TAACATTTGTGGGCCAGGTGTGG + Intronic
1098259240 12:68651135-68651157 AAAAGTTTTTGAGCCATGTGTGG - Intronic
1098542210 12:71669663-71669685 GAAAATTATTCAGCCAGCTGCGG + Intronic
1098542232 12:71669802-71669824 GAAAAAAAATTAGCCAGGTGTGG + Intronic
1098717553 12:73850735-73850757 AAATATTTATGGGCCAGGAGCGG + Intergenic
1098937409 12:76496527-76496549 AAAAATGTATTAGCCAGGTCTGG - Intronic
1099026308 12:77468639-77468661 AAAAAATAATTAGCCAGGTGTGG + Intergenic
1099063681 12:77945902-77945924 TAAAAAATATTAGCCAGGTGTGG - Intronic
1099457226 12:82878745-82878767 ATAAATGAATGAGCCAGGTGCGG + Intronic
1099871900 12:88359964-88359986 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1100284298 12:93150204-93150226 TAATGTTTATGGGCCAGGTGCGG - Intergenic
1100296639 12:93268805-93268827 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1100320382 12:93485959-93485981 AAAAATAAATTAGCCAGGTGTGG - Intronic
1100333172 12:93604812-93604834 AAAAAAATATCAGCCAGGTGTGG - Intergenic
1100509181 12:95252672-95252694 AGAAATTTATGGGCCAGGCGCGG + Intronic
1100569604 12:95835137-95835159 CAAAAAATATTAGCCAGGTGTGG + Intergenic
1100630850 12:96387977-96387999 GAAAAACAATCAGCCAGGTGTGG + Intronic
1100853186 12:98734955-98734977 AAGAAATTAGGAGCCAGGTGCGG + Intronic
1100905357 12:99292364-99292386 AAAAATAAATTAGCCAGGTGTGG + Intronic
1100983018 12:100178153-100178175 TAAGATTTCTCAGCCAGGTGTGG + Intergenic
1100989765 12:100239364-100239386 AAAAAATTATTGGCCAGGTGTGG - Intronic
1101088329 12:101258871-101258893 TAAAATATTTTAGCCAGGTGTGG - Intergenic
1101368377 12:104099443-104099465 AAAAATCTTTGAACCAGGTGTGG + Intronic
1101422188 12:104558827-104558849 AAAAATTTCTAGGCCAGGTGCGG - Intronic
1101658530 12:106746065-106746087 AAAAATTTAAAGGCCAGGTGCGG + Intronic
1101694134 12:107108560-107108582 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1101776618 12:107800591-107800613 GAAAATCTAGGGGCCTGGTGCGG + Intergenic
1101913397 12:108877940-108877962 GAAAAACAATGAGCCAGGTGAGG + Intronic
1102450358 12:113037403-113037425 GAAGAGTTATGGGCCAGGTGCGG - Intergenic
1102499690 12:113343224-113343246 TAAAAAATATTAGCCAGGTGTGG + Intronic
1102590517 12:113953196-113953218 GAAGATATATTGGCCAGGTGCGG + Intronic
1102623706 12:114217450-114217472 TTAAAATTATGGGCCAGGTGTGG + Intergenic
1102939007 12:116921981-116922003 AAAAATAAATGAGCCAGGTGTGG - Intronic
1102988981 12:117301281-117301303 CAAAAAATATTAGCCAGGTGTGG - Intronic
1103063708 12:117879559-117879581 AAAAAATAATTAGCCAGGTGTGG + Intronic
1103081347 12:118026441-118026463 AAAAAATCATGAGCCAGGTGTGG + Intronic
1103301925 12:119934285-119934307 AAAAATAAATAAGCCAGGTGGGG - Intergenic
1103349119 12:120271053-120271075 TAAAAAATATTAGCCAGGTGCGG - Intergenic
1103438133 12:120942709-120942731 AAAAAAATATTAGCCAGGTGTGG + Intergenic
1103522662 12:121546851-121546873 AAAAATAAATTAGCCAGGTGTGG - Intronic
1103755859 12:123206304-123206326 AAAAAAAAATGAGCCAGGTGTGG + Intronic
1103785229 12:123427695-123427717 TAAAAATTATTAGCCAGGCGTGG - Intronic
1103856739 12:123975582-123975604 TAAAATAAATCAGCCAGGTGTGG - Intronic
1104048118 12:125177759-125177781 GAAAATTCATCAGCTGGGTGAGG + Intergenic
1104615121 12:130260934-130260956 GAAACTTTACTGGCCAGGTGTGG - Intergenic
1104620645 12:130309601-130309623 AAAAATAAATCAGCCAGGTGTGG - Intergenic
1104816760 12:131650711-131650733 CAAAAATAATTAGCCAGGTGTGG + Intergenic
1104952741 12:132449365-132449387 ATAAATTTTTCAGCCAGGTGCGG - Intergenic
1105287553 13:19018148-19018170 AAAAATTTATGATCAAGGTAAGG - Intergenic
1105378964 13:19869039-19869061 TAAGATTTATGGGCCGGGTGCGG - Intergenic
1105390318 13:19971043-19971065 GAAGCTTAATGAGCAAGGTGGGG + Intronic
1105422830 13:20268071-20268093 GAAAATTTAAGAGCAAGCTCTGG + Intergenic
1105490796 13:20886315-20886337 GAAAATGTATAAGCCAGGCTGGG + Intronic
1105536710 13:21272742-21272764 TAAAAATTATTGGCCAGGTGTGG + Intergenic
1105566035 13:21549079-21549101 AAAAAAAAATGAGCCAGGTGTGG - Intronic
1105865551 13:24455771-24455793 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1106035090 13:26036907-26036929 AAAAATTAATTAGCTAGGTGTGG + Intergenic
1106382342 13:29252485-29252507 GAAAATGTAGGAGGCAGGGGAGG + Intronic
1106904479 13:34390801-34390823 GCAAATTTCTGGGCCGGGTGCGG - Intergenic
1107064132 13:36194517-36194539 GAAACATGATGAGCCAGATGTGG + Intronic
1108348586 13:49569749-49569771 GAAAAATTATTAGCCAGGCATGG + Intronic
1108452615 13:50582493-50582515 AAAAATAAATTAGCCAGGTGTGG + Intronic
1108497876 13:51043022-51043044 AATAAATTATGGGCCAGGTGCGG - Intergenic
1109295133 13:60521603-60521625 GAAAGTGTATGGGCCGGGTGCGG + Intronic
1109368638 13:61392297-61392319 GAAAAGTTATGAGGCAGGTGTGG + Intergenic
1109504702 13:63285169-63285191 GAAAAATTATTGGCCGGGTGCGG - Intergenic
1109637958 13:65148547-65148569 AAAAATGTATTAACCAGGTGTGG + Intergenic
1109746173 13:66625814-66625836 CAAAAAAAATGAGCCAGGTGTGG - Intronic
1110070915 13:71176431-71176453 GAAAATTTAAAAGGCAGGTCAGG + Intergenic
1110563627 13:76936119-76936141 TAAAATCCATTAGCCAGGTGTGG - Intergenic
1110710095 13:78641380-78641402 AAAAATTTTTGAGGCAGTTGAGG + Intronic
1110771710 13:79356211-79356233 GAAAAAATATTAGCCGGGTGTGG + Intronic
1110789394 13:79570376-79570398 AAAAATTAATTAGCCAGGCGTGG - Intergenic
1111196739 13:84884658-84884680 GAAAGTTTATGAGACATGTAGGG + Intergenic
1111767369 13:92548672-92548694 GAAAATATATAAGCAAAGTGGGG - Intronic
1111936914 13:94567120-94567142 ACAAAATTATGGGCCAGGTGCGG - Intergenic
1112285369 13:98099262-98099284 AAACATTTATGAGACAAGTGGGG + Intergenic
1112746850 13:102536557-102536579 GAAAACATATGAGCCACCTGGGG - Intergenic
1112862389 13:103848738-103848760 AAAAAATAATTAGCCAGGTGTGG - Intergenic
1112906265 13:104426001-104426023 AAAAAATAATTAGCCAGGTGGGG + Intergenic
1113034652 13:106036236-106036258 AAAAATATATTAGCCGGGTGTGG + Intergenic
1113045478 13:106150376-106150398 CAAAATTAATTAGCCAGATGTGG + Intergenic
1113490199 13:110685586-110685608 GAGAATTTATGATCTAGATGGGG + Intronic
1113712354 13:112476272-112476294 TAAAATTTGTGAGCCAGACGCGG + Intergenic
1114188736 14:20424562-20424584 GGAAAATTTTTAGCCAGGTGTGG - Intergenic
1114388626 14:22281956-22281978 GAAAATCTATAAGGCATGTGTGG - Intergenic
1114496332 14:23135410-23135432 GAAAAGTTTTAGGCCAGGTGCGG + Intronic
1114561435 14:23594338-23594360 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1115373273 14:32643594-32643616 AAGAATGTATGGGCCAGGTGTGG - Intronic
1115565271 14:34619830-34619852 GGGAATTTGTGAGCCAGGTATGG - Intronic
1115715422 14:36098091-36098113 GTAATCTTATGGGCCAGGTGTGG - Intergenic
1115846043 14:37536058-37536080 AAAAACTTATCAGCCAGGTATGG - Intronic
1115966117 14:38890216-38890238 AAAAGATAATGAGCCAGGTGTGG - Intergenic
1116387640 14:44351083-44351105 TAAAACTTAAGAGACAGGTGGGG - Intergenic
1116884808 14:50209474-50209496 CAAAATTTTTAGGCCAGGTGCGG + Intronic
1116895222 14:50309836-50309858 AAAAAATAATTAGCCAGGTGTGG - Intronic
1117421448 14:55550606-55550628 GAACAGCTATAAGCCAGGTGTGG + Intergenic
1117599868 14:57364374-57364396 AAAAATTTATTAGCTGGGTGTGG + Intergenic
1117690771 14:58302802-58302824 TAAAAAGTATTAGCCAGGTGTGG + Intronic
1117967520 14:61221073-61221095 GAAAATTTAGGACAAAGGTGGGG + Intronic
1118017391 14:61674112-61674134 AAACATTTATTGGCCAGGTGCGG + Intergenic
1118123518 14:62872992-62873014 TAAAAAATATTAGCCAGGTGTGG + Intronic
1118213096 14:63784200-63784222 GTAATTTTTTGGGCCAGGTGCGG + Intergenic
1118216545 14:63813897-63813919 CAAAAAATATTAGCCAGGTGTGG + Intergenic
1118292103 14:64536468-64536490 GAAAAAATATTGGCCAGGTGTGG + Intronic
1118409516 14:65463555-65463577 GAAAATATATTAGCCAGGCACGG - Intronic
1118537322 14:66782527-66782549 GAAAGATTCTGGGCCAGGTGCGG + Intronic
1118606247 14:67505988-67506010 AACAAATTATCAGCCAGGTGAGG - Intronic
1118852823 14:69597569-69597591 TAAAAAATATTAGCCAGGTGTGG - Intergenic
1119104352 14:71910032-71910054 CAAAAATAATTAGCCAGGTGTGG + Intergenic
1119369776 14:74129690-74129712 AAAAAATAATTAGCCAGGTGTGG + Intronic
1119546694 14:75477202-75477224 CAAAAAATATCAGCCAGGTGTGG - Intergenic
1119792378 14:77363809-77363831 AAAAAGTAATGAGCCAGCTGTGG - Intronic
1120503712 14:85327675-85327697 GAAAAATAATTAACCAGGTGTGG - Intergenic
1120746316 14:88155322-88155344 AAAATTTAATTAGCCAGGTGTGG + Intergenic
1121262689 14:92578078-92578100 AAAAATAAATAAGCCAGGTGTGG + Intronic
1121898488 14:97671146-97671168 CAAAAATAATGAGCCAGGCGTGG + Intergenic
1122664646 14:103320135-103320157 AAAAATTTATTGGCCAGGTGCGG - Intergenic
1202832532 14_GL000009v2_random:52224-52246 AAAAATATATTAGCCTGGTGTGG + Intergenic
1123693837 15:22862451-22862473 GAAAATTAATGATCTAGGTCAGG - Intronic
1123763455 15:23450758-23450780 GAAAATTAATAGGCCAGGCGCGG - Intergenic
1123872069 15:24585905-24585927 AAAAATGTATTAGCCATGTGTGG - Intergenic
1124026308 15:25969571-25969593 AAAAAAAAATGAGCCAGGTGTGG - Intergenic
1124138477 15:27056193-27056215 GCAAAATAATGAGCCAGGTGTGG + Intronic
1125313418 15:38405024-38405046 GAAAATATATCGGCCAGGTGCGG - Intergenic
1125339313 15:38659117-38659139 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1125659731 15:41384455-41384477 TAAAATAAATTAGCCAGGTGTGG - Intergenic
1125659752 15:41384591-41384613 TAAAATAAATTAGCCAGGTGTGG - Intergenic
1125694605 15:41624620-41624642 CAAAAATTATCAGCCAGGTGCGG - Intronic
1125701542 15:41689829-41689851 GAAACAATATGGGCCAGGTGTGG - Intronic
1126029158 15:44479004-44479026 GAAAATGTAAAAGCCAGGAGTGG - Intronic
1126147607 15:45491175-45491197 GAAAAATGATTAGCCAGGTGTGG - Intronic
1126153049 15:45540435-45540457 CAAAAAAAATGAGCCAGGTGTGG - Intergenic
1126598300 15:50403682-50403704 AACAACTTATCAGCCAGGTGCGG - Intergenic
1126766271 15:52014549-52014571 AAAAAATAATTAGCCAGGTGTGG + Intronic
1127091210 15:55469636-55469658 AAAAATAAATTAGCCAGGTGTGG - Intronic
1127162351 15:56202654-56202676 TAAAATAAACGAGCCAGGTGTGG + Intronic
1127210809 15:56772628-56772650 AAAAATTTAATAGGCAGGTGTGG + Intronic
1127472298 15:59301148-59301170 GAAAACAAATGTGCCAGGTGCGG - Intronic
1127691542 15:61402135-61402157 GAGAACTTATGAGCCAGAAGAGG - Intergenic
1127724720 15:61737874-61737896 AAAAAAATATTAGCCAGGTGTGG + Intergenic
1127955965 15:63853828-63853850 AAAAATTAATTAGCCAGGTGTGG + Intergenic
1128005821 15:64239529-64239551 CAAAAATAATTAGCCAGGTGTGG - Intronic
1128083333 15:64869451-64869473 AAAAAGTTATGGGCCAGGCGTGG - Intronic
1128301508 15:66569068-66569090 GAAAAGAAAAGAGCCAGGTGCGG + Intergenic
1128572963 15:68748999-68749021 AAAAATAAATCAGCCAGGTGTGG + Intergenic
1128755005 15:70176885-70176907 GAAGACTTATGGGCCGGGTGTGG + Intergenic
1128908394 15:71490133-71490155 TAAAAATTATAGGCCAGGTGTGG + Intronic
1128954830 15:71928913-71928935 AAAAATTTAATAGCCAGATGTGG + Intronic
1128955251 15:71934754-71934776 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1129286516 15:74529569-74529591 GAGAAATTAGCAGCCAGGTGTGG - Intergenic
1129415245 15:75373220-75373242 CAAAAAAAATGAGCCAGGTGTGG + Intronic
1129436379 15:75544377-75544399 GAAAATAAATTAGCCGGGTGTGG + Intronic
1129611755 15:77065695-77065717 TAAAACTTATCAGCCAGGTGCGG - Intronic
1129636624 15:77325252-77325274 AAAAATAAATTAGCCAGGTGTGG + Intronic
1129754576 15:78089674-78089696 AAAAATAAATTAGCCAGGTGTGG - Intronic
1129807959 15:78480531-78480553 AAAAATAAATTAGCCAGGTGTGG + Intronic
1129816457 15:78558609-78558631 TAAAATTAATTAGCCAGGTGTGG - Intergenic
1129989770 15:79951602-79951624 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1130030922 15:80312929-80312951 GATGACTTGTGAGCCAGGTGTGG - Intergenic
1130065641 15:80602676-80602698 AAAAATTAATTAGCCAGGTGTGG + Intergenic
1130072344 15:80658260-80658282 GAAAATATTTAAGCCAGGCGTGG - Intergenic
1130144214 15:81261236-81261258 GAAAATCTTTGAACCAGGTTGGG + Intronic
1130747814 15:86674982-86675004 GATTATTAATGAGCCAAGTGAGG + Intronic
1131038705 15:89243168-89243190 GAAAAGAGATGAGCCAGGTGGGG - Intergenic
1131059279 15:89394681-89394703 GCAACTTTATGAGAAAGGTGTGG - Intergenic
1131475055 15:92731292-92731314 GAAAATGTGGTAGCCAGGTGCGG + Intronic
1131492226 15:92873062-92873084 GAAACATTATGGGCCAGGTGCGG - Intergenic
1131501405 15:92970490-92970512 TAATAATTATGGGCCAGGTGCGG - Intronic
1132225209 15:100135045-100135067 GAGAATTTATGGGACAGGAGCGG + Intronic
1132948263 16:2544873-2544895 AAAAAATTTTGGGCCAGGTGTGG - Intronic
1132970285 16:2684353-2684375 TAAAAATTATGGGCCAGGCGCGG + Intronic
1133016973 16:2948266-2948288 TAAAAATGATCAGCCAGGTGAGG + Intronic
1133427034 16:5701583-5701605 CAAAAAATATTAGCCAGGTGTGG - Intergenic
1133747688 16:8699715-8699737 CAAAAAATATCAGCCAGGTGTGG - Intronic
1133813091 16:9176541-9176563 AAAAAAAAATGAGCCAGGTGTGG - Intergenic
1134266910 16:12700680-12700702 GAAAGTCTTTGGGCCAGGTGTGG - Intronic
1134443838 16:14315644-14315666 AAAAATATATTGGCCAGGTGTGG - Intergenic
1134684330 16:16148114-16148136 CAAAAATAATTAGCCAGGTGTGG + Intergenic
1134713665 16:16343379-16343401 AAAAATATATAGGCCAGGTGCGG - Intergenic
1135005447 16:18818090-18818112 AAAAATTTATTGGCCAGGTGTGG + Intronic
1135120202 16:19759825-19759847 AAAAATATATTAGCCAGGTGTGG + Intronic
1135321098 16:21496982-21497004 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1135373932 16:21928484-21928506 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1135437854 16:22442237-22442259 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1135465731 16:22683343-22683365 AAAAATTAATTAGCCAGGTGTGG - Intergenic
1135468680 16:22709778-22709800 GAAAAAAAATCAGCCAGGTGTGG - Intergenic
1135602014 16:23791642-23791664 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1135920240 16:26642949-26642971 AAAAATGTGTTAGCCAGGTGTGG - Intergenic
1136272445 16:29156422-29156444 GAAAAGATAGGAGCCGGGTGCGG - Intergenic
1136416185 16:30105299-30105321 AAAAATTAATTAGCCCGGTGTGG + Intronic
1136571165 16:31097743-31097765 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1136744305 16:32570631-32570653 GGACATTTGTGAGCCAGTTGAGG + Intergenic
1137389448 16:48069211-48069233 TAAAAAATATTAGCCAGGTGTGG + Intergenic
1137478436 16:48830856-48830878 GCATATTTCTGAGCCAGATGTGG + Intergenic
1137508017 16:49073167-49073189 TAAAAAATATTAGCCAGGTGTGG + Intergenic
1137605565 16:49784657-49784679 GAAAGTGGATCAGCCAGGTGTGG + Intronic
1137642352 16:50043767-50043789 AAAAAGTTAAGGGCCAGGTGTGG - Intergenic
1137642989 16:50049439-50049461 AAAAATTTTTTGGCCAGGTGTGG - Intergenic
1137693241 16:50444380-50444402 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1137782061 16:51105823-51105845 TAAAATAAATTAGCCAGGTGTGG + Intergenic
1137985735 16:53106108-53106130 AAAAACTTCTGAGCCAGGTGCGG - Intronic
1138028897 16:53543453-53543475 GAACATTTATGAGCTTGTTGTGG + Intergenic
1138733811 16:59227659-59227681 AAAAAAAAATGAGCCAGGTGTGG + Intergenic
1138881658 16:61023261-61023283 GAACATTTGAGAGCCAGGTTTGG - Intergenic
1139687483 16:68615727-68615749 AAAATTTTATTGGCCAGGTGTGG - Intergenic
1139795016 16:69475872-69475894 CAAAAAATATTAGCCAGGTGTGG - Intergenic
1140037374 16:71381721-71381743 GAAAATCTAGGAGCCAGGCATGG + Intronic
1140041988 16:71414131-71414153 GAAAGTGTTTGAGCCAGGAGAGG + Intergenic
1140065481 16:71607712-71607734 AAAAATTTTTTAGCCGGGTGTGG - Intergenic
1140073867 16:71678352-71678374 CTAAAGTTATGGGCCAGGTGCGG + Intronic
1140340640 16:74156452-74156474 GAAAAGATCTGGGCCAGGTGCGG + Intergenic
1140374399 16:74433302-74433324 GAAAAGAAATTAGCCAGGTGTGG - Intergenic
1140425539 16:74858080-74858102 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1140549888 16:75854534-75854556 AAAAATGTTTTAGCCAGGTGCGG + Intergenic
1140669507 16:77263248-77263270 GAAAATTTATGAGGAATGAGAGG - Intronic
1140709720 16:77665866-77665888 AAAAAAATATTAGCCAGGTGTGG - Intergenic
1140804251 16:78518509-78518531 TAACATTTATGGGCCAGGCGTGG - Intronic
1140865217 16:79054667-79054689 GAAAAATAATTAGCCAGGCGTGG + Intronic
1141000314 16:80301592-80301614 AACAAATTGTGAGCCAGGTGCGG - Intergenic
1142324438 16:89405478-89405500 AAAAAAAAATGAGCCAGGTGTGG - Intronic
1203025294 16_KI270728v1_random:504601-504623 GGACATTTGTGAGCCAGTTGAGG - Intergenic
1203046427 16_KI270728v1_random:829830-829852 GGACATTTGTGAGCCAGTTGAGG + Intergenic
1142718304 17:1759732-1759754 TAAAGTTTCTGGGCCAGGTGTGG - Intergenic
1142772483 17:2108648-2108670 AAAAAATTCTGAGCCAGGTGTGG + Intronic
1142778991 17:2165747-2165769 TAAAAATAATTAGCCAGGTGAGG + Intronic
1142977235 17:3652799-3652821 GAAAATAAAAGAGCCAGGAGTGG + Intronic
1143491412 17:7287276-7287298 CAAAATAAATTAGCCAGGTGTGG - Exonic
1143785494 17:9252451-9252473 AAAAAAATATTAGCCAGGTGTGG + Intronic
1143826399 17:9611508-9611530 TAAAATAAATTAGCCAGGTGTGG - Intronic
1143913696 17:10273273-10273295 AAAAATTAATTAGCCATGTGTGG - Intergenic
1144233651 17:13234808-13234830 AAGAATTTCTGGGCCAGGTGCGG + Intergenic
1144418589 17:15074759-15074781 AAAAATTAATTAGCTAGGTGTGG + Intergenic
1144557582 17:16295651-16295673 AATAAATTATCAGCCAGGTGTGG + Intronic
1144856144 17:18269095-18269117 AAAAAATAATTAGCCAGGTGTGG + Intergenic
1145059143 17:19721272-19721294 CAAAATCTATGAGACAGTTGAGG - Intergenic
1145073325 17:19830490-19830512 TAAAATTTATGGGCCAGGCATGG - Intronic
1145099983 17:20066893-20066915 AAAATTTGATTAGCCAGGTGTGG - Intronic
1145721017 17:27072843-27072865 TAAAATATATTAGCCAGGCGTGG + Intergenic
1146171494 17:30637766-30637788 CAAAACATATGAGCCAGGGGTGG + Intergenic
1146287452 17:31583502-31583524 AAAAATTAATTAGCCGGGTGTGG - Intergenic
1147047262 17:37762503-37762525 GAAGAGTTATTGGCCAGGTGAGG + Intergenic
1147279352 17:39345829-39345851 GAAAATATTTAGGCCAGGTGTGG - Intronic
1147350480 17:39838987-39839009 AAAACTTTAAGAGCCAGATGTGG - Intronic
1147356172 17:39898985-39899007 AAAAAAAAATGAGCCAGGTGTGG - Intergenic
1147783346 17:42959950-42959972 GAAAATATGGCAGCCAGGTGCGG - Intronic
1147848706 17:43424463-43424485 TAAAAATAATTAGCCAGGTGTGG + Intergenic
1147923834 17:43934721-43934743 AAAATTTTAAAAGCCAGGTGTGG - Intergenic
1148014179 17:44509447-44509469 TAAAATAAATTAGCCAGGTGTGG + Intergenic
1148020651 17:44551169-44551191 TAAAAATTCTGGGCCAGGTGCGG + Intergenic
1148128711 17:45249778-45249800 TAAAAGTTATAGGCCAGGTGTGG - Intergenic
1148375376 17:47139820-47139842 AAAAATTGATGAGGCAGCTGAGG - Intronic
1148395238 17:47302955-47302977 GATAAGTTAGGGGCCAGGTGTGG + Intronic
1148410137 17:47459157-47459179 AAAAAATAATGAGCCAGGTGCGG + Intergenic
1148425887 17:47595690-47595712 AAGAAATTATGGGCCAGGTGCGG + Intronic
1148472529 17:47904107-47904129 AAAAATAAATTAGCCAGGTGTGG + Intronic
1148525374 17:48327779-48327801 AAAAAAATATTAGCCAGGTGTGG - Intronic
1148537040 17:48448403-48448425 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1148753182 17:49957737-49957759 AAAAATTGCTGGGCCAGGTGCGG + Intergenic
1148986053 17:51622279-51622301 GAAAAGTTATAAGCCAGCTGTGG - Intergenic
1149309315 17:55378739-55378761 GAAAAAAAATGAGCCAGGTGTGG + Intergenic
1149488206 17:57061333-57061355 TCAAATTAATGAGCCAGTTGCGG - Intergenic
1149599185 17:57882218-57882240 GAAAATTTATGAGCCACAGCTGG - Intronic
1149886671 17:60347338-60347360 AAAAAAAAATGAGCCAGGTGTGG - Intronic
1150033488 17:61767423-61767445 CAAAAAATATCAGCCAGGTGTGG - Intronic
1150074658 17:62182188-62182210 GAAAATGCATTGGCCAGGTGAGG - Intergenic
1150103248 17:62442429-62442451 CAAAAAATATTAGCCAGGTGTGG - Intronic
1150170996 17:62994335-62994357 AAAAAAAAATGAGCCAGGTGTGG - Intergenic
1150504221 17:65681827-65681849 GCAAAAATATTAGCCAGGTGTGG - Intronic
1150533251 17:66008507-66008529 AAAAAAATATGATCCAGGTGTGG - Intronic
1150704322 17:67473732-67473754 AAACATTTATTAGCCAGGTGAGG - Intronic
1150744956 17:67809098-67809120 TAAAATCTCTTAGCCAGGTGCGG + Intergenic
1150786087 17:68163823-68163845 CAAAAAATATTAGCCAGGTGTGG + Intergenic
1151040213 17:70850674-70850696 AAATATTTATTGGCCAGGTGCGG - Intergenic
1151136704 17:71953281-71953303 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1151272246 17:73005793-73005815 CAAAAAATATTAGCCAGGTGTGG + Intronic
1151506938 17:74534345-74534367 GAAAAACTACGGGCCAGGTGTGG - Intergenic
1151762766 17:76115827-76115849 AAAAATTTTTAGGCCAGGTGCGG + Intronic
1151774032 17:76186213-76186235 AACTATTTATGGGCCAGGTGCGG + Intronic
1151802930 17:76388242-76388264 GAAAACTGATGGGCCAGGCGTGG + Intergenic
1151859396 17:76748529-76748551 AAAAAAAAATGAGCCAGGTGTGG + Intronic
1151928754 17:77217560-77217582 GAAAATAAAAGAGGCAGGTGTGG + Intergenic
1152691132 17:81718191-81718213 CAAAAATTAGGGGCCAGGTGCGG + Intronic
1153038133 18:783902-783924 AAAAATTAATGAGCTAGGTGCGG - Intronic
1153291462 18:3505944-3505966 GCAAATTTTTGGGCCAGGTGCGG + Intronic
1153510925 18:5851244-5851266 GGCAATTTATGAGTGAGGTGTGG + Intergenic
1153565815 18:6415954-6415976 AAAAATATATTAGCCAGGTATGG + Intergenic
1153604986 18:6824246-6824268 GAGAATTTTTTAGCCAGGTGTGG + Intronic
1153650941 18:7239682-7239704 AAAAATTTCTGGGCCAGGCGCGG - Intergenic
1153845483 18:9045827-9045849 AAAAATTAAAGAGCCAGGCGTGG + Intergenic
1153893783 18:9541211-9541233 AAAAATTAATTAGCCAGGCGCGG + Intergenic
1154245322 18:12691994-12692016 AAAAATTTCTGGGCCAGGCGCGG - Intronic
1154273971 18:12943863-12943885 GAAAACAAATTAGCCAGGTGTGG - Intergenic
1154477275 18:14774835-14774857 AAAAATCTAAGGGCCAGGTGTGG + Intronic
1154989532 18:21587775-21587797 AAAAATAAATTAGCCAGGTGTGG + Intronic
1154995224 18:21634142-21634164 CAAAGTTTATCAGCCGGGTGTGG - Intergenic
1155099306 18:22593533-22593555 GAAAATTAGAGAACCAGGTGGGG - Intergenic
1155143893 18:23067929-23067951 GAAAAATTTTTAGCCAGGTGTGG - Intergenic
1155251874 18:23960615-23960637 GAAAACAAATTAGCCAGGTGTGG + Intergenic
1155449767 18:25951498-25951520 GTAATTTCATGGGCCAGGTGTGG + Intergenic
1155512302 18:26590237-26590259 AAAAAAAAATGAGCCAGGTGTGG - Intronic
1156264525 18:35474529-35474551 AAAAATTTAAAAGCCAGGTGTGG + Intronic
1156673251 18:39496370-39496392 AAAAATTTATGAACCACTTGAGG - Intergenic
1157235824 18:45964675-45964697 AAATATTTCTGAGCCGGGTGTGG + Intronic
1157393757 18:47325076-47325098 TAAAATATATTGGCCAGGTGTGG + Intergenic
1157645580 18:49266002-49266024 AAAAAATAATTAGCCAGGTGTGG + Intronic
1157660238 18:49434915-49434937 AAAAACTTTTGGGCCAGGTGTGG + Intronic
1157754027 18:50202565-50202587 ACAAATATATTAGCCAGGTGTGG + Intergenic
1157837766 18:50923459-50923481 GAAAAATTCTCAGCCAGGAGTGG + Intronic
1158124673 18:54087959-54087981 AAAATTTAATTAGCCAGGTGTGG + Intergenic
1158250217 18:55479569-55479591 GAAATTTTAAGGGCCAGGTCTGG - Intronic
1158548879 18:58418084-58418106 GAAATTTTAAAAGCCAGGTTCGG + Intergenic
1158603345 18:58873602-58873624 AAAAATTAATGAGCCAGGCATGG - Intronic
1158879751 18:61765910-61765932 CAAAATAAATTAGCCAGGTGTGG + Intergenic
1158983781 18:62792709-62792731 AAAAATTTATTAGCCAGGTATGG + Intronic
1159406404 18:68008276-68008298 GTACATTTATCAGCCAGGTAGGG - Intergenic
1159416855 18:68162408-68162430 GACAATTTATTAGCCATATGGGG + Intergenic
1159440613 18:68475288-68475310 AAAAATTAATTAGCCAGGTGTGG + Intergenic
1160075586 18:75672839-75672861 GACAATTAAATAGCCAGGTGTGG + Intergenic
1160098857 18:75901947-75901969 AAAAATTAATTAGCCGGGTGTGG + Intergenic
1160171271 18:76557535-76557557 TAAAATTTTTGAGCCAGGTGCGG + Intergenic
1160366586 18:78331558-78331580 CAAAAAATATCAGCCAGGTGTGG - Intergenic
1161341002 19:3742277-3742299 AAAAATAAATTAGCCAGGTGTGG + Intronic
1161372090 19:3918395-3918417 AAAAATAAATTAGCCAGGTGTGG + Intronic
1161646747 19:5457631-5457653 AAAAATTCATTAGCCAAGTGTGG + Intergenic
1161694054 19:5755615-5755637 TAAAAATTATTAGCCGGGTGTGG + Intronic
1161727558 19:5938892-5938914 AAACAATTATGGGCCAGGTGCGG + Intronic
1161807095 19:6450787-6450809 CAAAAATTATTGGCCAGGTGTGG + Intronic
1161831937 19:6612478-6612500 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1161923983 19:7287450-7287472 GAATACTTCTGGGCCAGGTGTGG - Intronic
1161947257 19:7445290-7445312 GAAAATAAATTAGCCAGCTGTGG + Intronic
1161956015 19:7495546-7495568 AAAAATTAAAAAGCCAGGTGCGG - Intronic
1162048864 19:8019922-8019944 GAAAATTTATTGGCCGGGCGCGG + Intronic
1162138361 19:8570060-8570082 AAAAATGTATTAGCCAGGCGTGG - Intronic
1162387862 19:10370989-10371011 TAAAATAAATTAGCCAGGTGTGG + Intronic
1162465868 19:10839878-10839900 GAAAAATAATTAGCCAGGTGTGG - Intronic
1162491333 19:10994193-10994215 CAAAAAATATTAGCCAGGTGTGG - Intronic
1162492326 19:11000588-11000610 AAAAAGTAATGGGCCAGGTGCGG + Intronic
1162632245 19:11937776-11937798 AAAAATCTATAGGCCAGGTGCGG - Intronic
1162871012 19:13586776-13586798 TAAAATATAATAGCCAGGTGTGG + Intronic
1162885115 19:13691301-13691323 AAAAAATAATTAGCCAGGTGTGG - Intergenic
1163352560 19:16787280-16787302 AAAAAATAATTAGCCAGGTGGGG - Intronic
1163428511 19:17252434-17252456 TAAAATTTAGGGGCCAGGTGTGG + Intronic
1163543590 19:17927197-17927219 GATAATTAATTGGCCAGGTGCGG + Intergenic
1163585099 19:18159593-18159615 AAAAAAAAATGAGCCAGGTGTGG - Intronic
1163623705 19:18375801-18375823 TAAAAGTAATTAGCCAGGTGTGG - Intronic
1163640433 19:18458908-18458930 GAAGAAATAGGAGCCAGGTGTGG - Intronic
1163930283 19:20383652-20383674 GAAAAATTTTTGGCCAGGTGCGG - Intergenic
1164004594 19:21136753-21136775 CAAAATAAATTAGCCAGGTGTGG + Intergenic
1164045725 19:21538305-21538327 GAAAATTCATAGGCCAGGTATGG + Intronic
1164050615 19:21583279-21583301 GAAAATGTTTGGGCCGGGTGCGG - Intergenic
1164064471 19:21703668-21703690 GCAAGTTTTTGGGCCAGGTGTGG - Intergenic
1164245873 19:23428374-23428396 AAATATTTATGTGCCAGGCGAGG - Intergenic
1164279519 19:23757174-23757196 TAACTTTTATAAGCCAGGTGAGG - Intronic
1164373500 19:27662645-27662667 GGATATTTTTGAGCCCGGTGAGG - Intergenic
1164373609 19:27664349-27664371 GAAGATTTATGAGCCCACTGAGG - Intergenic
1164377552 19:27701791-27701813 GAAAATTTCTGAGCCTCTTGAGG - Intergenic
1164406428 19:27951279-27951301 GAACATTTCTGAGCCAGCTGTGG - Intergenic
1164484755 19:28645424-28645446 AAAAATTAAAGAGCCAGGTGTGG - Intergenic
1165036160 19:33035390-33035412 AAAAATTTTTAGGCCAGGTGTGG - Intronic
1165098782 19:33425963-33425985 TAAAATAAATTAGCCAGGTGTGG - Intronic
1165387901 19:35522319-35522341 AAAATTTGATGAGCCAAGTGTGG + Intergenic
1165435961 19:35795303-35795325 GAAAATCTATCAGCTGGGTGTGG + Intergenic
1165505705 19:36227537-36227559 AAACATTTTTAAGCCAGGTGTGG - Intronic
1165575843 19:36816441-36816463 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1165701990 19:37945387-37945409 AAAAAAATATCAGCCAGGTGTGG - Intronic
1165713715 19:38030269-38030291 TTAAAAATATGAGCCAGGTGTGG + Intronic
1165877055 19:39015469-39015491 AAAAAAGTATTAGCCAGGTGTGG + Intronic
1166078937 19:40431256-40431278 AAAAATTTAAGAGCCAGGCGTGG - Intergenic
1166111321 19:40624687-40624709 TAAAATTCATCAGCCAGGTGTGG - Intronic
1166335933 19:42107197-42107219 GAAAAAAAATTAGCCAGGTGTGG + Intronic
1166443351 19:42835813-42835835 AAAAATGTGTGGGCCAGGTGCGG + Intronic
1166480325 19:43166554-43166576 AAAAATGTGTGGGCCAGGTGCGG + Exonic
1166555769 19:43698961-43698983 AAAATTTTCTGGGCCAGGTGTGG + Intergenic
1166660852 19:44646472-44646494 AAAAAGTTCTGGGCCAGGTGCGG + Intronic
1166725376 19:45024129-45024151 GAAAACTTCAGGGCCAGGTGCGG - Intronic
1166826072 19:45610026-45610048 GAAAAAGAATTAGCCAGGTGTGG - Intronic
1166923060 19:46245000-46245022 GAAATTCTGTTAGCCAGGTGCGG + Intergenic
1167092066 19:47351342-47351364 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1167110962 19:47460921-47460943 GAGTATTTATGGGCCAGGCGTGG + Intronic
1167306058 19:48710258-48710280 AAAAAATAATTAGCCAGGTGTGG - Intergenic
1167354879 19:48997471-48997493 AAAAAAATATTAGCCAGGTGTGG + Intronic
1167386944 19:49169042-49169064 AAAAATAAATTAGCCAGGTGTGG + Intronic
1167673778 19:50872123-50872145 AAAATTTAATTAGCCAGGTGTGG - Intronic
1167892550 19:52552305-52552327 AAAAATTTTTGGGCCGGGTGCGG - Intronic
1168398601 19:56069362-56069384 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1168416527 19:56172605-56172627 AAAAAATTAAGGGCCAGGTGCGG + Intergenic
1168519242 19:57035412-57035434 CAAAAATAATTAGCCAGGTGTGG + Intergenic
1168523915 19:57073816-57073838 GAAAAATAAAGGGCCAGGTGAGG + Intergenic
1168606439 19:57763792-57763814 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1168660395 19:58161134-58161156 AAAACTTTATGGGCCAGGCGCGG + Intergenic
924989767 2:302920-302942 GAACATTTATGATTCATGTGAGG + Intergenic
925193714 2:1906954-1906976 AAAAAAATATTAGCCAGGTGTGG + Intronic
925941384 2:8823123-8823145 TAAAAAATATTAGCCAGGTGTGG - Intronic
926042653 2:9686473-9686495 GAGAGTTTCTGACCCAGGTGAGG - Intergenic
926168978 2:10538976-10538998 AAAAATTAATTACCCAGGTGTGG + Intergenic
926182792 2:10660606-10660628 GAACATATATGGGCCAGGTGTGG - Intronic
926194640 2:10755334-10755356 TAAAAAATATTAGCCAGGTGTGG - Intronic
926282736 2:11463793-11463815 TAAAAATAATTAGCCAGGTGTGG + Intronic
927320503 2:21739295-21739317 GAAAATTTATTAGCCAATTTGGG - Intergenic
927408906 2:22803099-22803121 TTAAATTTATTGGCCAGGTGCGG + Intergenic
927553880 2:24019430-24019452 GAAAATGTTACAGCCAGGTGCGG + Intronic
927585629 2:24301679-24301701 TAAAAATAATTAGCCAGGTGTGG - Intronic
927608656 2:24513996-24514018 GCAAATTTTTAGGCCAGGTGCGG + Intronic
927753398 2:25689537-25689559 AAAAATAAATTAGCCAGGTGCGG + Intergenic
927764505 2:25792894-25792916 AAAAATTTATCAGCCGAGTGCGG - Intronic
928025243 2:27734199-27734221 AAAAATAAATTAGCCAGGTGTGG + Intergenic
928126744 2:28621576-28621598 GAAAATCAATGAGCCTGGTCAGG - Intronic
928524812 2:32129377-32129399 GAAAATCTACTGGCCAGGTGTGG - Intronic
928573575 2:32631961-32631983 CAAAAAAAATGAGCCAGGTGTGG - Intronic
928603042 2:32920123-32920145 GAAAAAATTTGGGCCAGGTGTGG - Intergenic
928648302 2:33378379-33378401 TAAAAAATATTAGCCAGGTGTGG - Intronic
928946088 2:36773452-36773474 TAAAATTTATTGGCCGGGTGTGG + Intronic
929096161 2:38265070-38265092 GAAAATTTATGAGGCAGAAAGGG - Intergenic
929211079 2:39358087-39358109 GAAAATTACAGAGACAGGTGAGG - Intronic
929470695 2:42189422-42189444 GAAAATAAGTGAGCCAGGCGTGG + Intronic
929675519 2:43923334-43923356 AAAAAATTATTAGCAAGGTGTGG + Intronic
929784126 2:44976846-44976868 CAAAACTAATTAGCCAGGTGTGG + Intergenic
929961504 2:46499930-46499952 GAAAACTTAGGAGCCAGCTGGGG - Intronic
930043262 2:47145873-47145895 AAAAATATAAGAGCCAGGTAGGG + Intronic
930131077 2:47851515-47851537 GAAAATTAATAGGCCAGGCGCGG - Intronic
930428392 2:51241485-51241507 TAACATGTATGGGCCAGGTGCGG + Intergenic
930792297 2:55346708-55346730 GTAAATTTATCAGCCGAGTGCGG - Intronic
930815238 2:55590035-55590057 ATAAATTTGTGGGCCAGGTGTGG + Intronic
930973672 2:57428032-57428054 TAAAAATAATTAGCCAGGTGTGG + Intergenic
931339526 2:61385838-61385860 AAAAACAAATGAGCCAGGTGTGG + Intronic
931358685 2:61559393-61559415 AAAAATAAATTAGCCAGGTGTGG - Intergenic
931365053 2:61612105-61612127 GAAATTTTTTTGGCCAGGTGTGG - Intergenic
931366791 2:61626210-61626232 AAAAATAAATTAGCCAGGTGTGG + Intergenic
931448590 2:62348257-62348279 GAAATTATCTGGGCCAGGTGTGG + Intergenic
931737312 2:65208296-65208318 AAAACTGTATGAGCCAGGTGCGG + Intergenic
931830354 2:66044565-66044587 GAAAAAAAATCAGCCAGGTGTGG + Intergenic
932122934 2:69118259-69118281 AAAATTTAATTAGCCAGGTGTGG + Intronic
932161269 2:69462388-69462410 AAGAATTTCTGGGCCAGGTGCGG + Intronic
932171197 2:69558050-69558072 AGAAATATATAAGCCAGGTGTGG + Intronic
932250224 2:70237110-70237132 GAAAATATATTAGCTAGGTGTGG + Intronic
932768690 2:74488127-74488149 CATAAATAATGAGCCAGGTGTGG - Intronic
933160386 2:79017251-79017273 CTGCATTTATGAGCCAGGTGGGG + Intergenic
933609947 2:84423237-84423259 AAAAATATATTAGCCGGGTGTGG + Intergenic
933867107 2:86530281-86530303 GAAGAGTTCTGGGCCAGGTGCGG - Intronic
934107951 2:88713314-88713336 GATATTTTCTTAGCCAGGTGTGG - Intronic
934678002 2:96263516-96263538 GTAAATTTTTGAGCCGGGCGTGG - Intronic
934932321 2:98436621-98436643 AAACATATATCAGCCAGGTGCGG - Intergenic
935055957 2:99567121-99567143 AAAAAAAAATGAGCCAGGTGTGG - Intronic
935486198 2:103657415-103657437 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
935683715 2:105664499-105664521 AAAAATGTATCAGCCAGGCGAGG + Intergenic
935761590 2:106325588-106325610 GAAAATGTCTGGGCCAGGTGCGG - Intergenic
935974437 2:108563901-108563923 TAAAAATAATTAGCCAGGTGTGG + Intronic
936026334 2:109033798-109033820 CAAAAAAAATGAGCCAGGTGTGG + Intergenic
936174085 2:110203922-110203944 AAAAATTTTTAGGCCAGGTGTGG - Intronic
936473582 2:112820148-112820170 GAAAATTTAGGGGCCAGGCAGGG - Intergenic
937979177 2:127603841-127603863 GAAAATCTGTTGGCCAGGTGTGG + Intronic
938402964 2:131008101-131008123 AATAATTTAGGGGCCAGGTGTGG - Intronic
938556286 2:132427317-132427339 AAAAATATATTAGCCAGGTGTGG - Intronic
938858485 2:135341173-135341195 GAAAAAAAATTAGCCAGGTGTGG - Intronic
939889438 2:147719571-147719593 GAAATATTAAGGGCCAGGTGTGG + Intergenic
939915030 2:148029979-148030001 AAAAAGTTAGGGGCCAGGTGCGG + Intronic
939928691 2:148205231-148205253 AAAAATAAATTAGCCAGGTGTGG - Intronic
940189749 2:151028026-151028048 AAAATTTAATTAGCCAGGTGTGG + Intronic
940210062 2:151246898-151246920 AAAAATGTATTAGCCTGGTGTGG + Intergenic
940365671 2:152846080-152846102 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
941352776 2:164456568-164456590 GGAAATGTATGAGTCAGTTGGGG + Intergenic
941607735 2:167621242-167621264 ATAAATGTATAAGCCAGGTGTGG - Intergenic
941638793 2:167965068-167965090 AGAAATTTATTAGCCAGGAGAGG + Intronic
941826356 2:169901785-169901807 GAAAAATTATGAGCTATGTTTGG - Intronic
941826519 2:169903728-169903750 TAAAAAATATGAGCCGGGTGTGG + Intronic
941840748 2:170081035-170081057 AAAAATAAATAAGCCAGGTGTGG + Intronic
941987020 2:171520112-171520134 GAAAAATAATGACACAGGTGAGG + Intergenic
942016005 2:171816354-171816376 GAATATTTTTGTGCCAGGTGAGG - Intronic
942281689 2:174370753-174370775 AAAAAAATATTAGCCAGGTGTGG + Intronic
942551708 2:177126550-177126572 AAAAATTAATTAGCCAGGTGTGG + Intergenic
942671008 2:178376503-178376525 GAAAAGTTATGAGACTGATGGGG - Intronic
942759408 2:179380625-179380647 AAAAAATAATTAGCCAGGTGTGG + Intergenic
942883983 2:180899840-180899862 GAAAGTATATGAGAAAGGTGAGG + Intergenic
942894103 2:181030120-181030142 AAAAATAGAGGAGCCAGGTGTGG - Intronic
942968040 2:181921185-181921207 AAAAAATAATAAGCCAGGTGTGG + Intronic
943065967 2:183086514-183086536 GAAAATATATAGGCCAGGTGTGG + Intronic
943141681 2:183991253-183991275 GAAACCTTATAAGCCAGGAGAGG - Intergenic
943307076 2:186276076-186276098 CAAAAATTAGTAGCCAGGTGTGG + Intergenic
943352954 2:186817161-186817183 ATACATTTATGGGCCAGGTGCGG + Intergenic
943767025 2:191674162-191674184 TAAAAATAATCAGCCAGGTGTGG + Intergenic
944698578 2:202225392-202225414 CAAAAATTATTAGCCAGGTGTGG + Intronic
944700568 2:202242349-202242371 AAAAAATAATTAGCCAGGTGTGG - Intergenic
944770371 2:202908297-202908319 GAAAAGTGATTAGCCAGGCGTGG + Intronic
945875826 2:215277508-215277530 AAACATTTATGAGCTGGGTGCGG - Intergenic
946277296 2:218641227-218641249 AAAAAATTATCGGCCAGGTGAGG - Intronic
946546697 2:220751837-220751859 CAAAAAATATTAGCCAGGTGTGG - Intergenic
946568230 2:220991872-220991894 GTAAAAATATTAGCCAGGTGTGG + Intergenic
946745889 2:222845433-222845455 AAAGCTTTATTAGCCAGGTGTGG - Intergenic
946810216 2:223515541-223515563 AAAAATTTCTGGGCCAGGTATGG + Intergenic
947109013 2:226698617-226698639 ATAAATATATCAGCCAGGTGCGG - Intergenic
947517210 2:230816115-230816137 AAAAATTAATTAGCCAGGTGTGG + Intronic
947652804 2:231801603-231801625 GAAAAAAAATCAGCCAGGTGTGG - Intronic
948103757 2:235396258-235396280 GATAATTTGTGGGCCAGGCGTGG - Intergenic
948170912 2:235901588-235901610 TAAAAATTATGGGCCAGGTGTGG + Intronic
948201900 2:236135565-236135587 AAAAATTTTTTGGCCAGGTGCGG - Intergenic
948497372 2:238360591-238360613 TAAAATTTTTCAGCCGGGTGTGG + Intronic
948688884 2:239689742-239689764 TAAAAATAATTAGCCAGGTGTGG + Intergenic
948999665 2:241605871-241605893 GAAAAGTATTTAGCCAGGTGTGG - Intronic
1168787990 20:556438-556460 TTACATTTATCAGCCAGGTGCGG + Intergenic
1168890112 20:1289690-1289712 AAAAATAGATTAGCCAGGTGAGG + Intronic
1169148475 20:3270296-3270318 GTCAGTTTTTGAGCCAGGTGCGG - Intronic
1169423762 20:5480454-5480476 CAAAAATTATAGGCCAGGTGTGG + Intergenic
1170061346 20:12262858-12262880 AAAAATTCATTAGCCAAGTGTGG + Intergenic
1170342916 20:15349464-15349486 GGAAAATTATGGGCCAGGCGTGG + Intronic
1170362975 20:15567639-15567661 GAAAACTTACGAGGCAGTTGTGG - Intronic
1170699751 20:18693364-18693386 GAAAAATTGAGGGCCAGGTGCGG + Intronic
1170762590 20:19263945-19263967 GAAAATCTATGGGCCAGGGGCGG + Intronic
1170847362 20:19973955-19973977 GCATATTTATGAGCATGGTGAGG + Intronic
1170850265 20:19998132-19998154 CAAAATAAATTAGCCAGGTGTGG - Intronic
1170867519 20:20172606-20172628 AAAAGTTTATTGGCCAGGTGTGG - Intronic
1170915149 20:20615450-20615472 TGAAAGTTATCAGCCAGGTGCGG - Intronic
1170964933 20:21059711-21059733 AAAAATTTATTGGCCAGGTGTGG - Intergenic
1171095199 20:22326089-22326111 GTAAGTTTATAAGCAAGGTGGGG + Intergenic
1172155082 20:32818795-32818817 GAGAATGTAAGGGCCAGGTGTGG + Intergenic
1172503803 20:35446015-35446037 TAAAATAAATAAGCCAGGTGTGG + Intronic
1172754803 20:37275890-37275912 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1172790859 20:37504587-37504609 GACATTTGAGGAGCCAGGTGTGG - Intronic
1172964070 20:38820740-38820762 AAAAAAATTTGAGCCAGGTGCGG + Intronic
1173007003 20:39147641-39147663 AAAAAATAATCAGCCAGGTGTGG + Intergenic
1173701037 20:45071919-45071941 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1173805371 20:45921382-45921404 AAAAAATAATTAGCCAGGTGTGG + Intergenic
1173806348 20:45927900-45927922 AAAATTTAATGAGCCAGGTGTGG + Intergenic
1174361929 20:50034388-50034410 AAAAATTTAATAGCCAGGTGTGG - Intergenic
1174432496 20:50480564-50480586 GAGAAATAATTAGCCAGGTGTGG + Intergenic
1174504506 20:51008483-51008505 AAAATTTAATTAGCCAGGTGTGG - Intronic
1174628510 20:51935851-51935873 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1174763761 20:53232038-53232060 AAAAATAAATTAGCCAGGTGTGG - Intronic
1174913722 20:54633744-54633766 GAAAATTTAAGAGCTTGATGAGG + Intronic
1174958461 20:55127875-55127897 AAAAAAATATTAGCCAGGTGTGG + Intergenic
1174987959 20:55476518-55476540 AAAAAATAATCAGCCAGGTGTGG - Intergenic
1175270329 20:57729488-57729510 TAAAATAAATTAGCCAGGTGTGG + Intergenic
1175299013 20:57929707-57929729 GAAGTTTTATGAGCAAGGAGAGG + Intergenic
1176045589 20:63091057-63091079 GCAAAGCTGTGAGCCAGGTGAGG + Intergenic
1176176225 20:63726676-63726698 AAAAATTATTTAGCCAGGTGTGG - Intronic
1176692508 21:9933198-9933220 GAAAAATTATAAGCCAGTTTGGG + Intergenic
1177234453 21:18368998-18369020 AAAAATATATGACCCAGTTGTGG + Intronic
1177249261 21:18570812-18570834 TAAAAATAATTAGCCAGGTGCGG - Intergenic
1177607592 21:23401542-23401564 GAAGATTTCTGGGTCAGGTGTGG - Intergenic
1177879347 21:26673587-26673609 GAAAACTGCTTAGCCAGGTGTGG - Intergenic
1177923752 21:27187564-27187586 GCAAATTAATTAGCCATGTGTGG - Intergenic
1177961300 21:27670083-27670105 GAAAATAAAGGAGGCAGGTGAGG - Intergenic
1178197230 21:30360474-30360496 TAAAATGTATGACACAGGTGAGG + Intronic
1178344324 21:31811912-31811934 GATAATGTATGAGCCGGGAGCGG - Intergenic
1178533071 21:33391362-33391384 AAAAATTTATGGGCTGGGTGTGG + Intergenic
1178597886 21:33971246-33971268 GAAAACAAATGGGCCAGGTGTGG - Intergenic
1178744570 21:35236592-35236614 GAAAAACAATTAGCCAGGTGTGG - Intronic
1178825789 21:36015663-36015685 AAAAAAAAATGAGCCAGGTGTGG - Intergenic
1179395338 21:41034808-41034830 CAACATTTATAGGCCAGGTGCGG + Intergenic
1179529082 21:42006122-42006144 AAAATTTTCTTAGCCAGGTGTGG + Intronic
1179535507 21:42048954-42048976 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1179807423 21:43848562-43848584 AAAAAGAAATGAGCCAGGTGTGG - Intergenic
1179843693 21:44095201-44095223 TAAAAATAATTAGCCAGGTGTGG - Intronic
1180682276 22:17636638-17636660 AAAAAAATATTAGCCAGGTGTGG + Intronic
1180900204 22:19366070-19366092 AAAATTTTGTGGGCCAGGTGTGG + Intronic
1180973034 22:19825464-19825486 AAAAATAAATTAGCCAGGTGTGG + Intronic
1181147764 22:20860757-20860779 AAAAATGTATAAGCCAGGCGCGG + Intronic
1181219575 22:21358351-21358373 GAAAGTGCCTGAGCCAGGTGAGG + Intergenic
1181300745 22:21879300-21879322 AAAATTTTGTGGGCCAGGTGTGG - Intergenic
1181525576 22:23483621-23483643 TAAAAATAATCAGCCAGGTGTGG + Intergenic
1181691765 22:24566550-24566572 GAACAACTATGGGCCAGGTGTGG - Intronic
1181726201 22:24812654-24812676 GAAGATTTATGAGCAAGGGAGGG + Intronic
1181759313 22:25047124-25047146 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1182190672 22:28456862-28456884 AAAAATTTATGGGCCGGGTGCGG - Intronic
1182264995 22:29107591-29107613 GAACATTAATAGGCCAGGTGAGG + Intronic
1182582548 22:31323401-31323423 AAAAAATAATTAGCCAGGTGTGG + Intergenic
1182820612 22:33212725-33212747 GAATATTTGTGGGCCGGGTGCGG + Intronic
1182825211 22:33259031-33259053 ACAAATATATTAGCCAGGTGTGG - Intronic
1182926912 22:34133807-34133829 AAAGATTTGTGGGCCAGGTGTGG + Intergenic
1183151225 22:36039009-36039031 TAAAAATAATTAGCCAGGTGTGG + Intergenic
1183775428 22:39961099-39961121 AAAAAAATATTAGCCAGGTGTGG - Intronic
1183808424 22:40233165-40233187 GAAAAGAAATTAGCCAGGTGTGG + Intronic
1184485432 22:44775738-44775760 AAAGAGTTATGGGCCAGGTGCGG - Intronic
1184624583 22:45714534-45714556 AAAAATTAATCAGCCAGGTGCGG - Intronic
1184843872 22:47069066-47069088 GAAAATTTATGAGCCATTGTGGG - Intronic
1185187908 22:49413893-49413915 GAAAATTCAAGATCCAGATGTGG + Intergenic
1185348892 22:50323886-50323908 AAAAATAAATTAGCCAGGTGTGG - Intronic
1185396223 22:50590984-50591006 AAAAATAAAGGAGCCAGGTGTGG - Intronic
949481180 3:4494726-4494748 GAAAGTTTATGAGAGAGGAGGGG + Intronic
949489952 3:4579918-4579940 AAACCTTTATTAGCCAGGTGCGG + Intronic
950235996 3:11320576-11320598 GTAAAATTATGGACCAGGTGTGG - Intronic
950284438 3:11733646-11733668 GAAAAAAAATGAGCCCGGTGTGG - Intergenic
950512238 3:13437707-13437729 AAAAAGATATGGGCCAGGTGCGG - Intergenic
950513720 3:13450043-13450065 TAAAATAAATTAGCCAGGTGTGG + Intergenic
951346132 3:21548249-21548271 GAAACAGTATCAGCCAGGTGTGG - Intronic
951531053 3:23698399-23698421 ACAAATTTCTGGGCCAGGTGCGG + Intergenic
951877368 3:27442034-27442056 TAAAAATAATTAGCCAGGTGTGG - Intronic
953094797 3:39764968-39764990 GAAGATTGATGATCCAGGTAAGG + Intergenic
953737171 3:45505533-45505555 AAAAATTAATGAGCCAGGTGTGG + Intronic
953752161 3:45617187-45617209 TAAAATAAATTAGCCAGGTGGGG - Intronic
953864300 3:46571147-46571169 GAAAAGAAATTAGCCAGGTGTGG + Intronic
954165482 3:48754051-48754073 CAAAAAATATTAGCCAGGTGTGG - Intronic
954174288 3:48831520-48831542 AAAAATATAATAGCCAGGTGTGG - Intronic
954339736 3:49943597-49943619 AAAAAATTATGGGCCAGATGTGG - Intronic
954643424 3:52116032-52116054 AAAAATCTATGAGGCAGATGAGG + Intronic
955053806 3:55438379-55438401 CAAAAGTCATTAGCCAGGTGTGG - Intergenic
955079985 3:55649548-55649570 AAAAAATTATTGGCCAGGTGCGG - Intronic
955369366 3:58338049-58338071 AAAAATTTCTTAGCCAGGCGTGG + Intronic
955758438 3:62251227-62251249 CAAAAAATATAAGCCAGGTGTGG + Intronic
955912682 3:63873857-63873879 AAAAATGTATTAGCCAGGTTTGG - Intronic
956026316 3:64986820-64986842 TAAAAATTACCAGCCAGGTGGGG + Intergenic
956059707 3:65337029-65337051 TAAAATTTTTGGGCCGGGTGAGG - Intergenic
956678906 3:71759724-71759746 GAAAGTTTAAGAGGCAGTTGAGG - Intergenic
956819843 3:72944241-72944263 GAAAAAAAAAGAGCCAGGTGTGG - Intronic
957150384 3:76478826-76478848 GAAAATAAATTAGCCAGATGAGG - Intronic
958552386 3:95633268-95633290 AAAAAAAAATGAGCCAGGTGTGG - Intergenic
958913117 3:100017632-100017654 GTAAAGTTGTGAGCCAGATGTGG + Intronic
959087468 3:101866800-101866822 GATAAATTTTTAGCCAGGTGTGG + Intergenic
959981801 3:112525936-112525958 GAAAATAAATTAGCCAGGCGTGG + Intergenic
960024755 3:112995824-112995846 AAAAATTAATGGGCCAGGTGCGG - Intronic
960476486 3:118135851-118135873 GAACATTTATGATTCATGTGAGG + Intergenic
960480077 3:118177211-118177233 TAAAATTTATGGGCCGGGCGCGG - Intergenic
960630473 3:119725599-119725621 AAAAATAAATTAGCCAGGTGTGG + Intronic
961247199 3:125465399-125465421 CAAAATAAATTAGCCAGGTGTGG - Intronic
961418328 3:126778908-126778930 AAAATTTAATGAGCCAGGCGTGG - Intronic
961747575 3:129074916-129074938 AAAAATATATTAGCCAGGTATGG - Intergenic
962061541 3:131932863-131932885 CAAAAATAATTAGCCAGGTGTGG + Intronic
962326297 3:134435804-134435826 AAGAATTAATTAGCCAGGTGTGG - Intergenic
962541312 3:136385282-136385304 TACAATATATCAGCCAGGTGTGG + Intronic
962546229 3:136438904-136438926 TAAAGTTTCTCAGCCAGGTGTGG + Intronic
962790660 3:138808523-138808545 GAAAAATACAGAGCCAGGTGTGG + Intronic
963108916 3:141669164-141669186 AAAAATTAATGAGCCAGATGTGG + Intergenic
963237660 3:142971555-142971577 AAAAATGTAAAAGCCAGGTGTGG + Intronic
963243125 3:143030753-143030775 GAACATTTGTGGGCCAGGTGTGG + Intronic
963289700 3:143475112-143475134 AAAAAAAAATGAGCCAGGTGTGG - Intronic
963773169 3:149410186-149410208 GAAAATTTGTGATCCATGGGAGG - Intergenic
963780229 3:149479500-149479522 GAGAAATGATTAGCCAGGTGAGG - Intronic
963790024 3:149574184-149574206 TAAAAAAAATGAGCCAGGTGTGG - Intronic
964237681 3:154552483-154552505 GAAAATTTCTGAGACAGAAGGGG + Intergenic
964422628 3:156520288-156520310 GAAAAATTATAGGCCAGGTGTGG + Intronic
964431478 3:156611360-156611382 AAAAATTCAAGGGCCAGGTGCGG - Intergenic
964737643 3:159932953-159932975 AAAAATATTTTAGCCAGGTGTGG - Intergenic
965020696 3:163226632-163226654 CAAAAATAATTAGCCAGGTGCGG - Intergenic
965162316 3:165150142-165150164 AAAAATAAATTAGCCAGGTGTGG - Intergenic
965193404 3:165561176-165561198 AAAAATTAATGAGCCAGGCATGG - Intergenic
965195912 3:165594079-165594101 TAAAATGAATTAGCCAGGTGTGG + Intergenic
965547544 3:169931608-169931630 ATAAATTAAAGAGCCAGGTGCGG - Intronic
965905383 3:173699144-173699166 AAAACTTCTTGAGCCAGGTGCGG - Intronic
966319959 3:178691233-178691255 AAAAATTAAAAAGCCAGGTGTGG - Intronic
966359097 3:179115130-179115152 AAAAATTAAACAGCCAGGTGTGG + Intergenic
966479824 3:180394242-180394264 GAATGTTTCTGGGCCAGGTGCGG - Intergenic
966554778 3:181246474-181246496 AAAAAATAATTAGCCAGGTGTGG + Intergenic
966705273 3:182906738-182906760 GAAAATTTATGAGCCAGGTGTGG - Intronic
966861378 3:184232771-184232793 GGAAATTTATGAGCAGAGTGGGG + Intronic
967594271 3:191311994-191312016 GAAAAAAAATTAGCCAGGTGTGG + Intronic
968126854 3:196166386-196166408 AAATGTTTATCAGCCAGGTGTGG - Intergenic
968312888 3:197698701-197698723 GAAAAATTCTGGGCCAGGTGTGG + Intronic
968342322 3:197966947-197966969 GAAAATAAATGAACCAGGTGTGG - Intronic
968399475 4:279880-279902 AAAAATTTATAAACCAGGTAGGG + Intronic
968686478 4:1962824-1962846 AAAATTTCATCAGCCAGGTGTGG - Intronic
969393153 4:6904104-6904126 AAAAAATAATTAGCCAGGTGTGG + Intergenic
969906792 4:10404627-10404649 GAGACTTTATGCACCAGGTGTGG + Intergenic
970016291 4:11516295-11516317 GAAAATGTATGGGTCAGGTGCGG + Intergenic
970043209 4:11820184-11820206 CAAAAAAAATGAGCCAGGTGTGG - Intergenic
970080588 4:12280174-12280196 GAACATTTCTGAGCCAATTGTGG - Intergenic
970081223 4:12288759-12288781 GGAAATTTCTGAGCCCGTTGAGG - Intergenic
970115142 4:12686511-12686533 GAAAAGTTCTTGGCCAGGTGTGG + Intergenic
970646553 4:18128148-18128170 GAAAATTTAGGAGACAAGAGTGG - Intergenic
970930220 4:21502557-21502579 GAACATTTAAGAGGCAAGTGTGG - Intronic
971109436 4:23566809-23566831 AAAATCTTATAAGCCAGGTGTGG - Intergenic
972202857 4:36736314-36736336 TAAAACTTTTGGGCCAGGTGTGG - Intergenic
972547464 4:40094033-40094055 CAAAATTTGTAGGCCAGGTGTGG - Intronic
972595124 4:40523255-40523277 TAAAAATTATTAGCCAGGTGTGG - Intronic
972595692 4:40528120-40528142 GAAATGTTTTGGGCCAGGTGTGG + Intronic
972794612 4:42402830-42402852 AAAAATAGATGGGCCAGGTGGGG - Intergenic
972964372 4:44491291-44491313 CAAAATAAATTAGCCAGGTGTGG + Intergenic
973390635 4:49553556-49553578 AAAAATATATTAGCCTGGTGTGG + Intergenic
973780017 4:54279695-54279717 GAAAAATTGAGAGGCAGGTGAGG - Intronic
973889516 4:55355166-55355188 GAAAATGTATAGGCCGGGTGCGG + Intronic
975094727 4:70444759-70444781 GAACACTTTTGGGCCAGGTGCGG + Intronic
975097492 4:70474362-70474384 AAAATTTAATTAGCCAGGTGTGG + Intronic
975873612 4:78809531-78809553 TAAAAATAATTAGCCAGGTGTGG - Intronic
975893824 4:79062181-79062203 AAAAAATAATTAGCCAGGTGTGG - Intergenic
976162434 4:82217673-82217695 GAAAAATTAAGACCCAGGTCTGG - Intergenic
976245838 4:83005184-83005206 GTAAATTTATAGGCCAGGTGCGG - Intronic
976409869 4:84700956-84700978 GAAAAAGAATTAGCCAGGTGTGG + Intronic
976573054 4:86635671-86635693 CAAAATATTTGGGCCAGGTGCGG + Intronic
976585920 4:86797066-86797088 TAAAATTTTCGGGCCAGGTGCGG + Intronic
977165514 4:93690286-93690308 GATAACTTCTGAGGCAGGTGTGG + Intronic
977276403 4:94982700-94982722 AAAAATTTGTCAGCCGGGTGCGG + Intronic
977718224 4:100208301-100208323 GTAAAATTATGAGTGAGGTGAGG + Intergenic
977806752 4:101308714-101308736 AAATAATTATGGGCCAGGTGTGG - Intronic
977907975 4:102499985-102500007 GAAATTCTGTGAGCCGGGTGCGG - Intergenic
978222103 4:106289478-106289500 GACAATTGATCAGCCAGGCGCGG + Intronic
978397627 4:108298820-108298842 AAAAATAAATTAGCCAGGTGTGG - Intergenic
978509316 4:109498652-109498674 AAAAATAAATGAGCCAGGCGTGG - Intronic
978524774 4:109654318-109654340 GATCATATATCAGCCAGGTGTGG + Intronic
978787774 4:112629378-112629400 TAAAATATTTGAGCCAGGCGCGG + Intronic
978858362 4:113419211-113419233 AAAAATTAATCAGCTAGGTGTGG + Intergenic
979067667 4:116158408-116158430 GAAAATGGAAGGGCCAGGTGCGG + Intergenic
979618443 4:122771105-122771127 CTAAATTGATAAGCCAGGTGTGG + Intergenic
979655623 4:123189956-123189978 AAAAATAAATTAGCCAGGTGTGG - Intronic
979683759 4:123488489-123488511 ATAAATTTTTGAGCCAGGCGCGG - Intergenic
979860277 4:125685241-125685263 GAACATCTATTGGCCAGGTGCGG + Intergenic
980163508 4:129196569-129196591 AAAAAGTAATTAGCCAGGTGTGG - Intergenic
980365095 4:131793419-131793441 GAAAAATTATAAGCCAGTTTGGG + Intergenic
980384787 4:132074272-132074294 AGAAGTTTATGAGCCAGGCGTGG - Intergenic
980961264 4:139478657-139478679 GCAAATTCAGGGGCCAGGTGTGG - Intergenic
981475779 4:145185252-145185274 AAAGAATTATGGGCCAGGTGTGG - Intergenic
981703029 4:147627739-147627761 GAAAATAAATTAGCCAGGTGTGG + Intronic
981703050 4:147627870-147627892 GAAAATAAATTAGCCAGGTGTGG + Intronic
981703071 4:147628001-147628023 GAAAATAAATTAGCCAGGTGTGG + Intronic
982257226 4:153462907-153462929 AAAAATTTTTGGGCCAGGTGCGG + Intergenic
982456199 4:155611910-155611932 TTAAATTAATAAGCCAGGTGTGG + Intergenic
982495274 4:156083600-156083622 TTAAATATATGTGCCAGGTGGGG - Intergenic
982782128 4:159502103-159502125 GAAAATAGGAGAGCCAGGTGTGG - Intergenic
983480795 4:168271166-168271188 GAATATTTATTGGTCAGGTGCGG - Intronic
983777974 4:171632099-171632121 GAAAAATAATGGGCCAGGCGCGG + Intergenic
983861949 4:172718480-172718502 AAAAACATATGAGCCAGGTATGG + Intronic
984001568 4:174252813-174252835 AAAAAAATATTAGCCAGGTGTGG + Intronic
984358222 4:178692597-178692619 AAAAACTTATGAGCCAGGAGAGG - Intergenic
984797830 4:183681488-183681510 GTAAATTAATGGGCCGGGTGCGG + Intronic
984823058 4:183900442-183900464 GAAAATTTGTGATCCATGGGAGG + Intronic
984916790 4:184732711-184732733 TAAAATTTCTGGGCCAGGCGCGG + Intronic
984970915 4:185189079-185189101 TAAAAAATATTAGCCAGGTGTGG + Intronic
985272359 4:188206473-188206495 AAAAATTAATTAGCCAGGAGTGG - Intergenic
986134449 5:4961092-4961114 GAATATTTTTGGGCCAGGTGTGG - Intergenic
986186505 5:5446163-5446185 AAAAATTTAAAAGGCAGGTGTGG - Intronic
987255348 5:16144689-16144711 CAAAATGTATTAGCCAAGTGAGG + Intronic
987813432 5:22869523-22869545 GAAAATTTATTTGCGAGGTGAGG + Intergenic
988039090 5:25864799-25864821 AAAAAAATATTAGCCAGGTGTGG - Intergenic
988140866 5:27238250-27238272 AAAAAATAATAAGCCAGGTGTGG + Intergenic
988475509 5:31581463-31581485 TAAAATATATTAGCCAGGTGTGG - Intergenic
988544694 5:32144432-32144454 AAAAATTAATTAGCTAGGTGTGG + Intronic
988809675 5:34772062-34772084 AAAAATAAATTAGCCAGGTGAGG - Intronic
988904669 5:35774084-35774106 GGCAATTGATGAGCCAGTTGTGG - Intronic
989040004 5:37217822-37217844 GAAAAAAAATTAGCCAGGTGTGG + Intronic
989421509 5:41245237-41245259 AAAAATTTAACAGCCATGTGTGG + Intronic
989786562 5:45339313-45339335 GAAAATTTATGAATGAGGTTAGG + Intronic
989795433 5:45465464-45465486 GTAAGTTTTTCAGCCAGGTGCGG + Intronic
989856486 5:46300786-46300808 GAATATTTATGAGAAATGTGTGG - Intergenic
990281687 5:54258180-54258202 AAAAATTTATGAGTGAGGCGTGG + Intronic
990764894 5:59171170-59171192 GTGAAAGTATGAGCCAGGTGTGG - Intronic
990909409 5:60838731-60838753 AAATATTTATGAGTCAGGTGTGG + Intronic
990958551 5:61367969-61367991 AAAAAATAATTAGCCAGGTGTGG + Intronic
991080967 5:62598833-62598855 AATGATTTATGGGCCAGGTGCGG - Intronic
991343941 5:65642814-65642836 AAAAAATAATTAGCCAGGTGTGG - Intronic
991533006 5:67636495-67636517 GAAAATTTGGAAACCAGGTGAGG - Intergenic
991698710 5:69297647-69297669 TAAAATATATGGGCCAGGTGCGG - Intronic
991928572 5:71729366-71729388 AAAAAATTATAGGCCAGGTGTGG + Intergenic
992074741 5:73181258-73181280 GTATATTTATGGGCCAGGCGTGG - Intergenic
992119448 5:73576012-73576034 GAAAAGGTATTAGCCGGGTGCGG - Intronic
992395670 5:76367508-76367530 ATATATTTATGGGCCAGGTGTGG - Intergenic
992685860 5:79198892-79198914 GAAAATTGGTGGTCCAGGTGTGG - Intronic
992800492 5:80291258-80291280 AAAAATATATTATCCAGGTGTGG - Intergenic
992855637 5:80858337-80858359 GAAAATTTATAGGCCAGGAGCGG - Intronic
992895744 5:81243843-81243865 CAAAAAATATTAGCCAGGTGTGG - Intronic
992972617 5:82078415-82078437 GAAAATGTGTGTGCCAGGTGTGG + Intronic
993547236 5:89228816-89228838 GAAAATTAATTAGCTAGGTATGG - Intergenic
993983057 5:94565630-94565652 TAAAATTTTGCAGCCAGGTGCGG - Intronic
994103072 5:95915388-95915410 AAGATTTTATCAGCCAGGTGCGG - Intronic
994371261 5:98970352-98970374 GAAATTTGATTGGCCAGGTGTGG + Intergenic
994579289 5:101618135-101618157 AAAAATGTCTGGGCCAGGTGCGG - Intergenic
995044240 5:107626427-107626449 TTAAATTAATTAGCCAGGTGTGG - Intronic
995261387 5:110108089-110108111 AAAAATACATTAGCCAGGTGTGG + Intergenic
995722915 5:115155190-115155212 AAAAAATAATTAGCCAGGTGTGG + Intronic
996554090 5:124759680-124759702 GAAAATGAATGAGCCAGATGTGG - Intergenic
996609891 5:125366081-125366103 GAAGATCAATGAGCCATGTGGGG - Intergenic
996705581 5:126494643-126494665 AAAAATAAATTAGCCAGGTGTGG + Intronic
996730488 5:126712948-126712970 CAAAAAATATTAGCCAGGTGTGG - Intergenic
997033813 5:130162688-130162710 AAAAAGATATGAGCCAGGTGTGG - Intronic
997292258 5:132746623-132746645 TATAACTTAGGAGCCAGGTGTGG + Intergenic
997959794 5:138311437-138311459 AAAAATAAATTAGCCAGGTGTGG + Intronic
998109709 5:139491915-139491937 AAAAAATTTTGAGCCAGGCGCGG + Intergenic
998441630 5:142167532-142167554 AAAAATGCATTAGCCAGGTGTGG + Intergenic
998843159 5:146277821-146277843 GAAAAATTATTGGCCAGGCGCGG - Intronic
999289849 5:150417218-150417240 AAAATTTAATTAGCCAGGTGTGG + Intergenic
1000228916 5:159297104-159297126 AGAGGTTTATGAGCCAGGTGCGG + Intergenic
1000500731 5:162046036-162046058 AAAAATATATTGGCCAGGTGTGG + Intergenic
1000549765 5:162646477-162646499 GAAAATTCATGATTCATGTGAGG - Intergenic
1001141387 5:169146762-169146784 GCAAATATATGTGCAAGGTGAGG - Intronic
1001265689 5:170272900-170272922 GAAAATATTTGAACCGGGTGCGG - Intronic
1001404501 5:171466373-171466395 GAAAATGTTGTAGCCAGGTGCGG - Intergenic
1001816638 5:174674775-174674797 AACAATTTATCAGCCAGGTGCGG + Intergenic
1001885474 5:175286549-175286571 AAAAAATAATTAGCCAGGTGTGG + Intergenic
1002503604 5:179663863-179663885 GAAAATATTTGATCCAGTTGGGG + Intergenic
1002943651 6:1740264-1740286 TAAAATTTTTGGGCCAGGTGCGG + Intronic
1003052134 6:2789595-2789617 CACAAGTTATGGGCCAGGTGCGG + Intergenic
1003092527 6:3116056-3116078 TAAAAAATATTAGCCAGGTGTGG + Intergenic
1003397952 6:5769616-5769638 GAAAAAGAAAGAGCCAGGTGGGG + Intronic
1003624966 6:7733052-7733074 AAAAAAATATTAGCCAGGTGTGG - Intronic
1003635667 6:7829332-7829354 GAAAATTTATTGGCCAGGTAAGG + Intronic
1004100751 6:12608193-12608215 GACATTTTATTGGCCAGGTGCGG - Intergenic
1004407762 6:15350360-15350382 GAAACTGAGTGAGCCAGGTGAGG - Intronic
1004695870 6:18032592-18032614 AAAAACTTCTTAGCCAGGTGTGG + Intergenic
1004696661 6:18040508-18040530 AAAAACTTGTTAGCCAGGTGCGG + Intergenic
1004964456 6:20832498-20832520 GAAAATAAATTAGCCAGGTTTGG + Intronic
1005004798 6:21277010-21277032 AAAATTTTTTTAGCCAGGTGTGG - Intergenic
1005353107 6:24955851-24955873 AAAAAAATATTAGCCAGGTGTGG + Intronic
1005723736 6:28628437-28628459 AAAAATTTATTGGCCTGGTGTGG - Intergenic
1005906951 6:30270061-30270083 GAAACTTTCTGGGCCAGGTGCGG + Intergenic
1006076607 6:31536962-31536984 AAAAATAAAGGAGCCAGGTGTGG + Intronic
1006126628 6:31842884-31842906 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1006130567 6:31866600-31866622 AAAAATTTATGAGGCGGGTGCGG + Intronic
1006351870 6:33526673-33526695 AAAAAATAATTAGCCAGGTGTGG + Intergenic
1006473177 6:34239397-34239419 AATGATTTATGGGCCAGGTGAGG - Intronic
1006477640 6:34267994-34268016 AAAATTTTTTTAGCCAGGTGTGG + Intergenic
1006633311 6:35444856-35444878 CAAAAAAAATGAGCCAGGTGTGG - Intergenic
1006875147 6:37289042-37289064 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1006995038 6:38251607-38251629 AAAAATATTTCAGCCAGGTGCGG + Intronic
1007298341 6:40845996-40846018 CCAAATATATGAACCAGGTGAGG - Intergenic
1007623339 6:43228297-43228319 GAAAAATTTTGAGCCAGGCATGG + Intronic
1007676684 6:43601630-43601652 AAAAAAAAATGAGCCAGGTGTGG + Intronic
1007689642 6:43691713-43691735 TGAAATTTATTGGCCAGGTGTGG - Intergenic
1008457762 6:51731074-51731096 CAAAAAGTATTAGCCAGGTGTGG - Intronic
1008615253 6:53220074-53220096 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1009414249 6:63397623-63397645 AAAAGATTATGGGCCAGGTGTGG + Intergenic
1009586634 6:65615642-65615664 AAAAAGTTCTCAGCCAGGTGCGG + Intronic
1009590574 6:65664158-65664180 AAAAATTTATGGGCCGGGCGCGG - Intronic
1009953919 6:70429220-70429242 GAATAATTAGGGGCCAGGTGTGG + Intronic
1010118482 6:72343599-72343621 GAAAAAGAATGAGCCAGGTGTGG - Intronic
1010680415 6:78792626-78792648 AAAAAAATATCAGCCAGGTGTGG + Intergenic
1010914170 6:81595231-81595253 GTAAATATATTAGCCAGGAGTGG - Intronic
1011073651 6:83413953-83413975 GAAAATAAATTAGCCAGGTATGG + Intronic
1011144268 6:84194740-84194762 GAAATTTTTTCAGCCAGGCGAGG - Intronic
1011452376 6:87507830-87507852 CAAAATTTATTATCCAGTTGGGG + Intronic
1011538290 6:88402131-88402153 AAAAATAAAGGAGCCAGGTGTGG - Intergenic
1011594075 6:88999203-88999225 CAAAAAGTATTAGCCAGGTGTGG - Intergenic
1012274532 6:97256789-97256811 AAAAATAAATTAGCCAGGTGTGG + Intronic
1012447857 6:99324889-99324911 AAAAATTCAGAAGCCAGGTGTGG + Intronic
1012475277 6:99609728-99609750 AAAAAATAATTAGCCAGGTGCGG + Intronic
1012631757 6:101478667-101478689 AAAAAAATATTAGCCAGGTGTGG - Intronic
1012642615 6:101638829-101638851 AAAAATTAATTAGCTAGGTGTGG + Intronic
1012698409 6:102419709-102419731 GAATATGTATGAGCCAGGTACGG + Intergenic
1012918950 6:105201032-105201054 GTGAATTCAGGAGCCAGGTGAGG - Intergenic
1013060022 6:106624624-106624646 AAAAAGATATGGGCCAGGTGTGG - Intronic
1013453760 6:110311049-110311071 GAACAGTTTTGAGCTAGGTGGGG - Intronic
1013481969 6:110560894-110560916 AAAGATCTCTGAGCCAGGTGCGG + Intergenic
1013483622 6:110574309-110574331 GAAAATTTACTGGCCAGGCGTGG - Intergenic
1013493075 6:110669321-110669343 CAAAATTTATTAGTCAGGTGTGG + Intronic
1013526319 6:110977419-110977441 AAAAAATTCTTAGCCAGGTGCGG + Intergenic
1013534176 6:111048257-111048279 AAAAAGTTCTGGGCCAGGTGCGG - Intergenic
1013591543 6:111623104-111623126 AAAGATTTGTTAGCCAGGTGTGG - Intergenic
1013771056 6:113628875-113628897 AAAAATATATTAGCCAGGTGTGG - Intergenic
1013978927 6:116107035-116107057 AAAAAATAATTAGCCAGGTGAGG + Intronic
1014248845 6:119095712-119095734 TAAAAATAATTAGCCAGGTGTGG - Intronic
1014292898 6:119580857-119580879 TAAAAATAATTAGCCAGGTGTGG + Intergenic
1014636535 6:123854061-123854083 GAAAATTTATCGGGCGGGTGTGG - Intronic
1014689774 6:124549210-124549232 CAAAATAAATTAGCCAGGTGTGG + Intronic
1014893064 6:126866638-126866660 AAAAACTTATCAGCCAGGCGCGG + Intergenic
1015017189 6:128427800-128427822 CAAAATGTTTGGGCCAGGTGCGG + Intronic
1015309376 6:131749191-131749213 GAAATTTTATTAGCCGGGTGTGG - Intergenic
1015388423 6:132652593-132652615 AATAATGTCTGAGCCAGGTGCGG - Intergenic
1015664272 6:135610067-135610089 AAAAATTTTTGGGCCATGTGCGG + Intergenic
1015727481 6:136314398-136314420 GATAATTTATAGGCCAGGTATGG + Intergenic
1015761079 6:136661674-136661696 GAAATTTAATTAGCCAGTTGTGG - Intronic
1015918673 6:138245009-138245031 GAATAATTATAAGCCAGGCGCGG + Intronic
1016481155 6:144483596-144483618 TAAAAATAATTAGCCAGGTGTGG - Intronic
1016508546 6:144813476-144813498 GAAAAACTCTGGGCCAGGTGTGG - Intronic
1016714871 6:147213407-147213429 AAAATTATGTGAGCCAGGTGAGG - Intronic
1016932275 6:149423047-149423069 AAAATTTAATCAGCCAGGTGTGG + Intergenic
1016971503 6:149768380-149768402 TAAAAATTAGGGGCCAGGTGCGG - Intronic
1016977331 6:149822185-149822207 AAAAAATTATTAGCCAGTTGTGG + Intronic
1017002923 6:150008359-150008381 TAAAAATAATTAGCCAGGTGTGG - Intergenic
1017171667 6:151461332-151461354 GCACATTTATGACCCAGTTGGGG + Intronic
1017245748 6:152222878-152222900 GAATATTTATCAGACAGGTTTGG + Intronic
1017522003 6:155210625-155210647 GAAATAATATGGGCCAGGTGTGG - Intronic
1017679145 6:156846308-156846330 AAAAAAATATTAGCCAGGTGTGG - Intronic
1017848620 6:158282849-158282871 GAAAATCTATGGGCTGGGTGCGG + Intronic
1018266078 6:162025738-162025760 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1018361471 6:163074833-163074855 AAAAATTAATTAGCCAGATGTGG + Intronic
1018405885 6:163482027-163482049 AAAAAATAATTAGCCAGGTGTGG + Intronic
1018803851 6:167243534-167243556 AAAAAATTATTAGCCAGGCGTGG - Intergenic
1019586517 7:1807326-1807348 AAAAATGTGTGGGCCAGGTGCGG + Intergenic
1019768128 7:2866255-2866277 AAAAATTAATGAGTCAGGTGTGG - Intergenic
1019832483 7:3346644-3346666 GAAACTAAATTAGCCAGGTGTGG - Intronic
1020239051 7:6378253-6378275 GAAAATATGTCTGCCAGGTGCGG + Intronic
1020246352 7:6432502-6432524 GAAAAAAAATTAGCCAGGTGTGG + Intronic
1020406550 7:7841592-7841614 GATAATTTGTGAGCCAGGTGTGG - Intronic
1020721689 7:11752768-11752790 AAAATTCTATTAGCCAGGTGTGG + Intronic
1020805902 7:12790148-12790170 TAAAATTTTTGGGCCGGGTGTGG - Intergenic
1021104219 7:16618081-16618103 CAAAATAGATTAGCCAGGTGTGG - Intronic
1021504715 7:21369013-21369035 AAAAAAATATTAGCCAGGTGTGG + Intergenic
1021700426 7:23314336-23314358 CAAAAATAATTAGCCAGGTGTGG - Intronic
1021707498 7:23382088-23382110 AAAAATAAATTAGCCAGGTGTGG + Intronic
1022068121 7:26882354-26882376 AAATATTTCTTAGCCAGGTGTGG - Intronic
1022157194 7:27672371-27672393 TAAAATAAATTAGCCAGGTGTGG + Intergenic
1022165818 7:27760682-27760704 AAAAATTTTTCAGCCAGGTGCGG - Intronic
1022309564 7:29183665-29183687 AAAAAATTCTGGGCCAGGTGTGG - Intronic
1022394711 7:29976609-29976631 GAAAATTAAAGAGCCACATGTGG + Intronic
1022736027 7:33076983-33077005 TAAAAATGATTAGCCAGGTGTGG - Intergenic
1023158445 7:37274839-37274861 GATTATTTCTGGGCCAGGTGTGG - Intronic
1023317728 7:38957474-38957496 AAAAAATTATTAGCCAGTTGTGG + Intergenic
1023627201 7:42127854-42127876 ACAAAATTATTAGCCAGGTGTGG + Intronic
1023718465 7:43068243-43068265 AAATATTTTAGAGCCAGGTGTGG - Intergenic
1023752018 7:43381812-43381834 AAAAAATTATCAGCCAGGTGTGG - Intronic
1024925186 7:54605128-54605150 GAAAATTTCCAGGCCAGGTGCGG + Intergenic
1025046854 7:55699611-55699633 AAAAATTTATTACCTAGGTGTGG - Intergenic
1025081913 7:55990941-55990963 CAAAACATATTAGCCAGGTGTGG - Intronic
1025096390 7:56098806-56098828 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1025215518 7:57052806-57052828 AAAAAATAATTAGCCAGGTGTGG - Intergenic
1025261336 7:57420309-57420331 GGAAAATTATAGGCCAGGTGCGG - Intergenic
1025501278 7:61302490-61302512 GGAAATTTTTGAGCCAATTGAGG - Intergenic
1025516138 7:61648713-61648735 GGAAATTTTTGAGCCAATTGAGG - Intergenic
1025534844 7:61934928-61934950 GAACATTTATGAGCCTTTTGTGG + Intergenic
1025540475 7:62077539-62077561 GGAAATTTTTGAGCCAATTGAGG - Intergenic
1025626269 7:63225231-63225253 AAAAAATAATTAGCCAGGTGTGG - Intergenic
1025641133 7:63370754-63370776 GAAAATTGATGAAATAGGTGGGG + Intergenic
1025656329 7:63523167-63523189 AAAAAAATATGAGCGAGGTGTGG - Intergenic
1025696059 7:63775072-63775094 GGAAAGAGATGAGCCAGGTGAGG - Intergenic
1026131505 7:67625021-67625043 AAAAGATTATTAGCCAGGTGTGG + Intergenic
1026174244 7:67981971-67981993 CAAAAATAATTAGCCAGGTGTGG - Intergenic
1026182008 7:68049904-68049926 AAAAAGTTTTGGGCCAGGTGCGG + Intergenic
1026199769 7:68204647-68204669 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1026210837 7:68303429-68303451 AAAAAAATATTAGCCAGGTGTGG - Intergenic
1026243111 7:68594452-68594474 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1026497429 7:70915347-70915369 GAATATCAATAAGCCAGGTGTGG + Intergenic
1026552270 7:71378844-71378866 AAAAATAAATTAGCCAGGTGTGG + Intronic
1026705464 7:72687895-72687917 AAAAATTTTTTAGCCAGGTGTGG + Intronic
1026836029 7:73639907-73639929 GAAAAATAATTAGCCAGGTGTGG + Intergenic
1026892262 7:73989194-73989216 AAAAATTTAAAAGCCAGGCGTGG + Intergenic
1026995316 7:74612129-74612151 AAAAATAAATGAGCCAGGCGTGG + Intergenic
1027176963 7:75910465-75910487 AAAAATAAATTAGCCAGGTGTGG + Intronic
1027204536 7:76087047-76087069 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1027214056 7:76172900-76172922 TAAAAATAATTAGCCAGGTGTGG + Intergenic
1027287409 7:76661368-76661390 GGAAATTTATGACACAGGTCTGG - Intergenic
1027384334 7:77645597-77645619 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1027652928 7:80893233-80893255 GACAGTTCATGAGCCAGGTTAGG + Intronic
1028168759 7:87569841-87569863 TAATATATATGTGCCAGGTGTGG - Intronic
1028197915 7:87928316-87928338 AAAAAATTATCAGCCAGGCGTGG + Intergenic
1028598456 7:92573308-92573330 GAAAACAAATTAGCCAGGTGTGG - Intronic
1028767341 7:94574678-94574700 AAAAATTCCTGAGCCGGGTGTGG + Intergenic
1029052948 7:97708674-97708696 GAAAAGTCATGAGCCAGGGCAGG + Intergenic
1029089928 7:98040223-98040245 GAACCTTTATCAGCCAGGTGTGG + Intergenic
1029265324 7:99334835-99334857 AAAAAAATATTAGCCAGGTGTGG - Intronic
1029287250 7:99474302-99474324 GAAAGTTTACGAGCCGGGCGCGG + Intronic
1029293935 7:99524362-99524384 CAAAAATTATCAGCCGGGTGTGG - Intronic
1029332111 7:99867021-99867043 GAGCATTTATGAGCCATGGGAGG - Intergenic
1029383126 7:100226241-100226263 AAAAATAAATGAGCCAGGCGTGG + Intronic
1029407506 7:100384549-100384571 GAAAAAAAATTAGCCAGGTGTGG - Intronic
1029621209 7:101690913-101690935 AAAAAAAAATGAGCCAGGTGTGG - Intergenic
1030456864 7:109785719-109785741 AAAAATTAAAAAGCCAGGTGTGG - Intergenic
1030731376 7:112993638-112993660 AAGAATATATGGGCCAGGTGCGG + Intergenic
1031091425 7:117359928-117359950 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1031098309 7:117447665-117447687 GAAAATATATAAGCCAGGCACGG - Intergenic
1031552297 7:123130042-123130064 GCAAATGTATGAGACAGTTGGGG + Intronic
1031783521 7:125999398-125999420 GATTTTTTATTAGCCAGGTGTGG - Intergenic
1031917584 7:127577653-127577675 TAAAATGTATGGGCCAGGTGTGG + Intergenic
1031928701 7:127663044-127663066 AAAAATTTATTAGCCGGGTGTGG - Intronic
1031952056 7:127902867-127902889 TAAAATAAATCAGCCAGGTGTGG - Intronic
1032032440 7:128495603-128495625 CAAAAAATATTAGCCAGGTGTGG - Intronic
1032101746 7:128985302-128985324 AAAAAGTTTTCAGCCAGGTGTGG + Intronic
1032123988 7:129177949-129177971 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1032183311 7:129700625-129700647 GAATATATATGGGCCAGATGTGG + Intronic
1032213402 7:129937034-129937056 TACAATTTATGGGCCAGGTGTGG + Intronic
1032222560 7:130005770-130005792 GGAAAATTTTGGGCCAGGTGCGG - Intergenic
1032259924 7:130327221-130327243 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1032567433 7:132961124-132961146 AAAAATAAATTAGCCAGGTGTGG + Intronic
1032658075 7:133953447-133953469 AAAAATTAATTAGCCAGGTGTGG + Intronic
1032710629 7:134457842-134457864 GAAAAAAGATTAGCCAGGTGTGG + Intronic
1032750864 7:134839843-134839865 AAAAATAAATCAGCCAGGTGTGG - Intronic
1033058363 7:138080908-138080930 AAAAAATTAGGGGCCAGGTGTGG - Intronic
1033184793 7:139217795-139217817 GAAAAAAAAAGAGCCAGGTGCGG - Intergenic
1033263958 7:139868637-139868659 AAAAAAATATTAGCCAGGTGTGG - Intronic
1033317884 7:140313435-140313457 AAAAAATTCTGAGCCAGGCGTGG + Intronic
1033420241 7:141199021-141199043 GAAAATACATGAGCGAAGTGGGG + Intronic
1034141511 7:148822784-148822806 ATAAAAATATGAGCCAGGTGAGG + Intronic
1034177790 7:149113839-149113861 TAAAATTTTTGGGCCAGGTGCGG - Intronic
1034384208 7:150725102-150725124 AAAAAATAATGAGCCGGGTGTGG + Intronic
1034389722 7:150776141-150776163 GAGAACATATGGGCCAGGTGCGG - Intergenic
1034442726 7:151095027-151095049 TAAAAATTATTAGCCAGATGTGG - Intronic
1034574710 7:151987015-151987037 GAGAATTTTGGGGCCAGGTGTGG - Intronic
1034611659 7:152375970-152375992 AAAAATAAATCAGCCAGGTGTGG - Intronic
1034683868 7:152952517-152952539 GAAAAATAATGAGGCAAGTGGGG + Intergenic
1035194668 7:157206746-157206768 TTAAATTAATTAGCCAGGTGTGG - Intronic
1035463554 7:159061495-159061517 GAAAAATAATTAGCCGGGTGTGG + Intronic
1035876392 8:3194611-3194633 AAAAAATTATTAGCCAAGTGTGG - Intronic
1036451967 8:8876665-8876687 AAAAACTTATAGGCCAGGTGTGG - Intronic
1036458631 8:8931735-8931757 CAAAAATAATTAGCCAGGTGTGG + Intergenic
1036486097 8:9180197-9180219 GAATATTTAATAGCCAGGCGTGG - Intergenic
1036985001 8:13519416-13519438 GAAAACACATGAGCCAGGAGCGG - Intergenic
1037007220 8:13797424-13797446 GAATAGTTATGGGCCGGGTGCGG + Intergenic
1037476205 8:19260305-19260327 GAGAAACTATCAGCCAGGTGTGG + Intergenic
1037531484 8:19779076-19779098 AAAAAATTATTAGCCAGGTGTGG + Intergenic
1037546377 8:19928006-19928028 AAAATTTAATGAGCCAGGTGTGG + Intronic
1037840536 8:22242167-22242189 GAACTTTTATTGGCCAGGTGTGG - Intergenic
1038824351 8:30984656-30984678 AAAGATTGATTAGCCAGGTGTGG - Intergenic
1038874939 8:31538266-31538288 ACAAATTTGTCAGCCAGGTGTGG - Intergenic
1039963654 8:42268855-42268877 AAATATTTATTGGCCAGGTGAGG - Intergenic
1040068903 8:43173280-43173302 GAAAACTCATAGGCCAGGTGTGG - Intronic
1040281553 8:46053030-46053052 GAACATTTCAGAGCCAGCTGAGG + Intergenic
1040410695 8:47151628-47151650 AAAAAAGTATTAGCCAGGTGTGG - Intergenic
1040419682 8:47227174-47227196 GAAAGTTTATGGGCCAGGCGTGG + Intergenic
1040518280 8:48152423-48152445 AAAAATTTATTAGCTGGGTGTGG + Intergenic
1040528278 8:48243608-48243630 TAAAATTTATGAGCAAGAGGGGG - Intergenic
1040665097 8:49621977-49621999 AAAAGTTTATAGGCCAGGTGCGG - Intergenic
1040973370 8:53162499-53162521 GAAGATTAATTGGCCAGGTGAGG + Intergenic
1041192666 8:55369205-55369227 GAAAAGAAATTAGCCAGGTGTGG + Intronic
1041969235 8:63718192-63718214 GAAGTTTTATGAGCCAGGCTTGG - Intergenic
1042237482 8:66627341-66627363 AAAAATAAATTAGCCAGGTGAGG + Intergenic
1042256466 8:66809151-66809173 AATAAATTATGAGCCAGGAGTGG - Intronic
1042279530 8:67041054-67041076 CAAAAATCATGAGCCAGGAGCGG - Intronic
1042339528 8:67664524-67664546 GGTTATTCATGAGCCAGGTGTGG - Intronic
1042414785 8:68506868-68506890 GAAAACTTATCATCCATGTGAGG - Intronic
1042763832 8:72299455-72299477 AAAAATTAATTAGCCAGATGTGG - Intergenic
1042967874 8:74375035-74375057 GAAAAATATTGGGCCAGGTGTGG + Intronic
1043657370 8:82686357-82686379 AAAAATTAATTAGCCAGCTGTGG + Intergenic
1043918398 8:85951684-85951706 GAAAAAATATGAGCAAGGGGAGG + Intergenic
1044171145 8:89053361-89053383 GAAAGTTTGAGAGACAGGTGAGG + Intergenic
1044417599 8:91953836-91953858 AAAAATAAATCAGCCAGGTGTGG + Intergenic
1044547824 8:93479221-93479243 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1044708881 8:95036211-95036233 GAATATTTCTAAGCCATGTGTGG - Intronic
1044773056 8:95657904-95657926 AAAAATCTACGAGACAGGTGGGG + Intergenic
1044845802 8:96379785-96379807 AAATATTTTTGGGCCAGGTGCGG - Intergenic
1044970528 8:97615250-97615272 AAAAATGCATGTGCCAGGTGTGG + Intergenic
1045037002 8:98183748-98183770 AAAAATTAATTAGCCAGGTATGG - Intergenic
1045179630 8:99766233-99766255 AAAAATTAGTTAGCCAGGTGTGG - Intronic
1045194393 8:99915494-99915516 AAAAAATTATGGACCAGGTGTGG - Intergenic
1045241739 8:100408650-100408672 AAAAATAAATTAGCCAGGTGTGG - Intronic
1045600613 8:103711602-103711624 GAAAATATATCAGGCAGGTGCGG + Intronic
1045601423 8:103722077-103722099 GAACACTTATTGGCCAGGTGTGG + Intronic
1046281326 8:112035950-112035972 TAAAAATTATTTGCCAGGTGTGG - Intergenic
1046447884 8:114346961-114346983 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1046662270 8:116961137-116961159 AAAGATTTATGGGCCAGGCGCGG + Intronic
1046944485 8:119961948-119961970 AAAGTTTTATGGGCCAGGTGTGG + Intronic
1047112768 8:121809286-121809308 AAAAATGTAAAAGCCAGGTGTGG - Intergenic
1047240247 8:123080823-123080845 GAAAAGCTCTCAGCCAGGTGCGG - Intronic
1047355875 8:124121100-124121122 AAAAATATATTAGCCAGGTGTGG - Intergenic
1047477095 8:125243130-125243152 GAAAATGTATGATGCAGTTGAGG + Intronic
1047671176 8:127149142-127149164 AAAAATTTCCCAGCCAGGTGTGG + Intergenic
1049226801 8:141457005-141457027 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1050043028 9:1515342-1515364 GAATACTTATGTGCCAGGTATGG - Intergenic
1050180574 9:2918134-2918156 GAAAATTTGTGGGCCAGCTTGGG - Intergenic
1050266098 9:3891544-3891566 AAAAATAAATTAGCCAGGTGTGG + Intronic
1050583515 9:7085863-7085885 AAAAATTATTGGGCCAGGTGCGG + Intergenic
1050698506 9:8307926-8307948 AAAAAAATATTAGCCAGGTGTGG + Intergenic
1051296823 9:15605185-15605207 ATAAAATTATAAGCCAGGTGTGG - Intronic
1051354891 9:16232390-16232412 AAAAATTAATTAGCCTGGTGTGG + Intronic
1051442607 9:17101823-17101845 AAAAATAAATCAGCCAGGTGTGG - Intergenic
1051659784 9:19415198-19415220 GAAACTGTTTGGGCCAGGTGTGG + Intronic
1051689025 9:19689674-19689696 GAAAATATCAGATCCAGGTGAGG - Intronic
1051902438 9:22058036-22058058 GAAAAAAAATTAGCCAGGTGTGG + Intergenic
1052419540 9:28224352-28224374 AAAAAATTCTGGGCCAGGTGCGG - Intronic
1053459411 9:38257122-38257144 AAAAAAAAATGAGCCAGGTGTGG - Intergenic
1053629454 9:39919270-39919292 GAAAAATTATAAGCCAGTTTGGG + Intergenic
1053776314 9:41544280-41544302 GAAAAATTATAAGCCAGTTTGGG - Intergenic
1054214433 9:62331432-62331454 GAAAAATTATAAGCCAGTTTGGG - Intergenic
1054365420 9:64334207-64334229 GAAAAATTATAAGCCAGTTTGGG + Intergenic
1054673048 9:67823922-67823944 GAAAAATTATAAGCCAGTTTGGG + Intergenic
1054928128 9:70608682-70608704 AAAAATTAATTAGCCAGGTGTGG + Intronic
1055057635 9:72038403-72038425 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1055362970 9:75514524-75514546 GAAAATTAGTTAGCCAGATGTGG - Intergenic
1055391986 9:75832898-75832920 AGAAATTTATGGGCCAGGTGCGG + Intergenic
1055438324 9:76314790-76314812 AAAAAAATATAAGCCAGGTGTGG - Intronic
1055480233 9:76702346-76702368 GAAAAGATATCGGCCAGGTGCGG - Intronic
1055509368 9:76980181-76980203 AAACATTTATTGGCCAGGTGCGG - Intergenic
1055590173 9:77804372-77804394 TAAATTTTATAAGCCAGGTGTGG + Intronic
1055753765 9:79535084-79535106 GAGGTTTTATGAGCCAGGTTTGG - Intergenic
1056173744 9:84013896-84013918 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1056214597 9:84395291-84395313 GAAAAAGTTTGGGCCAGGTGTGG - Intergenic
1056364296 9:85888061-85888083 AAAATATTATCAGCCAGGTGCGG + Intergenic
1057118805 9:92551491-92551513 TAAAATAAATTAGCCAGGTGTGG - Intronic
1057188647 9:93073400-93073422 GAAAAATAATTAGCCAGGTGTGG - Intronic
1057471214 9:95358343-95358365 GAAAATTCCTGGGCCGGGTGCGG - Intergenic
1059095434 9:111408343-111408365 TAAAATTTTTGAGCAAAGTGCGG - Intronic
1059100500 9:111466898-111466920 GAAAATAAATGAGCTGGGTGTGG - Intronic
1059118786 9:111622669-111622691 GTTAATATCTGAGCCAGGTGTGG - Intergenic
1059142256 9:111864550-111864572 AAAAAATTATTAGCCATGTGTGG + Intergenic
1059146881 9:111907778-111907800 AAAAAATAATTAGCCAGGTGTGG - Intronic
1059148141 9:111920652-111920674 AAAAATTTGTGGGCCAGGCGTGG - Intronic
1059334090 9:113557770-113557792 GAAAGTTTCTGAGGCAGGGGAGG + Intronic
1060233950 9:121848049-121848071 AAAAATAAATTAGCCAGGTGTGG + Intronic
1060305123 9:122404802-122404824 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1060357868 9:122927475-122927497 GCACTTTTATGAGACAGGTGAGG - Intronic
1060805607 9:126574106-126574128 TAAAATATATTGGCCAGGTGCGG - Intergenic
1061004819 9:127922536-127922558 AAAAATTAACTAGCCAGGTGTGG + Intronic
1061098572 9:128474503-128474525 AAAAATTAGTCAGCCAGGTGTGG + Intronic
1061271258 9:129544646-129544668 AAAAAAAAATGAGCCAGGTGTGG + Intergenic
1061524473 9:131147276-131147298 AAAATTTTAGGAGCCAGGTATGG - Intronic
1062305515 9:135904582-135904604 AAAAGTTTTTAAGCCAGGTGTGG - Intronic
1062318729 9:135980275-135980297 CAAAAAATATTAGCCAGGTGTGG - Intergenic
1062431061 9:136527065-136527087 AGAAAGTTTTGAGCCAGGTGTGG + Intronic
1062673741 9:137727270-137727292 TAAAATTTCTGGGCCAGGTGTGG - Intronic
1203782028 EBV:106012-106034 GAAAATTCTTGAGCCGGCTGGGG - Intergenic
1185780109 X:2836517-2836539 AAAAATAAATTAGCCAGGTGTGG + Intronic
1185794956 X:2956929-2956951 AAAAATTAATGTGCCAGGCGTGG + Intronic
1186085487 X:5985414-5985436 AAAAATAAATTAGCCAGGTGTGG - Intronic
1186895133 X:13997740-13997762 CAAAAATTATTAGCCAGGTGTGG + Intergenic
1187153542 X:16703315-16703337 AAAAAATTCTGAGCTAGGTGCGG - Intronic
1187698669 X:21944546-21944568 GAAAAAAAATTAGCCAGGTGTGG + Intronic
1187721685 X:22157199-22157221 GGAAATAAATGAGCCGGGTGTGG + Intronic
1187786545 X:22894337-22894359 CAAAAATTATGAGGGAGGTGAGG - Intergenic
1187911844 X:24118544-24118566 GAAATATTATGGGCCGGGTGTGG - Intergenic
1187918099 X:24174681-24174703 GAAAATTTTAGGGCCAGGTGCGG - Intronic
1188073719 X:25749442-25749464 CAAAAAATATTAGCCAGGTGTGG + Intergenic
1188119524 X:26287120-26287142 GAAACTTGCTGAGCCAGGTGCGG + Intergenic
1188532044 X:31152687-31152709 TAAAATATATTAGCCAGGAGTGG - Intronic
1188594468 X:31881260-31881282 GAAAATAAATGGGCCAGGCGCGG + Intronic
1188905265 X:35783897-35783919 CAAAAAATATTAGCCAGGTGTGG - Intergenic
1189216631 X:39330751-39330773 CAAAATTAATTAGCCAGGTGTGG + Intergenic
1189656961 X:43254637-43254659 GAAAATAAATGGGCCGGGTGTGG + Intergenic
1189741449 X:44121162-44121184 AAGAATATAGGAGCCAGGTGCGG + Intergenic
1190195353 X:48313367-48313389 AAAAATTAATTAGCCAGGGGTGG - Intergenic
1190256452 X:48766458-48766480 GTAAATGTAGGGGCCAGGTGCGG + Intronic
1190419478 X:50214847-50214869 CAAAATTTGTGGGCCAGGTGTGG - Intronic
1190661801 X:52661589-52661611 AAAAATTAATTAGCCAGGGGTGG - Intronic
1190699488 X:52976153-52976175 TAAAAATTATTGGCCAGGTGCGG + Intronic
1190715550 X:53100188-53100210 GAAAATCTGTTGGCCAGGTGCGG + Intergenic
1190794399 X:53727544-53727566 AAAATTTTATTAGCCAGGCGCGG + Intergenic
1190805079 X:53827371-53827393 GAAGAATGATTAGCCAGGTGCGG - Intergenic
1191026959 X:55924223-55924245 AAAAATAAATTAGCCAGGTGTGG - Intergenic
1191078101 X:56477895-56477917 TAAAATATAAGAGCCAGGAGTGG + Intergenic
1192254656 X:69445354-69445376 GAAAATTTATTGGCCAGGCAAGG - Intergenic
1192586076 X:72319168-72319190 TAAAATATATTAGCCAGGTATGG - Intergenic
1193071684 X:77312777-77312799 AAAAGTTAATAAGCCAGGTGTGG + Intergenic
1193138431 X:77999285-77999307 GAAAATTTATGGGCCGTGTGTGG - Intronic
1195132604 X:101868573-101868595 TAAAAATTATGGGCCAGGCGTGG - Intergenic
1195149852 X:102055961-102055983 AGAAATATATTAGCCAGGTGTGG - Intergenic
1195515548 X:105771522-105771544 GAAAATTAATAAGTGAGGTGGGG + Intergenic
1195646451 X:107235976-107235998 AAAAATAAATTAGCCAGGTGTGG + Intronic
1195854861 X:109320141-109320163 GAAAAATTGTGGGCCAGGCGTGG + Intergenic
1195898287 X:109771291-109771313 AAAAAAATATTAGCCAGGTGTGG + Intergenic
1196439756 X:115707830-115707852 GAAAAAAAATTAGCCAGGTGGGG + Intergenic
1196681945 X:118478588-118478610 GAATAGTTATAAGTCAGGTGTGG - Intergenic
1196708220 X:118735827-118735849 AAAAAATAATGAGCCGGGTGTGG - Intronic
1196909945 X:120475015-120475037 AAAATGTTATGAGCCAGGTGCGG + Intergenic
1196921762 X:120592738-120592760 TAAAATTTATGGGCCGGGTGTGG + Intergenic
1197238441 X:124095215-124095237 GGAAAATTATCAGCCGGGTGCGG - Intronic
1197244300 X:124152347-124152369 CAAAAATAATTAGCCAGGTGTGG - Intronic
1197550896 X:127891524-127891546 GAAAAAAAATTAGCCAGGTGTGG - Intergenic
1197601472 X:128536174-128536196 GAAAATATGTGATCCATGTGGGG + Intergenic
1197662693 X:129191120-129191142 AAAAATAAATTAGCCAGGTGGGG + Intergenic
1197671485 X:129283222-129283244 AAAAAATTATTAGCCAGGTGTGG - Intergenic
1197764358 X:130050280-130050302 AAAAAAGTATTAGCCAGGTGTGG + Intronic
1197916099 X:131537221-131537243 AATAATTAATTAGCCAGGTGTGG + Intergenic
1198075923 X:133192892-133192914 AAAAATAAATTAGCCAGGTGTGG + Intergenic
1198109263 X:133488243-133488265 GAAAAGAGAGGAGCCAGGTGAGG - Intergenic
1198513609 X:137380379-137380401 GAAAATTTTTGAGCAAGATTTGG + Intergenic
1199566439 X:149220731-149220753 GAAACTCTTGGAGCCAGGTGTGG - Intergenic
1199773667 X:150992234-150992256 GAAATTAAATTAGCCAGGTGCGG - Intergenic
1199780500 X:151054231-151054253 AAAAAATTATAGGCCAGGTGTGG + Intergenic
1199970962 X:152860555-152860577 GAATTTTTAAAAGCCAGGTGTGG + Intronic
1200241967 X:154501201-154501223 AAAAATTAATTAGCCAGGTGTGG - Intergenic
1200475103 Y:3633085-3633107 GAGAATAGATGACCCAGGTGTGG - Intergenic
1200796416 Y:7345256-7345278 GAAAATTAATATTCCAGGTGTGG + Intergenic
1200921294 Y:8615679-8615701 GCACATTTATGAGACAGGTTTGG - Intergenic
1201250071 Y:12048472-12048494 GAAAATTTATGAGGGAGGAATGG - Intergenic
1201292681 Y:12437219-12437241 GAAAATATTTGGGCCAGGCGCGG + Intergenic
1201486047 Y:14495646-14495668 AAAAATAAATGTGCCAGGTGTGG + Intergenic
1201868291 Y:18678825-18678847 CAAAAAAAATGAGCCAGGTGTGG + Intergenic
1202094356 Y:21230338-21230360 CAAAAATAATTAGCCAGGTGTGG - Intergenic