ID: 966705274

View in Genome Browser
Species Human (GRCh38)
Location 3:182906743-182906765
Sequence ACTATGAAAATTTATGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966705274_966705276 24 Left 966705274 3:182906743-182906765 CCTGGCTCATAAATTTTCATAGT 0: 1
1: 0
2: 1
3: 18
4: 281
Right 966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924
966705274_966705278 30 Left 966705274 3:182906743-182906765 CCTGGCTCATAAATTTTCATAGT 0: 1
1: 0
2: 1
3: 18
4: 281
Right 966705278 3:182906796-182906818 AAGAAGAAGAAGGCCGGGCATGG 0: 4
1: 21
2: 124
3: 1033
4: 5222
966705274_966705275 20 Left 966705274 3:182906743-182906765 CCTGGCTCATAAATTTTCATAGT 0: 1
1: 0
2: 1
3: 18
4: 281
Right 966705275 3:182906786-182906808 AAAAAAGAAGAAGAAGAAGAAGG 0: 104
1: 407
2: 1338
3: 3905
4: 16682
966705274_966705277 25 Left 966705274 3:182906743-182906765 CCTGGCTCATAAATTTTCATAGT 0: 1
1: 0
2: 1
3: 18
4: 281
Right 966705277 3:182906791-182906813 AGAAGAAGAAGAAGAAGGCCGGG 0: 4
1: 24
2: 113
3: 928
4: 3747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966705274 Original CRISPR ACTATGAAAATTTATGAGCC AGG (reversed) Intronic
902857157 1:19216074-19216096 AGTATGACAATTTATGGGCCAGG + Exonic
905086681 1:35385970-35385992 TATAAGAAAATTTAAGAGCCAGG - Intronic
905595966 1:39207573-39207595 ACTATGAACATTCTTCAGCCAGG - Intronic
906373694 1:45276355-45276377 ACAATGAAAATTAGTGAGTCTGG + Intronic
907029313 1:51155098-51155120 AAAATGAAAATATATGGGCCGGG + Intergenic
907772115 1:57475852-57475874 TCAATGAATATTTTTGAGCCAGG - Intronic
907818234 1:57941051-57941073 ACAATGAATATTCATGAGTCTGG + Intronic
908147368 1:61260873-61260895 TCTATGAAAATTTCTTGGCCGGG - Intronic
908193508 1:61726888-61726910 ATTATGAAAATTTTAGGGCCAGG - Intergenic
908839638 1:68265917-68265939 ACCATGAAAAATAAGGAGCCAGG - Intergenic
910787814 1:91020132-91020154 ACTGTAAAACTTTATGATCCAGG + Intronic
910926797 1:92406046-92406068 ACCATGAATCTTTATGAGCTAGG - Intergenic
910995757 1:93102834-93102856 GCCATGAAATTTTATGGGCCAGG + Intronic
912375195 1:109204077-109204099 AATATAAAAATTAGTGAGCCTGG - Intronic
913400184 1:118423208-118423230 AATGTGAAAATTTATCGGCCGGG - Intergenic
915041790 1:152973938-152973960 ACTATGCAAATCTATCAGCCTGG - Intergenic
915379363 1:155426494-155426516 AATATAAAAATTAATGGGCCAGG - Intronic
916367734 1:164051959-164051981 ACATTGCAAATTTATGACCCTGG - Intergenic
917104844 1:171481796-171481818 ACTATGAAACATGATAAGCCTGG - Intergenic
917340943 1:173976877-173976899 ACAATGAAAGTTTATGAGTGTGG + Intronic
918073243 1:181149310-181149332 ACAATAAACATTTCTGAGCCTGG - Intergenic
918519993 1:185404879-185404901 ACTTTGAAGTTTTATGAGACAGG + Intergenic
919290981 1:195629984-195630006 AATATTAAAACTTATGAGCTGGG + Intergenic
919418846 1:197345801-197345823 TCTATTAAAATTTGAGAGCCAGG - Intronic
922675841 1:227548348-227548370 ACAATAAAAAATGATGAGCCAGG - Intergenic
924373723 1:243384230-243384252 ACTCTGCAAAGTGATGAGCCAGG - Intronic
1065132430 10:22635681-22635703 AGCATGGAAAGTTATGAGCCGGG + Intronic
1065369728 10:24971505-24971527 ACAATAAATACTTATGAGCCAGG - Intergenic
1065404035 10:25342814-25342836 AGTATGCAAAATCATGAGCCTGG - Intronic
1067267569 10:44758930-44758952 ACTATGAACATTTGTCATCCAGG - Intergenic
1068281170 10:54871713-54871735 ACAAAAATAATTTATGAGCCTGG - Intronic
1068744546 10:60515558-60515580 ATTATTAAAATATATGTGCCTGG + Intronic
1068864940 10:61884857-61884879 ACTATGAAAATGAAAGAGTCAGG - Intergenic
1069057815 10:63863301-63863323 ACTATGAACATTTATGTGCAAGG + Intergenic
1069382829 10:67857986-67858008 AATAGGAATATATATGAGCCGGG - Intergenic
1069972661 10:72186317-72186339 ATTCAAAAAATTTATGAGCCAGG + Intronic
1070069430 10:73072867-73072889 ACTTTTAAAATTTATCAGTCAGG + Intronic
1071037151 10:81261669-81261691 ACTCTGAAAATCTTTGTGCCAGG + Intergenic
1071797302 10:89020511-89020533 ACCAAGAAAATTAAGGAGCCTGG - Intergenic
1072509993 10:96112343-96112365 ACTGTGGAAATCTCTGAGCCTGG - Intergenic
1073609172 10:104926339-104926361 ACTATGTTAATTTATGAAGCAGG - Intronic
1075560542 10:123465131-123465153 ACTGTGAGAATTTATGCCCCAGG - Intergenic
1078592189 11:12652058-12652080 ACCATGAAAATTGAAGTGCCGGG - Intergenic
1081221373 11:40467460-40467482 ACTATGCAAATATATGTGACAGG + Intronic
1081820766 11:45992235-45992257 ACTTAGAAAATTTTTCAGCCCGG + Intronic
1083552761 11:63602699-63602721 ACAATGTAAATGTATGAGCCTGG - Intronic
1084577638 11:69999986-70000008 ATTGTGAAAGTTTCTGAGCCAGG + Intergenic
1086255313 11:84868820-84868842 ACTAGCAAAATTTATCAGCAAGG + Intronic
1087086433 11:94223481-94223503 ACTATGAGAAGTCGTGAGCCTGG - Intergenic
1087196273 11:95307289-95307311 AATAGGAAATTTTATTAGCCAGG - Intergenic
1088106460 11:106211935-106211957 ACTATGAAGAATTATTAACCAGG + Intergenic
1088940631 11:114451963-114451985 ACTATGATTAGTTATGAGGCTGG + Intergenic
1089478542 11:118787038-118787060 ACTATTAAACTTTATGGGCTGGG + Intronic
1089539108 11:119179337-119179359 ATTATGAAAAGTTTTGGGCCAGG + Intronic
1092192202 12:6529312-6529334 ACAGTGAAAATTCCTGAGCCGGG + Intronic
1092352047 12:7763542-7763564 ACTACAAAAAATTATTAGCCGGG + Intergenic
1093887381 12:24477729-24477751 ACTATTAAAATTGAAGAGCTTGG + Intergenic
1094258018 12:28457764-28457786 AAGAGGAAAATTTATGACCCTGG + Intronic
1094258020 12:28457782-28457804 AATATGAAAATCAATAAGCCAGG - Intronic
1094397411 12:30023014-30023036 CCTATGAAAATGTATATGCCTGG + Intergenic
1094534778 12:31311377-31311399 ACAATTAAAATCTATGACCCAGG - Intronic
1096865955 12:54563022-54563044 ACAATGGAGATTTCTGAGCCAGG - Intronic
1097825438 12:64170600-64170622 ATTATGAAGAATTATGAGTCAGG + Intergenic
1097829981 12:64214109-64214131 ACCATGAAAAGTTTTGAACCAGG - Intronic
1099329736 12:81268431-81268453 ACTATGAAAAATAATGCGCCGGG - Intronic
1099551172 12:84044967-84044989 ATGATTAAAATTTATGTGCCTGG + Intergenic
1100084551 12:90893331-90893353 AATAAGAAAATTGATGAGGCTGG + Intergenic
1101168124 12:102060658-102060680 ACTGTGAAATTTTAGAAGCCGGG + Intronic
1101235847 12:102789023-102789045 ACTATGTAACTATGTGAGCCCGG + Intergenic
1105666354 13:22561504-22561526 TGTATTAAAATTTAGGAGCCCGG - Intergenic
1107581750 13:41796733-41796755 AGAAAGAAAATTTGTGAGCCAGG - Intronic
1107897690 13:44982702-44982724 CATATGCAAATTTTTGAGCCAGG - Intronic
1108220717 13:48231223-48231245 ACCCTGAAAACTTAGGAGCCAGG - Intergenic
1109164729 13:59019817-59019839 ATTATAAAACTTTATGAGGCTGG - Intergenic
1109881633 13:68486091-68486113 ACTAGGAAATTTTATGAGCTTGG - Intergenic
1110306716 13:73996469-73996491 CCTGTGAAAAATAATGAGCCAGG - Intronic
1114414122 14:22528101-22528123 ACTATTAAAAATCATGAGGCCGG - Intergenic
1114938534 14:27575443-27575465 TGTACGAAAATTTATGAGTCTGG - Intergenic
1115565272 14:34619835-34619857 AGTATGGGAATTTGTGAGCCAGG - Intronic
1116206790 14:41877303-41877325 ATTTTGAAAATTTATTAGCAGGG - Intronic
1116581190 14:46643616-46643638 ACTATGAAAATTTAGGATAGTGG - Intergenic
1118124474 14:62885390-62885412 TCGATGATTATTTATGAGCCTGG - Intronic
1118409517 14:65463560-65463582 ACTAAGAAAATATATTAGCCAGG - Intronic
1119643675 14:76332310-76332332 ACTTTTAAAATTTTTGAGACAGG + Intronic
1120630495 14:86884068-86884090 ATTATGAAAACTTTTGGGCCTGG - Intergenic
1120951751 14:90047943-90047965 ACTATGAAAAAATACGAGACTGG - Intergenic
1202876448 14_KI270722v1_random:6698-6720 ACTATGAATTTTTATGAGTAGGG - Intergenic
1124017619 15:25890842-25890864 ACTCTTCAAATTTATGAGCCTGG - Intergenic
1125151292 15:36535531-36535553 ACAATGAAAAGTGCTGAGCCAGG - Intergenic
1125223715 15:37370016-37370038 ACAATGCAAATTTCTTAGCCTGG - Intergenic
1126076222 15:44912920-44912942 ACCAAGAAAATTAAGGAGCCTGG + Intergenic
1127067367 15:55254588-55254610 ACTGTGAAAAATTCTGAGACAGG + Intronic
1127123385 15:55789958-55789980 ACTCTGAAAATTCATGGGGCAGG - Intergenic
1128694414 15:69749700-69749722 ACTATGCAAATAAATAAGCCTGG + Intergenic
1130552267 15:84897510-84897532 ACTATGCACATTTATTAGGCTGG - Intronic
1130819194 15:87475884-87475906 ACTATGTAAATTTTTAAGTCAGG + Intergenic
1131794507 15:96001151-96001173 ATTAAGATAATTTATGAGGCAGG + Intergenic
1131864910 15:96697719-96697741 ACTATTCAAATAGATGAGCCTGG - Intergenic
1136100777 16:27994091-27994113 ACTAAGAAAATTAAGGAGCATGG - Intronic
1139093638 16:63678986-63679008 AATATGAATATTTAGGAGACAGG + Intergenic
1143075410 17:4338493-4338515 ACTATGAAAATGTCTGGGACTGG - Intronic
1143708911 17:8719974-8719996 AGTTTGAAAATTTATGGCCCTGG - Intergenic
1143928705 17:10397619-10397641 ACTGTGGAAAATTATTAGCCAGG + Intronic
1145073326 17:19830495-19830517 TCTTTTAAAATTTATGGGCCAGG - Intronic
1147128529 17:38390990-38391012 ATTATGAAAAAATATGGGCCAGG - Intronic
1147566796 17:41541376-41541398 ACTGTGAGAATTTGTGAGCAGGG - Intergenic
1150098257 17:62398131-62398153 ACTATTAAAGTTTATGATCTTGG - Intronic
1151544023 17:74781142-74781164 ACTATGGAAATTTGGGGGCCAGG - Intronic
1153422570 18:4924568-4924590 ACTATGAACATTTGTGTGCATGG - Intergenic
1153447446 18:5189403-5189425 AATTTGAAAAATTAAGAGCCTGG - Intronic
1154961564 18:21314766-21314788 AATATGAAAATGAATGAGCATGG + Intronic
1156345658 18:36255019-36255041 ACTACGAAAAATTATGGGCTGGG - Intronic
1156417105 18:36907855-36907877 ACTAAGAAACTCTCTGAGCCTGG + Intronic
1156617093 18:38799776-38799798 ACTAAGAAAATTAAGGAGCATGG - Intergenic
1157150350 18:45210749-45210771 ACCATTCAAATTTCTGAGCCTGG + Intergenic
1157636834 18:49165730-49165752 AGTATGAAATTTTATGATACTGG + Intronic
1157837765 18:50923454-50923476 AATATGAAAAATTCTCAGCCAGG + Intronic
1158307399 18:56121234-56121256 AGTATGAAAATTGAAGAGCAAGG - Intergenic
1158479763 18:57811230-57811252 AATATGAAAGTGAATGAGCCTGG - Intergenic
1158833506 18:61305207-61305229 GCTCTGGAAATTTATTAGCCAGG + Intergenic
1159072743 18:63644377-63644399 AATATGAAAATTTATGACAAAGG + Intronic
1159435352 18:68409659-68409681 AATATGAAAATTTTTGACCACGG + Intergenic
1160171270 18:76557530-76557552 TATATTAAAATTTTTGAGCCAGG + Intergenic
1161033164 19:2069134-2069156 AATATGTAAATGTATGAGCATGG + Intergenic
1165133638 19:33649552-33649574 ACTATGAACATTCATGAGGGGGG + Intronic
1167872870 19:52388171-52388193 ATTCTTAAAATTTATGGGCCAGG - Intergenic
1202674218 1_KI270710v1_random:26116-26138 ACTATGAATTTTTATGAGTAGGG + Intergenic
925657256 2:6163280-6163302 ACTATGATAATATCTGAGACAGG + Intergenic
928227773 2:29468320-29468342 ACTATTAAAAATTATTGGCCAGG - Intronic
928900079 2:36308282-36308304 CCTATGAAAATTCAGGTGCCAGG - Intergenic
930129023 2:47829189-47829211 ACTATAAAATTTTTTGAGGCCGG - Intronic
930750988 2:54933863-54933885 ACTATGAAATTTTCTCATCCAGG + Intronic
931180721 2:59897898-59897920 AATATGAAAATGAATGAGCCTGG + Intergenic
932228578 2:70063248-70063270 GCTGTCAAAATTTAAGAGCCAGG + Intergenic
935090143 2:99887498-99887520 ACTATGATATTTTGTGAGCACGG - Intronic
935761591 2:106325593-106325615 AATATGAAAATGTCTGGGCCAGG - Intergenic
938835519 2:135099688-135099710 CCTTTGAAACTTTCTGAGCCTGG + Intronic
939222140 2:139315831-139315853 ACTATAAAACTTTATAGGCCGGG + Intergenic
939922482 2:148133969-148133991 ATCATGAAAATTTATTTGCCAGG + Intronic
942172325 2:173300280-173300302 ACCAGGAAAATTAAGGAGCCTGG + Intergenic
943065966 2:183086509-183086531 GCTATGAAAATATATAGGCCAGG + Intronic
943335633 2:186610080-186610102 ACTAGGAAAATTAATAAGACGGG - Intronic
944807186 2:203294246-203294268 ACTATGAAAAATAATGGGCTGGG + Intronic
945526063 2:210889029-210889051 ACTAGGAAAATTTATAGGTCTGG + Intergenic
945875827 2:215277513-215277535 AATATAAACATTTATGAGCTGGG - Intergenic
945966839 2:216196960-216196982 ATTAAGAAAATTTATTATCCAGG + Intronic
947334232 2:229064964-229064986 ACTGTGAAATTTAATGAGCCTGG + Intronic
948578462 2:238968980-238969002 TCAATGAAAATTTATGTGACGGG + Intergenic
1169196704 20:3687039-3687061 AGCATGAAAATGAATGAGCCTGG + Exonic
1171116420 20:22528591-22528613 ATTATGAAAATTTTTGGGCCAGG - Intergenic
1171444265 20:25192683-25192705 AAGATTAAAATTTATGGGCCGGG + Intergenic
1173150669 20:40564107-40564129 ACTATGGAAATGAATGAGCCTGG + Intergenic
1173574828 20:44105843-44105865 ACTGTTAAAATGTATGATCCAGG - Intergenic
1176637711 21:9264068-9264090 ACTATGAATTTTTATGAGTAGGG - Intergenic
1176976672 21:15328373-15328395 ACCATGAAAATTTGGGAGACAGG - Intergenic
1177259048 21:18705002-18705024 ACTGTGAGAATATATGAGTCGGG - Intergenic
1178221380 21:30664105-30664127 GCTATGAAACTATATCAGCCTGG - Intergenic
1178779007 21:35581266-35581288 ACTCTGCAAATTCATGAGGCAGG + Intronic
1180371255 22:12039337-12039359 ACTATGAATTTTTATGAGTAGGG + Intergenic
1180421754 22:12871565-12871587 ACTATGAATTTTTATGAGTAGGG - Intergenic
1182190673 22:28456867-28456889 ATTTTAAAAATTTATGGGCCGGG - Intronic
949220933 3:1633035-1633057 ACCATGAAAATTAATGACACGGG - Intergenic
950700240 3:14739084-14739106 ATTAAGAATATTTGTGAGCCAGG - Intronic
951095367 3:18623581-18623603 TCTATTAAAATTTATGAAGCAGG + Intergenic
951640759 3:24832246-24832268 ACTGTGATATTTTATGAGCCTGG - Intergenic
951772967 3:26279342-26279364 ACTGTAAGAATTTATGAACCTGG - Intergenic
951923163 3:27877795-27877817 ACTTTAAAAATTTCTGAGGCTGG + Intergenic
953276103 3:41500255-41500277 AAGATGAAAATTAATGAGCTAGG - Intronic
955369365 3:58338044-58338066 ACTTTAAAAATTTCTTAGCCAGG + Intronic
957103164 3:75852978-75853000 ACTATGAATTTTTATGAGTAGGG + Intergenic
957857900 3:85902081-85902103 GCTATAAAAATTTAGGTGCCAGG + Intronic
958464016 3:94436315-94436337 ATTATAAAACTTTATGAACCTGG + Intergenic
960480078 3:118177216-118177238 TTTATTAAAATTTATGGGCCGGG - Intergenic
960944149 3:122954528-122954550 ACTAGGAAAAGTTTTGAGCAGGG - Intronic
961101388 3:124202109-124202131 AGTATGAAATTTTATGTGCTTGG + Intronic
961209119 3:125111726-125111748 CCAGTGATAATTTATGAGCCAGG - Intronic
962383054 3:134912355-134912377 CCTATGAAAATTTAGGAGCCTGG - Intronic
963622191 3:147624495-147624517 ACTATTAAAACTTAAGAGTCTGG + Intergenic
963858284 3:150279408-150279430 ACTATCAAATTTTTGGAGCCTGG + Intergenic
964234799 3:154512495-154512517 ACCATGAAAATATAAGACCCTGG + Intergenic
964584889 3:158286512-158286534 ACTATGAAAATTTAAGTGCTGGG + Intronic
964779345 3:160318358-160318380 ACTATAAAAATTTAGAAGCATGG - Intronic
965193405 3:165561181-165561203 ACAAAAAAAATTAATGAGCCAGG - Intergenic
965337698 3:167448432-167448454 CCTATGAAAATTTTGGAGTCTGG + Intronic
966411198 3:179647652-179647674 AATATAAAAAGTTATCAGCCGGG - Intergenic
966705274 3:182906743-182906765 ACTATGAAAATTTATGAGCCAGG - Intronic
967215637 3:187207612-187207634 GATTTGAAAATTTATCAGCCTGG - Intergenic
1202749184 3_GL000221v1_random:140953-140975 ACTATGAATTTTTATGAGTAGGG + Intergenic
970585908 4:17514034-17514056 AAAATGAGAATTTCTGAGCCTGG - Intergenic
971000029 4:22311530-22311552 ACTATGAAAACACATGAGCCTGG + Intergenic
974702813 4:65472874-65472896 ACTATGCAAATTTATGCAGCCGG + Intronic
975033246 4:69650144-69650166 ACCAAGAAAATTAATGAGCGTGG - Intronic
975382896 4:73723036-73723058 ACCATGGAAATTTATGTTCCAGG + Intergenic
975495582 4:75032576-75032598 GCTATGCAAATATATGATCCTGG - Intronic
980606820 4:135103100-135103122 ACAATTTGAATTTATGAGCCAGG + Intergenic
980776908 4:137448490-137448512 ACCATTAAAATTTATGATCTTGG - Intergenic
981617678 4:146658509-146658531 ACTATAAATATTTATGTGCTGGG + Intergenic
981803378 4:148683521-148683543 ACTAAGAAAATTTGGGGGCCAGG - Intergenic
981933617 4:150215963-150215985 ACTGTGGAAGTTAATGAGCCAGG + Intronic
983466548 4:168100386-168100408 ACTATGACAATGTGTGAGGCAGG + Intronic
983985857 4:174060166-174060188 ATAAGGAAAATCTATGAGCCTGG + Intergenic
984305027 4:177978395-177978417 AGCATGGAAATTTATCAGCCTGG + Intronic
1202752609 4_GL000008v2_random:22484-22506 ACTATGAATTTTTATGAGTAGGG - Intergenic
986487487 5:8252895-8252917 ACTTTGAAAGTTTCTGATCCTGG - Intergenic
986560861 5:9059843-9059865 AATATGAAAATAAATCAGCCGGG - Intronic
987224442 5:15824830-15824852 GCTATGAAAGTTTATGATTCAGG - Intronic
987617569 5:20296167-20296189 ATTATGAAAATTTGTCGGCCAGG - Intronic
988443785 5:31262250-31262272 ACTTTGAACATTTATTTGCCTGG - Intronic
990220708 5:53585448-53585470 ACAATGAAAATTTTTGTGCCGGG + Intronic
990957422 5:61357355-61357377 GCTATGGGAATTTAGGAGCCAGG + Intronic
991413584 5:66368880-66368902 AATATGACAATGTATGTGCCAGG + Intergenic
992698870 5:79319341-79319363 ACTTAGAAAATATATGAGCTTGG + Intronic
992742663 5:79789857-79789879 ACTATCACAAATTATGTGCCAGG - Intronic
995738657 5:115330833-115330855 AATATGCAAATTTAGAAGCCAGG + Intergenic
996532403 5:124540296-124540318 ATTATGAAAATTTATGTTACTGG + Intergenic
996570778 5:124930354-124930376 ACCATGAAAAAACATGAGCCAGG - Intergenic
997012849 5:129899412-129899434 ACTATGTAAGTTTCAGAGCCTGG - Intergenic
999516566 5:152307719-152307741 GCTATGAATATTCATGAGCAGGG + Intergenic
1001260221 5:170222189-170222211 ACTATGATAAAATATAAGCCTGG + Intergenic
1001815071 5:174661704-174661726 ATGTTGAAAATTTATGAGCAGGG + Intergenic
1002207124 5:177570680-177570702 ATTATTAAAACTTATCAGCCAGG - Intergenic
1003201687 6:3966901-3966923 ACCATTAAAATTTCTCAGCCGGG - Intergenic
1003362214 6:5438803-5438825 AATATGAAACTTTTTGAGCATGG - Intronic
1004096807 6:12563517-12563539 ACTATTAAAACTTCTGAGACAGG + Intergenic
1004474490 6:15958868-15958890 TCTCTGAAAATTTAGGGGCCAGG + Intergenic
1005868098 6:29951880-29951902 ACTATAAATATTTGTGGGCCAGG - Intergenic
1006995037 6:38251602-38251624 ACTATAAAAATATTTCAGCCAGG + Intronic
1007340705 6:41189716-41189738 ACAATGAAAATTAAGGAGCGTGG + Intergenic
1007508487 6:42356865-42356887 ACAATAGAAATTTATGGGCCGGG - Intronic
1007592057 6:43027977-43027999 ACTATGAACACCTATGTGCCTGG - Intronic
1008589749 6:52982221-52982243 AAGATGAAAATTTCTGAGCTGGG + Intronic
1008628188 6:53338029-53338051 ACGATGAAAAGTTATGAGTCTGG + Intronic
1008922839 6:56861237-56861259 TCTATGAAACTTTAAGTGCCTGG + Intronic
1009368007 6:62870599-62870621 AATATCAAAATTTAAGAGGCTGG + Intergenic
1009590575 6:65664163-65664185 TATATAAAAATTTATGGGCCGGG - Intronic
1010054082 6:71543495-71543517 GCTAGGAAAATTTGTTAGCCAGG - Intergenic
1011715939 6:90105010-90105032 AATATTAAAATTTATGAATCAGG - Intronic
1014672814 6:124328324-124328346 TATGTGAAAATTTATAAGCCAGG - Intronic
1015309377 6:131749196-131749218 AAAATGAAATTTTATTAGCCGGG - Intergenic
1016379188 6:143456361-143456383 AAAATCAGAATTTATGAGCCTGG + Intronic
1017164514 6:151394733-151394755 ACTATTAAATTTTCTGAGCTGGG - Intergenic
1019230519 6:170557436-170557458 ACTTTAAAAATTTTTCAGCCTGG + Intronic
1020406551 7:7841597-7841619 AATGTGATAATTTGTGAGCCAGG - Intronic
1021165780 7:17338649-17338671 ACTACGAGAATTTAGGGGCCAGG - Intronic
1021449635 7:20771237-20771259 ACTATTAAAAATTATTGGCCAGG - Intronic
1022145265 7:27531533-27531555 AATAAGAATATTTTTGAGCCAGG + Intronic
1022165819 7:27760687-27760709 ACTGTAAAAATTTTTCAGCCAGG - Intronic
1022403848 7:30067799-30067821 GCAAGGAAAATTAATGAGCCAGG - Intronic
1023137912 7:37071754-37071776 ACTAGCAAAATTAAAGAGCCTGG - Intronic
1023630704 7:42161310-42161332 AACATGAAAATGAATGAGCCTGG - Intronic
1026920048 7:74148816-74148838 ACCATGAAAATTAAGGAGCATGG + Intergenic
1032426674 7:131828187-131828209 GCTATGAAAATGAATGAGCATGG - Intergenic
1033076703 7:138256621-138256643 ACCATGAAAATTAAAGAGCATGG + Intergenic
1033165066 7:139032905-139032927 ACTATGAAACTATATAAGCCTGG + Intronic
1033500505 7:141944396-141944418 AGTATGAAAATTCATAATCCTGG + Intronic
1033625275 7:143105095-143105117 ACTATGAATATTTATGAAAGTGG - Intergenic
1034658921 7:152752423-152752445 GCCATGAATATTTATGAGACGGG + Intergenic
1036547815 8:9789242-9789264 ACAATTAAAATTTTTGGGCCAGG + Intergenic
1036720406 8:11169266-11169288 ACTAAGAAAATTAAGGAGCATGG - Intronic
1037252440 8:16912484-16912506 ACTAGGAAAATTTCAGGGCCAGG + Intergenic
1038077740 8:24096259-24096281 ATTATAAAAATTTATGATACAGG + Intergenic
1038892328 8:31739534-31739556 ATTATTAATATTTATGAACCTGG - Intronic
1038941206 8:32307931-32307953 TCTATGAACATTTCTGAGGCTGG - Intronic
1040545896 8:48397457-48397479 ACTCTGAAATTTTCTGACCCAGG - Intergenic
1041048721 8:53912443-53912465 AATATTAAAATTTATGTGGCAGG - Intronic
1041265643 8:56061828-56061850 ACTACAAAAATTAATGAGGCCGG + Intergenic
1043119445 8:76304252-76304274 CCTATTAAAAATTATAAGCCAGG - Intergenic
1044994543 8:97827147-97827169 GCTATGAAGAGTTAAGAGCCAGG - Intronic
1044999168 8:97865474-97865496 ACCATTAAAATTTATGATCTTGG - Intergenic
1045238142 8:100374282-100374304 ACTATGTAAATAAATGAGCATGG + Intronic
1046281327 8:112035955-112035977 ACTATTAAAAATTATTTGCCAGG - Intergenic
1046371759 8:113318186-113318208 AATATGAAAATTTATGTTTCTGG + Intronic
1047426673 8:124752765-124752787 AATATGAAAATGAATGAGCTTGG - Intergenic
1048407190 8:134135711-134135733 ACTATGAAATTTTATTTTCCTGG - Intergenic
1050258998 9:3821467-3821489 CCTCTGAAAATTGATGAGCTTGG + Intergenic
1051091259 9:13411580-13411602 ACTATTAATATTTAGGTGCCAGG - Intergenic
1058823171 9:108751577-108751599 AATATGTAAATGAATGAGCCTGG + Intergenic
1059990605 9:119861809-119861831 AATATGAAAAAGTAAGAGCCTGG + Intergenic
1060384566 9:123212879-123212901 AGTTTTAAAATTTATGAGTCTGG - Intronic
1203717820 Un_KI270742v1:171043-171065 ACTATGAATTTTTATGAGTAGGG + Intergenic
1203533398 Un_KI270743v1:7187-7209 ACTATGAATTTTTATGAGTAGGG - Intergenic
1203652044 Un_KI270751v1:134629-134651 ACTATGAATTTTTATGAGTAGGG + Intergenic
1185974332 X:4702497-4702519 AATATGAAAAGTTTTGAGCTGGG + Intergenic
1188407092 X:29825165-29825187 ACTATCAACATTAGTGAGCCGGG + Intronic
1189999843 X:46675509-46675531 GCTATGGGAGTTTATGAGCCAGG - Intronic
1190017896 X:46843968-46843990 TCTATAAAAATTTCTGAGGCTGG - Intronic
1191141134 X:57117928-57117950 ACGATGAAAATTTATGTCTCTGG - Intergenic
1191142736 X:57133651-57133673 ACGATGAAAATTTATGTCTCTGG - Intergenic
1192244789 X:69363196-69363218 AGTATGAAAATGGATGAGTCAGG + Intergenic
1194329433 X:92562541-92562563 AGTTTGAAAATTTTTCAGCCTGG - Intronic
1194521566 X:94924971-94924993 TGTATTATAATTTATGAGCCAGG - Intergenic
1194653293 X:96541670-96541692 ACTCTGACCATTTATGGGCCGGG + Intergenic
1194817388 X:98460343-98460365 CCTATGAATATTTATGACCTTGG - Intergenic
1196921761 X:120592733-120592755 AAAATTAAAATTTATGGGCCGGG + Intergenic
1197755903 X:129994598-129994620 CCTATAAACATTTATGAGACTGG - Intronic
1197888488 X:131242581-131242603 ACAAAGAAAATTTAAGAGACTGG + Intergenic
1198780895 X:140234367-140234389 ACTATAAAAATACATGAGACTGG - Intergenic
1198942253 X:141968969-141968991 ACTATGAAATCTTCAGAGCCAGG + Intergenic
1200638132 Y:5681731-5681753 AGTTTGAAAATTTTTCAGCCTGG - Intronic
1201058426 Y:10018742-10018764 CCTATGAAAGAATATGAGCCTGG + Intergenic
1201250072 Y:12048477-12048499 AGCATGAAAATTTATGAGGGAGG - Intergenic