ID: 966705276

View in Genome Browser
Species Human (GRCh38)
Location 3:182906790-182906812
Sequence AAGAAGAAGAAGAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966705274_966705276 24 Left 966705274 3:182906743-182906765 CCTGGCTCATAAATTTTCATAGT 0: 1
1: 0
2: 1
3: 18
4: 281
Right 966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924
966705272_966705276 30 Left 966705272 3:182906737-182906759 CCCACACCTGGCTCATAAATTTT 0: 1
1: 0
2: 1
3: 31
4: 277
Right 966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924
966705273_966705276 29 Left 966705273 3:182906738-182906760 CCACACCTGGCTCATAAATTTTC 0: 1
1: 0
2: 5
3: 149
4: 1268
Right 966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966705276 Original CRISPR AAGAAGAAGAAGAAGAAGGC CGG Intronic
Too many off-targets to display for this crispr