ID: 966708665

View in Genome Browser
Species Human (GRCh38)
Location 3:182947817-182947839
Sequence AAAAATGACCAGGGCCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966708658_966708665 1 Left 966708658 3:182947793-182947815 CCAAAGTTTGTATCCTCCCTCTT 0: 1
1: 0
2: 2
3: 25
4: 277
Right 966708665 3:182947817-182947839 AAAAATGACCAGGGCCTTTAGGG 0: 1
1: 0
2: 1
3: 15
4: 189
966708657_966708665 16 Left 966708657 3:182947778-182947800 CCTATACAAATGAGTCCAAAGTT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 966708665 3:182947817-182947839 AAAAATGACCAGGGCCTTTAGGG 0: 1
1: 0
2: 1
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966708665 Original CRISPR AAAAATGACCAGGGCCTTTA GGG Intronic
900597436 1:3488564-3488586 AAAAATGGCCGAGGCCTTGAAGG + Intergenic
902842945 1:19086798-19086820 ATAAATGCCCAGGACCTTTGTGG + Exonic
905341814 1:37283380-37283402 CATATTGACCTGGGCCTTTAGGG + Intergenic
909248779 1:73326034-73326056 AAAAATGAACAAAGCCTTCAAGG - Intergenic
911086899 1:93986155-93986177 AAAAAGAACCAGGGCCCTTGGGG + Intergenic
912939336 1:114031186-114031208 AAACAAGAGCAGGGCATTTATGG - Intergenic
912969626 1:114268694-114268716 GAAACTGACCATGTCCTTTACGG + Intergenic
913253910 1:116937237-116937259 AAAAACGGCCAGGTCCTGTAAGG + Intronic
913344050 1:117790109-117790131 AAAAATGAGCAAAGCCTTGAAGG - Intergenic
913718737 1:121568287-121568309 ATAAATGACCAGATCTTTTATGG - Intergenic
915841207 1:159214958-159214980 AAAAATGTCCATTGCCTTTTGGG + Intergenic
916464574 1:165061490-165061512 AAAAATGAACAGGGCAGTCAAGG + Intergenic
916472570 1:165138319-165138341 AAAAAAGGCCAGGGCGTGTATGG + Intergenic
919610288 1:199737368-199737390 TAATAGGATCAGGGCCTTTATGG - Intergenic
920840421 1:209549380-209549402 AAAAAAGACCAGGGCCAAGAGGG + Intergenic
920984724 1:210875927-210875949 AAAAATGTGCAGAGCATTTATGG + Intronic
921930915 1:220753575-220753597 AAATATGACCAGAGCCATCAGGG - Intronic
921952267 1:220942758-220942780 AAAAATAACAAGTGCCATTAAGG - Intergenic
922742345 1:228021004-228021026 AGAAATCACCAGGTCCTTTTGGG - Intronic
1062992301 10:1831474-1831496 AAAAATCACGAAGGCCATTAAGG - Intergenic
1066553499 10:36585510-36585532 AAAAAAGAACAGGGCTTTGAAGG + Intergenic
1069503658 10:68976885-68976907 AAAAATGATAAGGACCTTTATGG - Intronic
1072735539 10:97876626-97876648 AAAAATAACAAATGCCTTTAGGG - Intronic
1080068526 11:28049358-28049380 AAAAATGGGCAGGGCTTTTGGGG + Intronic
1080108429 11:28538047-28538069 AGAAGTGACCAAGACCTTTATGG - Intergenic
1080889185 11:36394466-36394488 ACAAATGACCACAGCCTTCATGG + Intronic
1081742491 11:45450192-45450214 AAAAATGACCAGATCATTTCAGG + Intergenic
1084638265 11:70407967-70407989 AAAAAGGGACAGGGCATTTAAGG - Intronic
1086280368 11:85179468-85179490 AAATATGACAAGGACCTTGATGG - Intronic
1088856032 11:113754487-113754509 AAAAATTCCCAGGACCCTTAAGG + Intronic
1090133295 11:124168643-124168665 AAAAATGATCAGTGACTTTGTGG - Intergenic
1090963506 11:131578416-131578438 AAAAAAGGCCAGTGCATTTAGGG + Intronic
1091743159 12:2974396-2974418 AAAAATGACCAAGGCCAGGATGG + Intronic
1092666767 12:10809365-10809387 AAAGATGATCACTGCCTTTATGG + Exonic
1093231739 12:16553271-16553293 AAAAATAACCCAGGCCTTTTTGG + Intronic
1093890091 12:24509425-24509447 AAAAATGACCATGGCATTAAAGG + Intergenic
1098057021 12:66518118-66518140 TAAAATGAGCAAGACCTTTAAGG - Intronic
1098625340 12:72659343-72659365 AAAAATGGCAAGGGCCTCTGAGG - Intronic
1098922636 12:76316353-76316375 TAAAATGTCCAAGTCCTTTATGG + Intergenic
1100807026 12:98296321-98296343 AAAAATGACAGGGGCCTCTGTGG + Intergenic
1101576619 12:106003115-106003137 CAAAATGAGCAGGGGCTGTAGGG + Intergenic
1103399589 12:120634215-120634237 AAAAATGAAAAGGGTTTTTATGG - Intergenic
1105068702 12:133220758-133220780 GAAGATGACCAGGGCCTTCGGGG - Intronic
1106134687 13:26965295-26965317 CAGAATGAGGAGGGCCTTTATGG - Intergenic
1106240561 13:27909223-27909245 AAAAATGACCTGGGGCTTGCAGG + Intergenic
1106639565 13:31569454-31569476 AAAAATGAACAGAGCCTCAAAGG + Intergenic
1106866742 13:33972892-33972914 AAAAATGTCAAGAGGCTTTATGG + Intergenic
1108859424 13:54836334-54836356 AACAATCACCAGAGCTTTTAAGG - Intergenic
1109042091 13:57352078-57352100 AAAAATGACCAGGGCCACTATGG - Intergenic
1112521606 13:100100668-100100690 AAACAGGAACAGAGCCTTTATGG + Intronic
1113398743 13:109972630-109972652 AAAAATGACCTGGGAATTTCTGG + Intergenic
1113628861 13:111866592-111866614 AAAAATGACCAAGGCAGATATGG + Intergenic
1114212763 14:20629651-20629673 AAAAATACCCAGTGCCATTATGG - Intergenic
1114645480 14:24253830-24253852 AGAATTGACCAGGCCCTTTCAGG - Intronic
1120328934 14:83062995-83063017 ATACATGACCAGATCCTTTAGGG - Intergenic
1120748070 14:88169853-88169875 AAAAATGAACAAAGCCTTCAAGG + Intergenic
1121597278 14:95174130-95174152 ACAAATGACCTGGTCCTTCAAGG + Intergenic
1121661508 14:95638687-95638709 AAAAATAATAAGGGCCATTAGGG + Intergenic
1121785571 14:96657721-96657743 AAAAATGAACAGAACCTTGAAGG - Intergenic
1125619673 15:41049077-41049099 AGAAGTGACTAGGGCCTTTAAGG + Intronic
1125842953 15:42822442-42822464 AAAAATAAACCGGGCCTTGAAGG + Intronic
1125878394 15:43169585-43169607 AAAAAGGACCCGGGCCTGCAGGG - Exonic
1126405706 15:48320512-48320534 AAAAATTACCACAGCCTTGATGG - Intergenic
1126801002 15:52296198-52296220 AAAAATGCCCTTGGCCTTTGTGG + Intergenic
1129147336 15:73660559-73660581 AAAAATGAGCAGGACTTTGAAGG - Intergenic
1129984428 15:79904940-79904962 AAAAGTGCCCAGAGACTTTATGG - Intronic
1130033453 15:80336540-80336562 AAAAATGAACAGGACCTAAATGG - Intergenic
1131112532 15:89774411-89774433 AAAGAAGACCAGGGACATTAGGG - Intronic
1133627872 16:7588968-7588990 AAAAATGACAAGGTCCCTGAAGG - Intronic
1135981206 16:27148872-27148894 AGAAGTGACAAGTGCCTTTAAGG - Intergenic
1140196275 16:72858135-72858157 AAAACTAACAAGGGCCTTTCTGG + Intronic
1140845247 16:78880966-78880988 AAAAATTACCAGAAGCTTTAGGG - Intronic
1141007783 16:80369333-80369355 CAATAGGATCAGGGCCTTTAAGG + Intergenic
1149167290 17:53767699-53767721 AAGAATGACCATGACCTTTTTGG + Intergenic
1150155500 17:62849737-62849759 CAAAATAACCACGGCCTTTCTGG - Intergenic
1150408548 17:64922921-64922943 AAAGATAACCAGGGCCCATACGG - Intergenic
1151041870 17:70872107-70872129 AAAAATGAGCTGTGCCTTTTAGG - Intergenic
1152034889 17:77865976-77865998 AAAAATGACAATGGCCTCTGTGG - Intergenic
1152510666 17:80785273-80785295 AAAAATGAGCAGGGATATTAGGG + Intronic
1152867543 17:82733297-82733319 AAAAATTACAAGGGGCTTTGAGG + Intergenic
1153117764 18:1680664-1680686 GAAAATGACCAGGTAATTTAGGG + Intergenic
1153161731 18:2213079-2213101 AAAAATGAGCAGAGCATTTGGGG + Intergenic
1155288047 18:24311742-24311764 AAAAAAGTACAGTGCCTTTAAGG + Intronic
1157300993 18:46479066-46479088 AAAATTAACCAGTCCCTTTAAGG - Intronic
1159382480 18:67679403-67679425 AAAAATGAACAAAGCCTTTGAGG - Intergenic
1162696122 19:12477282-12477304 TAAATTGAACAGGGCCTTGAAGG - Intronic
925125383 2:1451357-1451379 ATAAATTACCATCGCCTTTATGG - Intronic
927294623 2:21440169-21440191 AAAAACAACCATGGCCCTTAGGG + Intergenic
927943545 2:27120822-27120844 AAAAAGGAGTAGGGCCTTTTGGG + Intergenic
928184973 2:29102073-29102095 AGAAATGACAAAGGCCTTCAAGG - Intronic
928298027 2:30102297-30102319 ACAAATTACCAGAGCCTTCAGGG + Intergenic
928629960 2:33180921-33180943 AAAAATGCTGAAGGCCTTTAAGG + Intronic
928664162 2:33533833-33533855 ATAAATTATCAGGGCCTTGAGGG + Intronic
929096076 2:38264326-38264348 AACAATGACAAAGGCCTTGAGGG - Intergenic
930982287 2:57541817-57541839 TAAAATGACAAAGGCATTTATGG - Intergenic
932055725 2:68441488-68441510 AATAATGACTTGGGCCTTTGTGG + Intergenic
932084399 2:68745495-68745517 AAAAATGGCCAGAGAATTTAAGG - Intronic
936631006 2:114202630-114202652 AAAAGTGAACAGGGCCTTAAGGG - Intergenic
936808672 2:116369015-116369037 AAGAATGAACAGAGACTTTAAGG + Intergenic
942930155 2:181481931-181481953 AAAAATGTCCAGGGAGTATATGG + Intronic
943369465 2:187000375-187000397 GAAAATGGCCAGAGCCTCTAGGG - Intergenic
945883287 2:215348998-215349020 AAAAATGCCCAGGTGCTTTCTGG + Intronic
947721667 2:232373351-232373373 AAAAATTAGCAGGGTATTTATGG - Intergenic
948617333 2:239208835-239208857 AAAAATGAGAACGACCTTTATGG + Intronic
1169480351 20:5974476-5974498 AAAATTGACCAGGGCTTCTCTGG + Intronic
1169623231 20:7531753-7531775 AAAAATCACCAGGGCATACATGG + Intergenic
1172100180 20:32480564-32480586 AAGAATGTCCAGGGCCTGGAAGG - Intronic
1174621295 20:51876620-51876642 AAAAATGAGCCCGGCTTTTAGGG + Intergenic
1175767668 20:61602361-61602383 GAAAATGACCAGGTCCTCAAAGG + Intronic
1178667523 21:34561962-34561984 ATAAATGACCAGGGATTTTCTGG - Intronic
1182192911 22:28482358-28482380 AAAAATTACCTGGGCGTGTAGGG - Intronic
1182529219 22:30942281-30942303 AAACATGAGCAGGCACTTTAAGG + Intronic
1182544213 22:31064256-31064278 AAAAATGTCATGGGCATTTAGGG + Intronic
949392358 3:3577299-3577321 AAAAATGACCTCTGCCTTCAGGG - Intergenic
950614636 3:14148863-14148885 GAAAATGACCTGGGCCTGTTTGG - Exonic
951403560 3:22265465-22265487 AAAACTCACCAGGCCTTTTAAGG + Intronic
951947717 3:28159904-28159926 AAGAATGAACAAAGCCTTTAAGG + Intergenic
952703127 3:36347622-36347644 AACAATGACCACAGCCTTGAAGG - Intergenic
953073597 3:39547494-39547516 AAAAAAGACTGGGGCATTTAGGG + Intergenic
956342138 3:68237280-68237302 AAATGTGACTAGTGCCTTTACGG - Intronic
959397550 3:105859977-105859999 GAAAATTACCAAGACCTTTATGG + Intronic
960361821 3:116721904-116721926 AAAAATGACAGGGGCATTTTGGG - Intronic
960373226 3:116866701-116866723 AAAAAGGACATGGTCCTTTATGG + Intronic
960797247 3:121500554-121500576 AAAAATGAACAGAGTCTTAAAGG + Intronic
961575139 3:127829642-127829664 CAAAATGAACAGAGCCTTCAGGG - Intergenic
962873485 3:139518369-139518391 AACAATGACCAGGGCCTCTGGGG + Intronic
963685805 3:148432285-148432307 TAAAATGTCCAGGGTGTTTACGG + Intergenic
966652376 3:182315523-182315545 TAAAATGACCAGGTCCCTGAGGG - Intergenic
966708665 3:182947817-182947839 AAAAATGACCAGGGCCTTTAGGG + Intronic
967779087 3:193416700-193416722 AAAAATGAACAGAGCCTAAAGGG + Intronic
973910521 4:55575390-55575412 AAAAATAAACAGGGCCTAAAGGG + Intronic
974359488 4:60858109-60858131 AAAAATGATTAGGGACATTAAGG - Intergenic
978116057 4:105021583-105021605 AGAAATGACCATGTCCTTTATGG + Intergenic
987451016 5:18084228-18084250 TAAAATGACCTGGGCCTTCTGGG + Intergenic
987468890 5:18306455-18306477 GAAAAGGACCAGGGGCTTTAGGG + Intergenic
988327933 5:29795551-29795573 AAAAATGACCAGGATATATATGG + Intergenic
989959858 5:50399750-50399772 ATAAATGACCAGATCTTTTATGG + Intronic
990428922 5:55715552-55715574 AAAAATGAACAAGACCTGTAAGG + Intronic
990924838 5:61008830-61008852 AATATTGACTAGGGCCTTGAAGG + Intronic
991077070 5:62552684-62552706 AAACATGACCAGGCCCCTCATGG - Intronic
992508261 5:77408762-77408784 CAAAATGACCAGTGCTTTCACGG - Intronic
992997597 5:82348162-82348184 AAAAATTACCCGGGGCTTGATGG - Intronic
994505588 5:100639646-100639668 CAAAATGTCCAGGGCAGTTATGG - Intergenic
994711762 5:103274000-103274022 AAAAATAACCAGGGCCATTGAGG - Intronic
994782902 5:104115912-104115934 GAAAATGACCAAGGCTTTAATGG + Intergenic
994993475 5:107029022-107029044 AAAAAAGGCCAAGGCCTTTTAGG + Intergenic
996005532 5:118416625-118416647 AAATATGAACAGGGCCTATTCGG + Intergenic
996224632 5:120976794-120976816 GAATATGAGCATGGCCTTTAGGG + Intergenic
996422352 5:123276920-123276942 AAAAATGACCAGGTCCTTGTGGG - Intergenic
996571086 5:124932983-124933005 AAGAATGACCAGACCCTTTAAGG - Intergenic
998933731 5:147210906-147210928 AAAAAGGAACCAGGCCTTTACGG + Intergenic
999857479 5:155610608-155610630 AAAAATCACTAGGGCCTGTGAGG + Intergenic
1001784096 5:174396820-174396842 GTAACTGACCAGGGCCTTGAAGG + Intergenic
1003514745 6:6808569-6808591 AAAAGTGACCATGGACTTTATGG - Intergenic
1004277022 6:14245811-14245833 AAAAATGACTATTGCCTTGAGGG + Intergenic
1004392948 6:15224536-15224558 AAAAATGACCCTTGCCTATAAGG - Intergenic
1006203251 6:32316013-32316035 GTAAATGAAGAGGGCCTTTAAGG - Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1008131864 6:47728050-47728072 CAAATTGAGCAAGGCCTTTATGG - Intergenic
1011121419 6:83957643-83957665 AAAATTGACCAGAACCTATATGG + Intronic
1011944678 6:92886064-92886086 AACAAATACCAGGGCCTTTTGGG + Intergenic
1012524029 6:100155933-100155955 AACAAGAACCAGGGCCTATATGG + Intergenic
1013610275 6:111788216-111788238 GAAAATGGCCAGGTCCTTGAGGG + Intronic
1014841493 6:126225258-126225280 TCAAATGACCAGGGGGTTTATGG + Intergenic
1015160133 6:130143658-130143680 AAGATAGACCAGGGCCTTTTGGG - Intergenic
1017256730 6:152341691-152341713 AAAATTGACCAGGCCCTTAGTGG - Intronic
1018661640 6:166092690-166092712 AAAAATATCAATGGCCTTTATGG - Intergenic
1019332067 7:465126-465148 AAACATGACCAGGGCCTGGGAGG + Intergenic
1020533637 7:9365747-9365769 AAAAATGAACAAAGCCTTTAAGG + Intergenic
1020575799 7:9925755-9925777 TAAAAGGAACAAGGCCTTTAAGG - Intergenic
1022084969 7:27057765-27057787 AAAAATAACCACTCCCTTTATGG + Intergenic
1022322593 7:29301121-29301143 AAAAATGACAAAGGACTTTCTGG - Intronic
1022530041 7:31061357-31061379 AGAAGTGACCAAGCCCTTTAGGG + Intronic
1024134534 7:46392851-46392873 AAAAATGCACAGGGTCTTTGAGG - Intergenic
1024183577 7:46924302-46924324 AAACATCACCAGAGCCTTTCAGG - Intergenic
1028620135 7:92816306-92816328 AAAAATGCCCAAGGCCTTAAAGG + Intronic
1029176742 7:98670013-98670035 AGAAATGACCACGGCCTCGAAGG - Intergenic
1033386299 7:140879609-140879631 AACAATTACCTGGGCCTTCAAGG + Intronic
1035481989 7:159194313-159194335 CAAAATGTCCAGGGCCTTCTGGG - Intergenic
1036112865 8:5924025-5924047 AAAAATGCACATGGCCTTAAAGG + Intergenic
1036704170 8:11034390-11034412 CAAAATGTCCAGGACATTTATGG + Intronic
1037701418 8:21278009-21278031 AAAAATGAGCAGAGCCTTAGAGG - Intergenic
1038234963 8:25744178-25744200 TAAAATGTCCAGGGCCATTCTGG + Intergenic
1038645949 8:29362375-29362397 AAAAATGACCAGGATCTGTTGGG + Intergenic
1039377670 8:37052488-37052510 TAAAATGACATGGGCCTTTGGGG - Intergenic
1043884076 8:85578303-85578325 AAAGAAGACCAGGGTCTTTAAGG - Intergenic
1044499426 8:92934496-92934518 AACAATAACAAGGCCCTTTATGG + Intronic
1045656939 8:104397134-104397156 AGAAGTGAGGAGGGCCTTTAGGG - Intronic
1045983001 8:108213994-108214016 AAAAATGACTAGTGCCCTTTGGG - Intronic
1046599716 8:116301877-116301899 AAAAATGTGAAGGGCCTCTATGG - Intergenic
1047565809 8:126042181-126042203 GAAAAACACCAGGGCCTTGAAGG + Intergenic
1050664222 9:7916931-7916953 ACAAATGTCCAGTGGCTTTAGGG + Intergenic
1051341746 9:16118628-16118650 TGGAATGACCAGGGCATTTATGG + Intergenic
1054737321 9:68768433-68768455 AAAAATGACAAAGGACTTTATGG + Intronic
1060813453 9:126622861-126622883 ACAAAGGCCAAGGGCCTTTAGGG + Intronic
1061991981 9:134164113-134164135 AAAAATGCCCCGGGGCTTTGCGG + Intergenic
1187203929 X:17163324-17163346 AAAAATGAACAGGGCCTCAGAGG + Intergenic
1187310277 X:18135175-18135197 AGAAATGAGCAGGGCATTTGAGG + Intergenic
1187498939 X:19822333-19822355 AAAAATGAACAGAGCCTTAGAGG - Intronic
1189909050 X:45791253-45791275 AAAAATGAACAGGGCCTCAGGGG + Intergenic
1190037684 X:47040899-47040921 AAAAATTAAAAGGGCCTTTGGGG - Intronic
1197365973 X:125565032-125565054 CAAAATGTCCAGGGCAGTTACGG + Intergenic
1198153666 X:133935517-133935539 CAAAATGCTCAGGGCCTTTTGGG - Intronic
1198497917 X:137212361-137212383 AAGAATCACCAGGTTCTTTATGG + Intergenic
1201053797 Y:9967752-9967774 AAAAAAGCCTAGGGCCTTTTTGG - Intergenic
1201676737 Y:16594608-16594630 CAGAATTACCAGGGACTTTATGG + Intergenic