ID: 966710503

View in Genome Browser
Species Human (GRCh38)
Location 3:182967706-182967728
Sequence GAAGAATCCTAGACACTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966710503 Original CRISPR GAAGAATCCTAGACACTTGA GGG (reversed) Intronic
905316993 1:37088870-37088892 GAAGAATCCAAGACAACTAAGGG + Intergenic
905946042 1:41902158-41902180 GCAGAATCCTGGACACTAAAAGG + Intronic
906902624 1:49852660-49852682 GAAAAATCCTCTACACCTGAAGG + Intronic
907516911 1:54998654-54998676 GAAGAATTCTACACTCTTCAAGG - Intergenic
907840734 1:58154971-58154993 GAAGAAACCTAGAGACTTAGAGG + Intronic
909793564 1:79703868-79703890 GAAGAATCCTTGAACCTGGAAGG - Intergenic
912274693 1:108243804-108243826 GAAGAAACCCAGACACATGATGG + Intronic
912286573 1:108376054-108376076 GAAGAAACCCAGACACATGATGG - Intronic
912293526 1:108450537-108450559 GAAGAAACCCAGACACATGATGG - Intronic
912533329 1:110341832-110341854 GAAGACTACTAGCCACTTGGAGG - Exonic
913990976 1:143611456-143611478 GAAGAAACCCAAACACATGATGG + Intergenic
914838540 1:151228590-151228612 GAAGCATCCTGGATCCTTGAGGG + Intronic
914940480 1:152018597-152018619 GAAGAAACCCAAACACATGATGG - Intergenic
915047040 1:153026642-153026664 GAAAAGTTCTGGACACTTGAAGG - Intergenic
923279523 1:232429705-232429727 GAAGAAACCAAGACGCTGGAGGG + Intronic
1064272439 10:13877803-13877825 GAACCATCCCAGACACTTCATGG + Intronic
1066036148 10:31487354-31487376 GAAGACTCCTCAACACTTTAAGG - Intronic
1067299415 10:44995269-44995291 GAAGAAGGCCAGACACTGGAAGG + Exonic
1068722601 10:60262875-60262897 GAGGAATCCTTGACTCTTAAGGG - Intronic
1069227736 10:65965216-65965238 GAGGAATCATAGACCTTTGAAGG + Intronic
1069710486 10:70485204-70485226 GATGAATCCTACATACTTAAGGG - Intronic
1070703421 10:78619596-78619618 GAAGAATCCAAGACACATAAAGG + Intergenic
1072329145 10:94329235-94329257 GAAGAATCCTTTACACTTAATGG - Exonic
1075681292 10:124334709-124334731 GAAGAATGATAGACAAGTGAAGG + Intergenic
1077971661 11:7198630-7198652 GAAGGATCCTATACTCATGAAGG - Intergenic
1079372767 11:19865660-19865682 GAAAAATTCAAGGCACTTGATGG + Intronic
1080254414 11:30273047-30273069 GAAGCATTCTAGACAGTTGGTGG + Intergenic
1081182856 11:40005611-40005633 CAAGAATCCTGTACAGTTGAGGG + Intergenic
1084984759 11:72859017-72859039 GAAGAAACCCAGGCACATGATGG + Intronic
1090413082 11:126522390-126522412 CAAGGTTCCTAGACACTGGAAGG - Intronic
1091733823 12:2902630-2902652 GAATAATCATAGATTCTTGAGGG + Intronic
1098488361 12:71047380-71047402 GAAGTCGCCCAGACACTTGAAGG + Exonic
1100288042 12:93186460-93186482 GAAGCTTGCTAGACACTAGAAGG - Intergenic
1107580814 13:41782993-41783015 GAAAAATACTAGAAACTTGCAGG + Intronic
1107719670 13:43234967-43234989 GAAGAATTCTGTCCACTTGAAGG - Intronic
1109768214 13:66933748-66933770 ACAGAATCCAAGACACTTCACGG - Intronic
1117091061 14:52250776-52250798 AAGGAATCCTTGACCCTTGAGGG - Intergenic
1121651414 14:95561740-95561762 GAAAAATCCCAGACAGTTGGGGG + Intergenic
1121779161 14:96610775-96610797 GAAGAATCAAAGACATCTGAAGG - Intergenic
1125042362 15:35205279-35205301 GAAGTATCCTAGAGTTTTGAAGG + Intergenic
1125454511 15:39843703-39843725 TTAGAATACTAGACATTTGATGG + Intronic
1127487811 15:59435718-59435740 GAACAATTCTATATACTTGATGG - Intronic
1128865393 15:71111246-71111268 GAAGACTCCCTGACACTTCATGG + Exonic
1131200551 15:90392178-90392200 AAAGAAGCCTAGACACAAGAGGG - Intronic
1131532511 15:93205865-93205887 TAACAATCCTTGATACTTGAGGG + Intergenic
1134353403 16:13459198-13459220 GAAGATTCCTAGATATTTGTAGG + Intergenic
1136882856 16:33913541-33913563 CAAGCACCCTAGACACTTTAGGG - Intergenic
1137837091 16:51602816-51602838 GAAGAGTTCTAGACACTGGAAGG - Intergenic
1140853810 16:78959759-78959781 GATGAATCCGAGACAAGTGAGGG + Intronic
1141707613 16:85676571-85676593 GCAGCATGCTAGACACTGGAGGG + Exonic
1147135236 17:38430251-38430273 CAAGAACCCAGGACACTTGAGGG + Intronic
1148013694 17:44505861-44505883 AAAGAATGCCAGACATTTGAAGG + Intergenic
1151050559 17:70973729-70973751 GAAGAACCCTAGATAATTAAAGG + Intergenic
1153376783 18:4389926-4389948 GAAGTATCTTAGAAACATGAAGG - Intronic
1153809494 18:8739475-8739497 GAAGAATCCTAGGCAGTGTAGGG - Intronic
1157827050 18:50821971-50821993 GGAGAATCTTAGACTCTTGTGGG - Intronic
1158001083 18:52619957-52619979 GAAAGATTCTAGAAACTTGATGG + Intronic
1158879125 18:61759800-61759822 GAAGCAACCTAGACACTGAAAGG + Intergenic
1161300475 19:3540181-3540203 GAAGAATCCTAGAACCTGGGAGG - Intronic
1162384718 19:10354006-10354028 GGCGAGTCCTAGAGACTTGAGGG - Intronic
1163884320 19:19952444-19952466 GAAGACTTGTAGACACTTGTGGG + Intergenic
1167009339 19:46796478-46796500 CCAGAATCCTAGACCCTTCAGGG + Intergenic
925701855 2:6646871-6646893 GGAGGATGCTAGACACTGGAGGG - Intergenic
926519781 2:13896751-13896773 GGAGCTTCCTAGACACTTGTTGG + Intergenic
935377818 2:102418096-102418118 TTAGAATACTAGACTCTTGACGG + Intergenic
937002609 2:118481893-118481915 GAAGAACCCCTGGCACTTGATGG + Intergenic
941605928 2:167596495-167596517 GAATATTCCTACACACTTTAAGG + Intergenic
944295509 2:198057273-198057295 GAGGCATCCTAGGCTCTTGATGG + Intronic
944872874 2:203932100-203932122 GAAGAATCCTTGACTTTTGGAGG - Intergenic
946996827 2:225402267-225402289 TAAAAATCCTAGACACAAGAAGG + Intronic
947621354 2:231593239-231593261 GAAGGCTCATAGACACTTGCAGG - Exonic
948520430 2:238533241-238533263 GCAGAATCCAAGACACTTGCTGG + Intergenic
948521501 2:238541566-238541588 GAAAGATCCAAGACACTTGCTGG + Intergenic
1169416702 20:5423444-5423466 GAAGAATCCTGCACACAGGATGG + Intergenic
1179352445 21:40625414-40625436 GGAGACTCCTAGACACAGGATGG - Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955888886 3:63629638-63629660 GAATAATCTGAAACACTTGAAGG - Intergenic
963687637 3:148457314-148457336 GAAGAATCAGAAGCACTTGAGGG + Intergenic
964222726 3:154365309-154365331 CAAGAATACCAGAGACTTGAAGG - Intronic
966710503 3:182967706-182967728 GAAGAATCCTAGACACTTGAGGG - Intronic
972979017 4:44673116-44673138 GAAGAACTCAATACACTTGAGGG + Intronic
974236960 4:59193652-59193674 GATGGTTCCTAGAAACTTGAAGG - Intergenic
974344962 4:60667839-60667861 GTAGAAGCATAGAGACTTGAAGG + Intergenic
976187863 4:82460163-82460185 GAATAAACCTAGACACTACAGGG - Exonic
977136189 4:93307521-93307543 GAAGAATCATAGACAATGAAAGG - Intronic
977996954 4:103505715-103505737 AGAGAAACCTAGACACTGGAAGG + Intergenic
978157330 4:105505010-105505032 AAAGAATTCTAGACACCAGATGG + Intergenic
986505568 5:8446882-8446904 CCAGAATCCTAGACACTTCTGGG + Intergenic
991138240 5:63208580-63208602 GAAGAATCCTAGAACCTGCAGGG + Intergenic
991719874 5:69485440-69485462 AAAGAAACCCAGACACTTTATGG + Intergenic
993306615 5:86282701-86282723 GAAGAAACCCAAACACATGATGG - Intergenic
994165731 5:96606374-96606396 TAAGAATACTACATACTTGATGG + Intronic
996417437 5:123225808-123225830 AAACAATCCTATAGACTTGATGG - Intergenic
996779533 5:127170917-127170939 GAAGACTGCTAGCCACTTGGAGG + Intergenic
996861237 5:128068198-128068220 GAAGAAACTTAAACACTTTAAGG + Intergenic
998761164 5:145433708-145433730 GCTGAATCCTAGACCTTTGAGGG - Intergenic
1005386907 6:25294068-25294090 AAAGAAACCAAGACACTTGCTGG - Intronic
1005649383 6:27872555-27872577 GAAAAATCCTAGACTTTTGGGGG - Intergenic
1009573262 6:65417576-65417598 GAATAATCCAAGAGACCTGATGG - Intronic
1010734591 6:79429427-79429449 GGGGAAACCTAGACACTGGAGGG - Intergenic
1011019601 6:82797414-82797436 GAAGAATTCAACACACTTGCTGG - Intergenic
1011231759 6:85169726-85169748 GCAGAATTCTAGACAGTTTAAGG - Intergenic
1012629563 6:101447196-101447218 GCAGAATCTTAGAGACTTGGAGG + Intronic
1016721459 6:147303658-147303680 GCAGCTTCCTAGAGACTTGAAGG + Intronic
1017941047 6:159053338-159053360 GAAGATCCCTAAACACTTGAAGG + Intergenic
1020914670 7:14177463-14177485 GAAGAATCCTTGAAACTGGAAGG + Intronic
1024139831 7:46451072-46451094 GAAGCATCCAAGATACTTGGTGG + Intergenic
1024248313 7:47487325-47487347 AAAGCATGCTTGACACTTGAGGG - Intronic
1028370094 7:90082092-90082114 GAAAAATACTACTCACTTGAGGG + Intergenic
1030297417 7:107942752-107942774 GAAGACTACCAGACACTTGTAGG - Intronic
1035002131 7:155621193-155621215 GAAGAATGTGAGACACTTGCGGG + Intronic
1035263392 7:157675450-157675472 GCAGAATTCAAGACACTTGATGG - Intronic
1045843263 8:106604084-106604106 GAAGAAACCTGAACACTTGCAGG + Intronic
1045953334 8:107877099-107877121 GAAGAATCTTATATACTTGTAGG - Intergenic
1055245518 9:74237680-74237702 GCATTATCCTAGACACTGGAAGG - Intergenic
1057990942 9:99768876-99768898 GGAGAATCCTAGAAACATAATGG + Intergenic
1060431355 9:123553662-123553684 GAAAAATCCTAGAAGCTGGATGG + Intronic
1060543489 9:124447292-124447314 AAAGCATCCTAGAAACCTGAAGG + Intergenic
1186679414 X:11855772-11855794 GGAACATCCTAGAAACTTGAAGG - Intergenic
1195315494 X:103673460-103673482 GAAGAATAATTGACACCTGATGG + Intergenic
1196980556 X:121209110-121209132 GAAGAGTCCTTGAGACTTAAGGG - Intergenic
1198872719 X:141193179-141193201 GGAACTTCCTAGACACTTGAAGG + Intergenic
1199228840 X:145410875-145410897 GTAGAATCATAGACTCTTCAAGG + Intergenic