ID: 966710657

View in Genome Browser
Species Human (GRCh38)
Location 3:182969100-182969122
Sequence TTGTAAGTGTAAGAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966710657 Original CRISPR TTGTAAGTGTAAGAAGTGGA GGG (reversed) Intronic
903012009 1:20337924-20337946 TTGGCAGTGTAAGTTGTGGATGG - Intronic
903167346 1:21530144-21530166 TTTTAAGGGCAAGAAGTGCATGG - Intronic
906080348 1:43083275-43083297 TAGTAAGTGTAAAAATGGGAAGG - Intergenic
907196337 1:52690060-52690082 TTTTAAGTGTAAAAAGAGCATGG + Intronic
907440221 1:54474355-54474377 TTGCAAGAGGGAGAAGTGGAGGG - Intergenic
908061416 1:60354066-60354088 CTATAAGTGTAAGAATTTGAAGG - Intergenic
909797958 1:79767206-79767228 GTGTCAGTTTAAGAAGTGAAAGG - Intergenic
913454819 1:119020051-119020073 TTGTAGGTGTGAGAAATGCATGG + Intergenic
917057472 1:170998956-170998978 TTGAAAGTTTTAGAAGTAGATGG - Intronic
917715394 1:177731882-177731904 TAGTATGTGTAAGTAGTGCAAGG - Intergenic
917766489 1:178224408-178224430 TTCTAAGTATCAGAAGTGAAAGG - Intronic
917771662 1:178286221-178286243 TTGTAAGACTAAGAAGTTAAGGG - Intronic
921877638 1:220216816-220216838 TTGGAAGTGTGATAAGAGGAAGG - Intronic
922921400 1:229307897-229307919 TTGCAAGTTTAAGAAATGGAGGG - Intergenic
923341632 1:233012430-233012452 TTGTAAGTGAAAAAACTGAAAGG + Intronic
924875305 1:248096740-248096762 ATGTAAGTGTAGCAAGTGTAGGG - Intronic
1065123707 10:22552849-22552871 TTATAAGTGTAAGAAAAGAAGGG + Intronic
1065643092 10:27805139-27805161 TTGGAAGTGCAAGAAGAGAAGGG + Intergenic
1066173892 10:32882948-32882970 CTGGAAGTGTAAGAAATGTATGG - Intergenic
1067990155 10:51202763-51202785 TTGTCTGGGAAAGAAGTGGAAGG + Intronic
1068291968 10:55015183-55015205 TTTTAAGTGTAAAATGTGGTGGG - Intronic
1071899119 10:90100078-90100100 TTGCCAGTGTAAAAAGTGGTAGG - Intergenic
1071903276 10:90143584-90143606 TGGTAAGTATAAGAGGAGGAGGG + Intergenic
1072277531 10:93837716-93837738 TTGTAAGTTTCAGAAGGGGAGGG + Intergenic
1073614419 10:104978630-104978652 TGGTAACAGAAAGAAGTGGATGG - Intronic
1078648356 11:13163705-13163727 TTGTAAGTGTGCAAAGTGTAGGG - Intergenic
1080727146 11:34909694-34909716 TTGTAGGGGCAAGATGTGGAAGG + Intronic
1082041566 11:47689815-47689837 TTGTAAGTGAAATAATTGAATGG - Intronic
1083019353 11:59490522-59490544 TTCTAGATGTAAGAAGTGAAAGG - Intergenic
1088548875 11:110990111-110990133 TTGTAAATGGAAGAATAGGAGGG + Intergenic
1089407377 11:118209450-118209472 TTATAAGTGGAAGGAGTGGGTGG - Intronic
1089576798 11:119450256-119450278 TTTTAAGAGTAAGAACTGGAAGG + Intergenic
1091124073 11:133081047-133081069 TTGGAAGTGTTAGAATTGGAAGG + Intronic
1091702087 12:2670225-2670247 CTGGAAGTGTAGGAAGGGGAAGG - Intronic
1097497600 12:60360557-60360579 TTATAAGTGAAATAATTGGAAGG + Intergenic
1099297898 12:80853235-80853257 TTATAAGTTTCAGAATTGGAAGG - Intronic
1100081753 12:90861050-90861072 TTAGAAGTGGGAGAAGTGGAAGG + Intergenic
1100946057 12:99785044-99785066 TTCTGAGGGCAAGAAGTGGAGGG + Intronic
1101120256 12:101571755-101571777 TTGAAAGGGAAAGAAGAGGAGGG - Intronic
1103143548 12:118573674-118573696 TTTGAAGTGAAAGAATTGGATGG + Intergenic
1103178690 12:118888507-118888529 TTGGACATGTAAGAATTGGAGGG - Intergenic
1107148271 13:37083213-37083235 TTGTAAGAGTAAAAAGTTGTTGG + Intergenic
1107761891 13:43688356-43688378 TTGAAATGGAAAGAAGTGGATGG + Intronic
1108572460 13:51764991-51765013 TTGCAAGAGCAGGAAGTGGAGGG - Exonic
1109427976 13:62193161-62193183 ATGTAAGGGAAAAAAGTGGAGGG - Intergenic
1110309245 13:74028216-74028238 CTGTAAGTATAAAAAGTGCATGG + Intronic
1110867342 13:80409988-80410010 TAGGAGGTGGAAGAAGTGGAGGG - Intergenic
1112796912 13:103067123-103067145 TTGCATGTGTAAGTAGTTGAGGG - Intergenic
1113607205 13:111617922-111617944 TTGTACGTGTAATTATTGGAAGG + Intronic
1115305138 14:31925915-31925937 TTTTAGGTGTAAGAAATGAATGG + Intergenic
1116901315 14:50364665-50364687 CTGTAAGAGTAAGAAGCGCAAGG + Intronic
1119722519 14:76900826-76900848 GTGCAAGTCTAAGATGTGGAGGG - Intergenic
1122948017 14:105022073-105022095 TTTTAAGTGTGAGGGGTGGAGGG + Intergenic
1124336812 15:28863397-28863419 TAGTAAATGTAAGAAGTTAATGG + Intergenic
1125971370 15:43914503-43914525 TAGTAAGTGTCAGAACTGGATGG - Intronic
1127333639 15:57963076-57963098 GTGAAAGTGTAGGAAGTGAAGGG - Intronic
1128120978 15:65146259-65146281 GTGGAAGTGGAAGAAGTGAATGG - Intergenic
1128471750 15:67959746-67959768 AAGTCAGTGGAAGAAGTGGATGG - Intergenic
1129654407 15:77514485-77514507 CTGTACATGTAAGATGTGGATGG + Intergenic
1131741760 15:95400418-95400440 TTCTAAATGTAAGAATTGGCTGG - Intergenic
1135045735 16:19153671-19153693 GCGTAAGTCTGAGAAGTGGAAGG + Intronic
1138014618 16:53417326-53417348 GTTTAAGTGTAAAAAGTGAAAGG - Intergenic
1138975423 16:62201252-62201274 TTGGAAGGGTAAGTAGTGGCTGG + Intergenic
1141079774 16:81039692-81039714 TTGTGTGTGAAAGCAGTGGAGGG + Intronic
1141316955 16:82971465-82971487 TTTTAAAAGTAAGAAGTGCAGGG + Intronic
1143277855 17:5726875-5726897 TTGTTTGTGTAACAAGTGGTCGG - Intergenic
1145769498 17:27482773-27482795 TTATAAATGAAATAAGTGGAGGG + Intronic
1145769919 17:27485533-27485555 TTATAAATGAAATAAGTGGAGGG + Intronic
1147192489 17:38746259-38746281 TAGTGAGTGTGAGAGGTGGAGGG - Intronic
1147944266 17:44071445-44071467 TAGTAAGTGTGAGATGAGGATGG - Intronic
1149140283 17:53424650-53424672 ATATAAATGTAAGAAGTTGAAGG - Intergenic
1149305590 17:55343643-55343665 TTGCAAGTTTAAAAAGTAGAGGG - Intergenic
1150997401 17:70334565-70334587 ATGTAAGTGTAAGAAGAGAATGG - Intergenic
1154344383 18:13530250-13530272 TTTTAAAAGTAAGAAGAGGAAGG + Intronic
1155462972 18:26104115-26104137 ATGTAAGTGTTACCAGTGGAGGG - Intergenic
1156407505 18:36796842-36796864 TTAGAAGTGGAGGAAGTGGAGGG + Intronic
1156638063 18:39055005-39055027 TTACAAGAGTAAGCAGTGGAAGG - Intergenic
1159540669 18:69770826-69770848 TGGAAAGTGTAAGAAATAGAAGG - Intronic
1168072050 19:53958839-53958861 TAGTAAATGAAAGAAATGGAGGG - Intergenic
930342770 2:50138150-50138172 TTGTAAATGAAATATGTGGAAGG - Intronic
930370601 2:50496405-50496427 TTTTAAGTGTTAGAAAAGGATGG - Intronic
930387127 2:50711189-50711211 TGGTAAGTTTAAGCATTGGATGG + Intronic
930654698 2:53996289-53996311 TTGGAAGTGCAAGAAGTGTAGGG + Intronic
932690256 2:73907136-73907158 TTTTAAGTGAAAGAAGAGGTAGG - Intronic
932971352 2:76547021-76547043 TTGTGAGTGTCTGAAATGGAAGG + Intergenic
936102555 2:109595702-109595724 CAGTAAGTGTAAGAATTTGAAGG + Intronic
939131417 2:138240311-138240333 CTGTAAGTGTAAGTAGTAGTTGG + Intergenic
939835952 2:147129957-147129979 TTTTAAATGTAAGAAGCAGAAGG + Intergenic
941263547 2:163328880-163328902 TTGTAAATGTTAGAAATTGATGG + Intergenic
941827797 2:169919257-169919279 TTGTGAGTGGAAGAAGTTCAAGG + Intronic
946677388 2:222175802-222175824 TTGGAAATGTGAGAAATGGATGG + Intergenic
947232252 2:227900500-227900522 TTGTAAGTGTCAGAAGTGGATGG + Intronic
947868641 2:233419553-233419575 TTGTATGTCTTAGAAATGGAAGG + Intronic
948898849 2:240945916-240945938 GTGAAAGTGGAAGAAGTGGGTGG - Intronic
1169313810 20:4571343-4571365 ATTTCAGTGTAAGATGTGGAGGG + Intergenic
1170101663 20:12707963-12707985 TTTTAAGTGGAAAAAGTGCATGG - Intergenic
1173423704 20:42925435-42925457 TTGTAAGTGTTGGAAGGGCAAGG + Intronic
1175299690 20:57934161-57934183 TTGGAAGTGGGAGAGGTGGAGGG + Intergenic
1176969955 21:15253670-15253692 TTGTAAGTGAAAGAGGAGGTAGG + Intergenic
1179330037 21:40391007-40391029 TTGCAAGTGTAGGGAGTGGAGGG + Intronic
1183337914 22:37261156-37261178 TGGGAAGTGTAAGAAGTGGCTGG + Intergenic
1183765142 22:39866370-39866392 ATGTAAGTGTCACAAGTGCAGGG - Intronic
1183809657 22:40244086-40244108 CTGCAAGTGGAAGGAGTGGATGG - Intronic
951039907 3:17978582-17978604 TTGTAAGAGAAACAGGTGGAAGG - Intronic
951730751 3:25808017-25808039 TGGGAAGTAAAAGAAGTGGATGG - Intergenic
952304638 3:32135162-32135184 GTGTATGTGTTAGAGGTGGATGG + Intronic
955901136 3:63756269-63756291 TTAGAAAAGTAAGAAGTGGAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965960312 3:174421739-174421761 CTTGAAGTGTAAGAATTGGAGGG - Intergenic
966710657 3:182969100-182969122 TTGTAAGTGTAAGAAGTGGAGGG - Intronic
969565695 4:7976297-7976319 TGGTGAGTGTGAGAAGTGGATGG - Intronic
970203785 4:13635388-13635410 TTTTAAGAGTAAGAGGTGGTTGG + Intergenic
971461630 4:26904965-26904987 TTGAAAGTGTAGACAGTGGATGG + Intronic
971503640 4:27343030-27343052 GTGTGTGTGTAAGAAGTGGGGGG + Intergenic
977546993 4:98395712-98395734 TGGAAAGTATAAGAGGTGGATGG - Intronic
978750704 4:112243429-112243451 GTGTCAGTGAGAGAAGTGGAAGG - Intronic
979093243 4:116514994-116515016 TTTTAAGTGGAAGATGTGTACGG - Intergenic
982081913 4:151798530-151798552 TTGCAAATGGAAGAAGTAGAAGG + Intergenic
984238001 4:177184822-177184844 TTGTAAGGGAAAGAAAAGGAAGG + Intergenic
986409673 5:7464751-7464773 TTTTAGGTGTGAGAAGTTGATGG + Intronic
986822427 5:11482317-11482339 TTGTATGTGTAGGTGGTGGAGGG - Intronic
988275847 5:29080269-29080291 TTGTAAGTTGAAGAATTAGAAGG - Intergenic
988437508 5:31193683-31193705 TTGCAAGTGAATGAAGTGGGAGG - Intergenic
989753156 5:44919932-44919954 TTGTATCTGTAACAAGTGTATGG - Intergenic
990166009 5:52993912-52993934 TGGCAAGTGAAAGAAATGGAAGG + Intronic
992115947 5:73538735-73538757 TTGTAAGTCTATGTAGTGTAAGG + Intergenic
992791756 5:80220282-80220304 TTGTAATTTTAAAAAGTAGAGGG - Intronic
993617349 5:90129960-90129982 TTGCAAGTGGAAGAGGTTGAAGG - Intergenic
994176470 5:96717399-96717421 TTGCAAGGCTCAGAAGTGGAAGG + Intronic
994593120 5:101797187-101797209 ATGTAAGTGTTAGGAATGGAGGG - Intergenic
994843501 5:104955619-104955641 TTTTAAGTGGCAGCAGTGGAAGG + Intergenic
998727407 5:145033388-145033410 TTTTAAGTGTATGAATTGGCTGG - Intergenic
998990752 5:147813162-147813184 TTCTAAGTTCCAGAAGTGGAAGG + Intergenic
1000102243 5:158027125-158027147 TTGTAAATGGAAGAGCTGGAAGG + Intergenic
1000543362 5:162568330-162568352 TGGTAACTGAAAGAAGTGAAGGG + Intergenic
1000579653 5:163019842-163019864 TTGTAAGTGCATGAAATTGAAGG - Intergenic
1000810119 5:165851040-165851062 TTTTATGTGGAAGAGGTGGAAGG - Intergenic
1001884468 5:175276649-175276671 TTGTGAGGATTAGAAGTGGAAGG + Intergenic
1005090620 6:22053256-22053278 TTTTAAGTGTAATGATTGGAGGG + Intergenic
1006219389 6:32475535-32475557 TTGTTACTGAAAGAAGTGTACGG - Intergenic
1006228717 6:32563563-32563585 TTGTTACTGAAAGAAGTGTACGG - Intronic
1007248143 6:40477063-40477085 TTGTAAGTCTAATATGTGGTTGG - Intronic
1007251500 6:40498193-40498215 TTGAAAGTGTAAGCAGGAGATGG + Intronic
1009560435 6:65234279-65234301 CTCTAAGAGTAAGCAGTGGATGG + Intronic
1010717526 6:79246568-79246590 CTGTAACTGGAAGATGTGGATGG - Intergenic
1010978116 6:82339666-82339688 TTCTAAATGTATGAAGTGGTAGG - Intergenic
1014342420 6:120227096-120227118 CTGTAAGTGTAGGAAGTCGGTGG - Intergenic
1015044033 6:128757736-128757758 AGGTAAGTGTATGAAGAGGAGGG - Intergenic
1015689855 6:135909967-135909989 TTGCAAATGTAAGCAGTAGAGGG - Intronic
1016685596 6:146879171-146879193 ATGGAAGTGTACGAAGGGGAAGG - Intergenic
1017403263 6:154089010-154089032 TAGTAGGAGTAAGATGTGGAAGG - Intronic
1020089471 7:5330611-5330633 TGGTAAGTGTGTGAAGTGAAGGG + Intronic
1022389802 7:29933681-29933703 ATGTAAGGTTGAGAAGTGGAAGG - Intronic
1022840196 7:34157098-34157120 TTGTAGGTGTGAGATGTGGCTGG + Intergenic
1027928741 7:84502906-84502928 TTGTACGTGTTAGAAAAGGATGG + Intergenic
1028151663 7:87380589-87380611 GTGTAAGTGCAAGAAATGAAAGG + Intronic
1029248071 7:99216856-99216878 TTGAAAGGGTAAGAGGTGGCTGG - Intergenic
1030468801 7:109937523-109937545 TGGGAGATGTAAGAAGTGGATGG + Intergenic
1030578924 7:111327509-111327531 TTTGAAGTGTAAGAAGTACATGG - Intronic
1030730520 7:112982661-112982683 TTATCAGTGTAAAAACTGGAGGG - Intergenic
1031676662 7:124619157-124619179 TGGTAAGTGGAAGAGGTGGCTGG - Intergenic
1031877343 7:127156567-127156589 TGGTGAGTTTAAGAAGAGGAGGG - Intronic
1032379395 7:131460875-131460897 TCGTAAGTGGTAGAAGTGAAGGG - Intronic
1032771222 7:135059051-135059073 TTCTAATTATAAGAAGTGGCCGG - Intronic
1033411207 7:141119367-141119389 TTGCAAGTGGAAGATGTAGAGGG + Intronic
1034354567 7:150442607-150442629 TTGGCAGCGTAAGAAGCGGAAGG + Intergenic
1035960310 8:4129165-4129187 TTGAAAGTGGAAGAAGAGGTTGG - Intronic
1035974094 8:4287694-4287716 TTGTAAGTGTATGAAAGAGAGGG + Intronic
1039690393 8:39858678-39858700 TTGTCAGTGGGTGAAGTGGAGGG - Intergenic
1040345380 8:46487765-46487787 TTGTTATTGAAAGAAGTGTAAGG - Intergenic
1041187414 8:55315313-55315335 TTGTAAATGCAATAAGTGGTTGG + Intronic
1042700649 8:71609141-71609163 TTTTAAGTGTGAGCAGTTGATGG + Intergenic
1043451230 8:80368976-80368998 TTATGAGAGTAAGAAGTGGAAGG + Intergenic
1046363796 8:113198543-113198565 GAGTTAGTGTATGAAGTGGAAGG - Intronic
1050667692 9:7959776-7959798 TTGGAATTGTAGGAAGAGGAAGG - Intergenic
1051216376 9:14802475-14802497 TTGGAAGTATAAGAATGGGAGGG - Intronic
1055193484 9:73557092-73557114 TTGTAAATTAAAGAAGTGCAGGG - Intergenic
1058139920 9:101346475-101346497 CTGTAAGTGTTAGACTTGGACGG + Intergenic
1058631612 9:106993955-106993977 TTTTAAATGTGAGAAGTGCAAGG - Intronic
1062232895 9:135492196-135492218 ATGTACGTTTAAGAAGTGGCTGG + Intergenic
1186498857 X:10034535-10034557 TGGGAGGTGTAAGAAGTGGTTGG + Intronic
1187381666 X:18807482-18807504 TTGTAAGAGCAAGAAGAGGGTGG - Intronic
1189217559 X:39339628-39339650 TTGTAAGTGGCAGAGCTGGATGG + Intergenic
1191591264 X:62887994-62888016 TGGGAAGTGCAAGAAGTGGGGGG + Intergenic
1192084293 X:68080430-68080452 TAGTAAAAGTAAGAAGGGGAAGG - Intronic
1193703159 X:84788972-84788994 TTACAAGTGTAAGAAGGGTAGGG - Intergenic
1195371237 X:104175976-104175998 TTTTAAGGTTAAGAATTGGATGG + Intronic
1197318535 X:124998845-124998867 TTGCAAGTGTAATAAGTGCATGG - Intergenic
1197710646 X:129664653-129664675 TTGCAGGTGTAAGAAGTTTAAGG - Intergenic
1199800444 X:151246252-151246274 TTGGAGGGGTAAGAAGTAGAAGG + Intergenic