ID: 966711631

View in Genome Browser
Species Human (GRCh38)
Location 3:182978978-182979000
Sequence CTGTGGCTGAGTGTTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966711628_966711631 -2 Left 966711628 3:182978957-182978979 CCTGAAGAGCACACATTTCAGCT 0: 1
1: 0
2: 2
3: 19
4: 193
Right 966711631 3:182978978-182979000 CTGTGGCTGAGTGTTTCCCAGGG 0: 1
1: 0
2: 4
3: 15
4: 242
966711627_966711631 2 Left 966711627 3:182978953-182978975 CCATCCTGAAGAGCACACATTTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 966711631 3:182978978-182979000 CTGTGGCTGAGTGTTTCCCAGGG 0: 1
1: 0
2: 4
3: 15
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966711631 Original CRISPR CTGTGGCTGAGTGTTTCCCA GGG Intronic
902226038 1:14996946-14996968 CTGAGGCTGTGTGTTCCCCCAGG + Intronic
902507700 1:16948652-16948674 CTGTGGCTCAGGCTTCCCCAGGG + Intronic
904349225 1:29894093-29894115 CTGTGGCTCTGTGTTTGCCGAGG + Intergenic
904464863 1:30701740-30701762 CACAGGCTGAGTGTTGCCCAGGG - Intergenic
904928851 1:34070349-34070371 TTCTGGCTGACTGTTGCCCAAGG + Intronic
906436069 1:45797676-45797698 CTGGGGCTGCTTGTTTCCCTGGG + Intronic
906559368 1:46744711-46744733 CTGTGGCTGAGGGAAGCCCATGG - Intergenic
908359669 1:63356743-63356765 CTGGTGCTCAGTGTGTCCCATGG - Intergenic
910666404 1:89729468-89729490 CTCTGCCTAAGTGTTTTCCAGGG - Intronic
913148980 1:116021549-116021571 CAATGGTTGAATGTTTCCCATGG + Intronic
913653820 1:120942743-120942765 CTGTGTCTGTGTTTTTCCCTGGG + Intergenic
916076018 1:161200397-161200419 CTCTGGCTGCTTGTTTCCCCAGG + Intronic
916840009 1:168590339-168590361 CTCTGGCTGAGTTTTTACCATGG - Intergenic
917820646 1:178760310-178760332 GTGTGGCTGAGTTTTTCCTTAGG + Intronic
917964257 1:180168418-180168440 CTGTGGCTCAGTTTTGGCCAGGG + Intronic
919320133 1:196026021-196026043 CTGTGCCACAGTGTTTTCCAGGG - Intergenic
920804619 1:209220821-209220843 CTGGGGCTGAGTGCTTTCCTTGG - Intergenic
924556813 1:245125671-245125693 CTGGGGCTGAGGGTTTTCCCAGG + Intronic
1062917473 10:1252411-1252433 CTGTGGAAGAGTCTTTCTCAAGG - Intronic
1065598245 10:27339101-27339123 CAGAGGCTGAATGTTTCCAAGGG - Intergenic
1066244560 10:33569953-33569975 TAGTGGCTGTGTCTTTCCCAAGG - Intergenic
1069592115 10:69648672-69648694 CTGTGGCTGAATGGTGCTCAAGG + Intergenic
1070504935 10:77104692-77104714 CTGTGACTGATTATTTTCCATGG + Intronic
1071464027 10:85923359-85923381 CTGTGGTTTAGTGCTTCACAGGG - Intronic
1074706681 10:116139106-116139128 CTGTGGCTGAGAGTTTGCTGAGG + Intronic
1076367798 10:129933642-129933664 GCGTGGCTGAATGTTTCCTAAGG + Intronic
1076531093 10:131145173-131145195 CTGTGCCTTAATGTTTCCCGTGG + Intronic
1076830795 10:132993231-132993253 CTGTGTCTGAGGGTCCCCCATGG + Intergenic
1077613455 11:3659382-3659404 CTTGGGCTGAGTGATCCCCAGGG - Intronic
1078889169 11:15538581-15538603 CTGTGCCTGAGGGTTTTCCTTGG + Intergenic
1080321099 11:31010233-31010255 TTCTTGCTGAGTGTTTCACAAGG + Intronic
1083271309 11:61574172-61574194 CGCTGGCTGAGTGTTTACTATGG + Intronic
1084686655 11:70700107-70700129 CAGTGGCTAAGTCTTTCACATGG + Intronic
1085106992 11:73853474-73853496 CTGAGGCTCAGAATTTCCCAAGG - Intronic
1085728443 11:78975581-78975603 GTGTGGGTGTGTGTATCCCAAGG - Intronic
1086584272 11:88433433-88433455 CTGGGGCTGAATGTTTTGCATGG - Intergenic
1086598591 11:88605089-88605111 CTGTTTCTCAGTGTTACCCATGG - Intronic
1087336086 11:96846522-96846544 CTCTGGCTTAGCGTTTCTCATGG - Intergenic
1087964389 11:104394253-104394275 CTGGGCCTCAGTGCTTCCCATGG - Intergenic
1088472430 11:110200578-110200600 CTGTGGTGGGCTGTTTCCCATGG + Intronic
1089565755 11:119370775-119370797 GGGTGGCTGAGTTTGTCCCAGGG + Intronic
1089752433 11:120661100-120661122 CTGTGGCTGGCTGTGTCCCCAGG - Intronic
1090927359 11:131260429-131260451 GTGTGGCTGAGTGTGACCAAGGG + Intergenic
1091769167 12:3140235-3140257 ATGTTGTTTAGTGTTTCCCAGGG + Intronic
1092408737 12:8238514-8238536 CTGCAGCTGAGTGTGACCCATGG - Intergenic
1093118855 12:15243928-15243950 CTCTGGCTGAGTCCTTGCCATGG + Intronic
1093418520 12:18948044-18948066 CTGTGGCTGTGTGCTATCCATGG + Intergenic
1095976744 12:47945375-47945397 GATTGGCTGGGTGTTTCCCAGGG - Intergenic
1100063526 12:90611386-90611408 CAGTGGCTCAGGTTTTCCCAAGG - Intergenic
1101210596 12:102531699-102531721 CTGCGGCTCAGTGTCCCCCAGGG - Intergenic
1103243951 12:119439198-119439220 ATGTAGCTAAGTGTTTCCTAGGG - Intronic
1103330407 12:120150141-120150163 CTGTTTCTGAGTGTTTCCAGAGG - Intronic
1103455278 12:121060422-121060444 CTCAGGCTGGGAGTTTCCCAGGG + Intergenic
1104058496 12:125248575-125248597 TTGTGTCTGAGTGTGCCCCATGG + Intronic
1104512562 12:129393862-129393884 CTGTGGCTGAGACATTCCCTGGG + Intronic
1106015256 13:25863223-25863245 CTGTGGCTGGGTGTGTTCCTCGG + Intronic
1107110078 13:36687974-36687996 CTCTGGCTGACTTATTCCCAGGG + Intronic
1107346039 13:39461984-39462006 CTGTGGCTGAGTCTGTCACCTGG + Intronic
1107671478 13:42750643-42750665 AAGTGGCTGAGGGTTTCCCCAGG + Intergenic
1107878250 13:44809495-44809517 CTGCTGCTGAGTCTCTCCCAGGG + Intergenic
1109744676 13:66608680-66608702 TTGGGGCTGAGTGTTGCTCAGGG - Intronic
1111432712 13:88163987-88164009 CTATGGCTGTGTGCTACCCAGGG + Intergenic
1113133660 13:107065012-107065034 CTTTTGCAGAGTGTGTCCCAGGG + Intergenic
1113851416 13:113420848-113420870 CTGGGGCTAGGTGTGTCCCAGGG - Intergenic
1117987974 14:61407358-61407380 CTGTGCCTGGGTGGATCCCAAGG - Intronic
1118250291 14:64153535-64153557 ATGAGGCTGAGTGTTGCCTATGG - Intronic
1118991104 14:70797835-70797857 CTGTGGGTGGATGTTTGCCAAGG - Intronic
1119036750 14:71236764-71236786 GTGTGGCTGAGTTTTAGCCAAGG - Intergenic
1119161472 14:72456222-72456244 CTGGATCTGACTGTTTCCCAAGG - Intronic
1120000801 14:79301261-79301283 CTGTGGCTGAGTGTTTGCCCTGG + Intronic
1120731152 14:88002763-88002785 CTGTGCCTCAGTCTTTTCCAAGG + Intergenic
1121171033 14:91854688-91854710 CTGTGTCTGAATGCTTCCCTGGG - Intronic
1121711536 14:96042394-96042416 CAGGGGCTGAGGTTTTCCCAAGG - Intronic
1122051278 14:99062036-99062058 CTGTATGTGTGTGTTTCCCAGGG - Intergenic
1123006901 14:105328138-105328160 CAGAGGTTGAGTGTTTCCCTAGG + Intronic
1123967916 15:25477535-25477557 CTGATGCTGGGTGTTGCCCAGGG + Intergenic
1123983059 15:25621351-25621373 CTGTGACTGGGAGTTTGCCATGG - Intergenic
1124049114 15:26178722-26178744 CTCTCCCTGAGTGTTTCCAAAGG - Intergenic
1124510557 15:30320783-30320805 ATGTGGCTGAGTGGTTCCCCCGG + Intergenic
1124732331 15:32209744-32209766 ATGTGGCTGAGTGGTTCCCCCGG - Intergenic
1125369667 15:38959423-38959445 CATCTGCTGAGTGTTTCCCATGG - Intergenic
1126831447 15:52611157-52611179 GCATGGCTGAGTGTTTCTCATGG - Exonic
1126988883 15:54347228-54347250 CTTTCGCTGAGTGGTTTCCACGG - Intronic
1127387799 15:58481095-58481117 CTTTGGCCCAGTGTATCCCATGG - Intronic
1128944979 15:71813835-71813857 CTGGGGCTCAGGGTCTCCCAGGG - Intronic
1129869677 15:78932354-78932376 CTGTGGCTGATTTCTTACCAAGG + Exonic
1130746558 15:86660001-86660023 CTGTGGCTTTGTGATTCCCCAGG - Intronic
1131444112 15:92481653-92481675 CTATGACTGAGTGTTTCCCTGGG - Intronic
1133255321 16:4512963-4512985 CTGTGGCTGTGTGGCCCCCAGGG + Exonic
1134407054 16:13969926-13969948 CTGTCTCTGAGTCTTACCCAAGG + Intergenic
1135840578 16:25872608-25872630 CAGTGGCTGTAAGTTTCCCAAGG + Intronic
1136997161 16:35198464-35198486 CTGTGGCTGATCATTTCCGAAGG + Intergenic
1137483844 16:48875205-48875227 ATGTGGTTGAGTGTTTCCTTTGG - Intergenic
1138412588 16:56851789-56851811 CTGTGGCTGTTTGCTTCTCAGGG - Intergenic
1139236266 16:65342758-65342780 CTGTGGCTTTCTGTTCCCCATGG - Intergenic
1139369842 16:66459992-66460014 GTGTGCCTGAGTGCATCCCAGGG - Intronic
1139374285 16:66487144-66487166 CTGTGGGTGAGTGTATTCCTTGG - Intronic
1139588820 16:67921626-67921648 CTGAGGCCAAGTGGTTCCCAGGG - Intronic
1141753851 16:85978312-85978334 CTCTGGGTGAGAGTTTCCAAGGG + Intergenic
1142441501 16:90101152-90101174 ATGTAGCTGAATGTTTCCTAAGG - Intergenic
1142776574 17:2144678-2144700 CTGTGTCTGACAGTGTCCCAGGG - Intronic
1143515775 17:7418570-7418592 ATGTGGATGTGTGTTTCCCCAGG + Exonic
1144719941 17:17462271-17462293 CTGGGGCTGAGGGTGTCCCTGGG - Intergenic
1145366294 17:22269220-22269242 CTGAGGCTGAGTGATTCTGAAGG - Intergenic
1146492571 17:33292878-33292900 CTGGGGCTGAGAGCTTCTCAGGG + Exonic
1147520904 17:41172426-41172448 CTGTGTCATAGTGTTTTCCAAGG - Intergenic
1151366565 17:73620829-73620851 TTGTGGCTGAGTTGTTGCCAGGG + Intronic
1151862815 17:76778131-76778153 CTGTGGCTCAGTGTGGCCCCCGG + Intronic
1152637727 17:81437005-81437027 CTCTGGCTCAGTGGATCCCAGGG - Intronic
1152741400 17:82020018-82020040 CTGTGCCTGAGCCTCTCCCAGGG + Intronic
1153278272 18:3390340-3390362 CTGGGGCTGAGAGTTTCCAGAGG + Intergenic
1156218050 18:35021678-35021700 GTGTGGCTGAGAGTATCACAGGG + Intronic
1156927569 18:42600864-42600886 CTGTAGCTGTGTGGTACCCATGG + Intergenic
1157060135 18:44278427-44278449 CTGTGCCTCAGTATTACCCAAGG + Intergenic
1158875491 18:61730466-61730488 CAGGGAATGAGTGTTTCCCAAGG - Intergenic
1158878641 18:61755303-61755325 CTGTGCCTCAGTTTCTCCCATGG + Intergenic
1161058319 19:2201465-2201487 TTGTGGTTGAGTGTCCCCCATGG + Intronic
1161739424 19:6011475-6011497 CTGTGTCTGTGTGATGCCCACGG - Intronic
1163315013 19:16535694-16535716 CTGTGGCTGAGAGGTGGCCAAGG - Intronic
1166413460 19:42573581-42573603 CTGTAGCTCAGTGGTTCCAAAGG + Intergenic
1166887742 19:45972287-45972309 CTGTGGCTGGGTGTGACACATGG - Intronic
925847843 2:8049815-8049837 CTTTGGATGAATGGTTCCCAAGG - Intergenic
926339328 2:11891932-11891954 CTGTGGTTGAGAGTGGCCCAGGG + Intergenic
927151969 2:20201370-20201392 CTGTGCCTTCGTCTTTCCCATGG - Exonic
928250055 2:29668542-29668564 CTGTGTCTGTGTATTTTCCAAGG + Intronic
933287514 2:80400415-80400437 TTGTGCCTTAGTGATTCCCATGG + Intronic
933818214 2:86086030-86086052 CTGTGCCTGAGTAGTCCCCATGG - Intronic
935359901 2:102238315-102238337 ATGTGACTGGGTCTTTCCCAGGG - Intronic
935681159 2:105638424-105638446 CTGAGTCTGTGTGTTTTCCAGGG - Intergenic
936438485 2:112529228-112529250 GTGTGGCAGAGTGTTACCGAAGG - Exonic
938099984 2:128492141-128492163 CTGGGTCTGCGTGTTCCCCAAGG + Intergenic
938622192 2:133067767-133067789 CTGTTGCAGACTGTTTCCCTGGG + Intronic
938707331 2:133943876-133943898 CTCTGGCTGAGTCTCTCCCAAGG + Intergenic
938842281 2:135174870-135174892 CTGTGGCTGAGTCCCACCCAAGG + Intronic
939466458 2:142562614-142562636 CTGTGGCTCAGGGAATCCCAAGG - Intergenic
940150432 2:150594539-150594561 CTGTGGATGAGCGTTGCCCATGG + Intergenic
941431014 2:165414191-165414213 CTATGTCTGAGTGTATTCCATGG + Intergenic
944967870 2:204956222-204956244 CTTTGGCTGAGAGATTGCCAAGG + Intronic
945327695 2:208501731-208501753 TTATGGCTGAGTGTATTCCATGG + Intronic
946840164 2:223811858-223811880 CTGTGCCAGATTGTTTCCTATGG - Intronic
947765521 2:232634682-232634704 CTCTGGCTCAGTGTCTCCCCAGG - Intronic
1169060321 20:2656167-2656189 TGGTGTCTGAGTGATTCCCAGGG + Intronic
1169789818 20:9397937-9397959 CTGGGGCTGACTGGTTCCCTTGG + Intronic
1171026747 20:21637703-21637725 CTGTGGCTGAGTGTGTCACTAGG + Intergenic
1171820756 20:29835923-29835945 CTTTGGGTGTGTGTTTCCTAGGG - Intergenic
1172501521 20:35431602-35431624 CTGGGGGAGAGTGTTTTCCAAGG + Intergenic
1172601734 20:36188509-36188531 GTGAGGAGGAGTGTTTCCCAAGG - Intronic
1173612227 20:44377885-44377907 CTGTGGATGAGAGTTTCTCTAGG + Intronic
1174069437 20:47889396-47889418 CTGAGGCTGAGTGTGCCCCCTGG + Intergenic
1175463248 20:59171021-59171043 CTGTGGCTGGGGGGTTCACATGG - Intergenic
1176299849 21:5094495-5094517 CTGTGGCTCCGTGTGTCCCAGGG - Intergenic
1176709024 21:10134442-10134464 CTGGGGCTGGATGTTGCCCAGGG - Intergenic
1177959898 21:27650683-27650705 CAGTGTCTGAGTGATTTCCAGGG - Intergenic
1178204246 21:30444419-30444441 CTGTGAGTGTGTGTTTCCTATGG - Intergenic
1178246103 21:30954248-30954270 CTGTGGCAGGATTTTTCCCATGG - Intergenic
1178336640 21:31749490-31749512 GTGACGCTGAGTGTTTCCCAAGG + Intergenic
1179857173 21:44167416-44167438 CTGTGGCTCCGTGTGTCCCAGGG + Intergenic
1181941921 22:26484136-26484158 CTGTGGCTCAGAATTGCCCATGG - Intronic
1184692826 22:46125004-46125026 CTGTGACTGTGTGTTTGTCATGG + Intergenic
1185232394 22:49690647-49690669 CTGTGGCTGAGTGGTGCTCCCGG - Intergenic
949872873 3:8604208-8604230 GTGTGAGTGAGTGTGTCCCAAGG - Intergenic
954785522 3:53089676-53089698 ATGTGGCTGCGTGTTTTCCCAGG - Exonic
955661054 3:61299506-61299528 CTGTGGTTGAGGGTTCCCCCTGG - Intergenic
957094750 3:75768288-75768310 CTGTGGCTGAGTGTGTCGGGGGG + Intronic
957452469 3:80397673-80397695 GTGTGGCAGGGTGTTTCTCATGG - Intergenic
961005657 3:123403659-123403681 ATGTGGCTGATTGATTCTCACGG - Intronic
961887675 3:130107056-130107078 CTGCAGCTGAGTGTGACCCATGG - Intronic
963768199 3:149361000-149361022 CTGTTTCTGAGTGTTGCCAATGG + Intergenic
966711631 3:182978978-182979000 CTGTGGCTGAGTGTTTCCCAGGG + Intronic
967873379 3:194250239-194250261 CTGGAGCTGAGTATTTCACAGGG + Intergenic
968134003 3:196208689-196208711 CTGTGGCTCAGTTTCTCCCTGGG - Intronic
968503726 4:962612-962634 CTGTGTCTGCTTGTGTCCCAGGG - Exonic
969694801 4:8728504-8728526 CTGTAGCCGAGAATTTCCCAGGG + Intergenic
969757199 4:9157690-9157712 CTGCAGCTGAGTGTGACCCATGG + Intergenic
971512842 4:27448293-27448315 CAGTGGGTGAGCATTTCCCATGG - Intergenic
973778965 4:54270782-54270804 CTGTAGATGAGTGTCTTCCAAGG + Intronic
978406324 4:108383068-108383090 GGGTGCCTGAGTGTTTCTCAGGG + Intergenic
978499530 4:109394101-109394123 CTGTGGCTGAGGGTTACTCCTGG + Intergenic
980159263 4:129139391-129139413 CTGTGGATGAGAGATTCCAATGG - Intergenic
982159281 4:152551731-152551753 CTGTGGCAGAATGTGTTCCATGG - Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983768928 4:171523565-171523587 CTGTTGCTCTGTTTTTCCCATGG + Intergenic
985507456 5:291800-291822 CTGTGGATGAGTGTTTGGCCAGG + Intronic
985573655 5:663837-663859 CTGTGGCTGTGTGCGTGCCAAGG + Exonic
985882416 5:2648644-2648666 CTGTGGCTGAGAGTCACCGATGG + Intergenic
986316507 5:6592211-6592233 CTAGCGCAGAGTGTTTCCCAGGG + Intergenic
986735968 5:10667567-10667589 CTGGGTCTGATTGTATCCCAGGG + Intergenic
987118205 5:14743004-14743026 CTGTGGGTGTGTGTTTCACGCGG - Intronic
988065126 5:26222677-26222699 CTGTGGATGAGTGTTTGGCCAGG - Intergenic
990040532 5:51373806-51373828 CAGCTGCGGAGTGTTTCCCACGG - Intergenic
991482820 5:67101376-67101398 CTGAGGCTGAGTCTTTCCCAGGG - Intronic
992107227 5:73459670-73459692 CTATGACTGACTCTTTCCCAAGG + Intergenic
992584717 5:78225270-78225292 CTGTGGCTAAGTGGTTAACATGG - Intronic
994022802 5:95047353-95047375 CCCTGGCTGAATGTTTCTCATGG + Intronic
999378873 5:151106096-151106118 CTGGGGCTGAGTGTTTCCCCAGG + Intronic
1000336205 5:160243400-160243422 GTGTGGCTGTGTGTCACCCAGGG + Intergenic
1001029444 5:168251147-168251169 CTCTGGCTGATTCATTCCCAAGG - Intronic
1001961826 5:175884262-175884284 CAGGGGCTGAGTGTTCCCCATGG + Intergenic
1002669668 5:180856495-180856517 CTGAGGCTAAGTGTTGCCCAAGG + Intronic
1005920221 6:30394914-30394936 CTGTGGCTGACTGCCTCCCGCGG + Intergenic
1006395031 6:33781760-33781782 CAGGGGCTGAGGGCTTCCCAGGG - Intronic
1007971780 6:46059020-46059042 GTGTGGTTGAGTGTTTCTCCAGG + Intronic
1010566662 6:77423483-77423505 CTTTGGGTGAGTGTTCGCCAGGG + Intergenic
1010723793 6:79311482-79311504 CTGGGGGTGAGTGTTTCACAAGG - Intergenic
1012233908 6:96790734-96790756 CTCTGGCTGACAGCTTCCCAAGG + Intergenic
1012413955 6:98992248-98992270 CTGACCCTGAGTGTTTTCCAAGG + Intergenic
1012899444 6:104990419-104990441 CTTTGGATGAGTGTTTCACCTGG + Intronic
1016819951 6:148337946-148337968 CTGTGGGTGAGTGAATTCCAAGG - Intronic
1017526337 6:155244263-155244285 CAGTGGCAGAGTGTTTACAAAGG + Intronic
1017707342 6:157135669-157135691 CTGTTGCTGAGTGTTTGCTGAGG - Intronic
1019253922 7:36594-36616 ATGTAGCTGAATGTTTCCTAAGG + Intergenic
1019643738 7:2118182-2118204 CTGTGGCTGAGTGGCACCCCTGG - Intronic
1021648189 7:22807356-22807378 CTGTGACAGTGTGTTGCCCATGG - Intergenic
1021903004 7:25306278-25306300 CAGTGGCTGTGACTTTCCCAAGG - Intergenic
1022166335 7:27766559-27766581 CTGTGGCAGAGACTTTCCCTAGG + Intronic
1022670215 7:32448621-32448643 CTGTGCCTGAGAGTTTGCCATGG + Intergenic
1023221723 7:37926103-37926125 CTGTGGATGATTAATTCCCAGGG + Intronic
1023365804 7:39461996-39462018 CTGTGGCTGCCTTTATCCCAAGG - Intronic
1023498936 7:40827834-40827856 CTGTGGCTGGATGGTTTCCATGG - Intronic
1024555875 7:50603284-50603306 CTGTGGCTGGCTCCTTCCCAGGG + Intronic
1027692637 7:81367714-81367736 TTGTGGATGAGTGTTTCCTTTGG + Intergenic
1029323921 7:99789287-99789309 CTATGACTGAGAGTTTCCCGAGG + Intergenic
1030078002 7:105753135-105753157 CTGCTGCTGAGTCTTTCTCAAGG + Intronic
1032191555 7:129768834-129768856 CTCTGGCTGCGTGGCTCCCATGG + Intergenic
1032415335 7:131731325-131731347 CATTTGCTGAGTGTTTGCCATGG + Intergenic
1036849133 8:12189655-12189677 CTGCAGCTGAGTGTGACCCATGG - Intronic
1036870494 8:12431929-12431951 CTGCAGCTGAGTGTGACCCATGG - Intronic
1037990562 8:23318937-23318959 CTGAGCCTGACTGTCTCCCATGG - Intronic
1039459407 8:37730864-37730886 CAGTGGCTGAGTGTCTACCCTGG + Intergenic
1041135809 8:54757625-54757647 CTGTGTCTGAGGGCTTCCCCTGG - Intergenic
1041847044 8:62341054-62341076 CTGTAGCTGAGTGTTTCCAAGGG - Intronic
1042401957 8:68360084-68360106 CTGTGGCTTAATTCTTCCCAGGG + Intronic
1044528690 8:93282760-93282782 CTGTGGCTTAGTGCCTCACAAGG - Intergenic
1047356874 8:124130122-124130144 GTCTGTCTGAGTGCTTCCCAGGG - Intergenic
1047759701 8:127945117-127945139 CAGTGGCCGAGTGTTTTTCAAGG + Intergenic
1048440971 8:134458700-134458722 GTGTGGATGTGTGTTTGCCAAGG + Intergenic
1048614710 8:136060081-136060103 CTGTGGCTGAGTTTATCCATTGG + Intergenic
1052824146 9:33163255-33163277 CTGTTGCTGAGCGTCTGCCAGGG - Intronic
1053645996 9:40119961-40119983 CTGGGGCTGGATGTTGCCCAGGG - Intergenic
1053759720 9:41343579-41343601 CTGGGGCTGGATGTTGCCCAGGG + Intergenic
1054327008 9:63717858-63717880 CTGGGGCTGGATGTTGCCCAGGG - Intergenic
1054538574 9:66256015-66256037 CTGGGGCTGGATGTTGCCCAGGG + Intergenic
1055353089 9:75410082-75410104 CTGATGCTGTGTGTTTCTCAAGG + Intergenic
1059744232 9:117184475-117184497 CTGTCCCTGAGAGTGTCCCAAGG - Intronic
1060108334 9:120888821-120888843 CTGTGGGTGAGTGATCTCCAAGG + Intronic
1061082184 9:128378160-128378182 ACGGGGCTGAGTGTTCCCCATGG - Intronic
1061249002 9:129415651-129415673 CTGGGGCTGGCTGTGTCCCAAGG + Intergenic
1061343104 9:129999303-129999325 CTGTGGCTGGCTGGTTCTCAAGG - Intronic
1061792154 9:133064519-133064541 ATGTGGCTGAGGATTTTCCAGGG - Exonic
1062746475 9:138215949-138215971 ATGTAGCTGAATGTTTCCTAAGG - Intergenic
1202793784 9_KI270719v1_random:103412-103434 CTGGGGCTGGATGTTGCCCAGGG - Intergenic
1185857696 X:3551068-3551090 CTGGGGCTAAGGGTTTCCCCAGG + Intergenic
1189200995 X:39195547-39195569 CAGTTGCTGAGGGTTCCCCAGGG - Intergenic
1189263400 X:39694357-39694379 CTTTGCCTGAGTGTTTCCTCTGG + Intergenic
1190916155 X:54812556-54812578 CTTTGGCAGAGTGGTTCTCAAGG + Intronic
1191900094 X:66032010-66032032 CTATGTCTGATTGTTTCTCATGG - Intronic
1193802215 X:85949895-85949917 ATGGGGATCAGTGTTTCCCATGG - Intronic
1199561788 X:149171386-149171408 GTGTGAATGAGTGTTTCCTATGG + Intergenic
1200827792 Y:7661127-7661149 CTGTGGCTGAGTGAATCCCTCGG - Intergenic
1202037037 Y:20646256-20646278 CTGTGGCTAAGTGGTGGCCAAGG + Intergenic
1202372251 Y:24206266-24206288 GTGTGTGTGTGTGTTTCCCAAGG + Intergenic
1202498534 Y:25463854-25463876 GTGTGTGTGTGTGTTTCCCAAGG - Intergenic