ID: 966712008

View in Genome Browser
Species Human (GRCh38)
Location 3:182980693-182980715
Sequence CCCCGGGCGCGGGGGTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966711998_966712008 -7 Left 966711998 3:182980677-182980699 CCCCGCGCGGGGCTTCCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 150
Right 966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG 0: 1
1: 0
2: 5
3: 32
4: 323
966712001_966712008 -9 Left 966712001 3:182980679-182980701 CCGCGCGGGGCTTCCCCCGGGCG 0: 1
1: 0
2: 0
3: 7
4: 136
Right 966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG 0: 1
1: 0
2: 5
3: 32
4: 323
966712000_966712008 -8 Left 966712000 3:182980678-182980700 CCCGCGCGGGGCTTCCCCCGGGC 0: 1
1: 0
2: 1
3: 22
4: 174
Right 966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG 0: 1
1: 0
2: 5
3: 32
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966712008 Original CRISPR CCCCGGGCGCGGGGGTCCCC CGG Intronic
900072108 1:779121-779143 GCCAGGGCCCGGGGATCCCCGGG + Intergenic
900113876 1:1020503-1020525 CCCCGGGAGGGGGGGTCGCCGGG + Intronic
900360609 1:2287127-2287149 CCCCGGGCGGGAGGGTGCGCAGG - Intronic
900570074 1:3353807-3353829 CGCTGGGAGCAGGGGTCCCCAGG - Intronic
901640913 1:10692572-10692594 TCCCGGGCGCAGAGGTCCCCAGG + Intronic
901738264 1:11325971-11325993 CCCCGGGGGCAGTGGTCACCTGG - Intergenic
901762520 1:11479948-11479970 CCGCGCGCGCGAGGGTCCCCAGG + Intronic
902169640 1:14599295-14599317 CCCCGGGTGTGGGGGACCCCGGG - Intronic
903349806 1:22710893-22710915 CCCCGGGCTCGGGGGGCCAGGGG - Intronic
904045191 1:27604294-27604316 CCCCAGGCGCGGGGTCCCCGGGG - Intronic
904688273 1:32275692-32275714 GACCGGGCGCGGGGGTGCCCCGG + Intronic
905108282 1:35576927-35576949 CCGCTGGCGCTGGGGTCCCGCGG - Intronic
905883096 1:41477099-41477121 CCCAGGGAGCGAGGCTCCCCTGG + Intergenic
905972691 1:42153631-42153653 CCCCGGGCCCCGTGCTCCCCCGG - Intronic
906314234 1:44775947-44775969 GGCCCGGCGCGGGGGTCTCCGGG + Intronic
906532777 1:46533059-46533081 CCGCGGGCGCCGGGGCCTCCAGG + Intergenic
911188555 1:94926802-94926824 GGGCGGGCGCGGGGGCCCCCGGG - Intronic
912431455 1:109630442-109630464 CCCAGGACGCTGGGGTCTCCCGG + Intronic
912502277 1:110130348-110130370 CCCTGGGGGCGGGGGACCGCTGG + Intergenic
914813691 1:151047899-151047921 CCCCGGGCGGCGGGGGCCCAAGG + Exonic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
918311354 1:183287794-183287816 CCTTGGGCCTGGGGGTCCCCTGG - Intronic
918996948 1:191773742-191773764 CCCAGGGGGAGGGGGTACCCAGG - Intergenic
919980656 1:202641176-202641198 CCCCTGGAGGGGGAGTCCCCAGG - Intronic
922267044 1:223993076-223993098 GCCAGGGCCCGGGGATCCCCGGG + Intergenic
922748374 1:228059730-228059752 CCCTGGGGACGGGGCTCCCCTGG + Exonic
922753681 1:228082665-228082687 CTCCGGGCGCGGGGCACGCCGGG - Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
924172442 1:241356759-241356781 GCCCCGGCGCGGGGCTCCCGGGG + Intronic
924421877 1:243917352-243917374 CCCCGGCCTCGGGGGCCCGCGGG - Intergenic
924763119 1:247007631-247007653 CTGCGGGCGCGGGGCTGCCCCGG + Intronic
1065883718 10:30059189-30059211 CTCGGAGCGCGGGGGTCCCGGGG - Intronic
1066464417 10:35640377-35640399 CGCCGGGCGCGGGGGGCGCTGGG - Exonic
1067346866 10:45443670-45443692 CGCCGGGCCCTGGGGTCCTCAGG + Intronic
1068505111 10:57890820-57890842 CCCGGGGGGGAGGGGTCCCCTGG - Intergenic
1069532816 10:69231477-69231499 TGCCGGGAGCGGGGGTCCCAGGG - Intronic
1069709406 10:70479113-70479135 CCTCGGGCTGGGGGGTGCCCGGG - Intronic
1069962721 10:72087922-72087944 CCCGGGGCTGGGGGGTCCCAGGG + Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070328999 10:75404865-75404887 CCCCGGGCGCGCAGGCCCCCAGG - Intergenic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1071546728 10:86535446-86535468 CCCCGGGCGTGGCGGCCTCCTGG + Intergenic
1074585897 10:114767918-114767940 CCCCGGGCTCGGGGCTGCCGGGG - Intergenic
1074815205 10:117137434-117137456 TCCAGAGCGCGGGAGTCCCCTGG + Intronic
1075519811 10:123136657-123136679 CCCCGGGCACGGTGCTTCCCGGG + Intronic
1075682293 10:124341533-124341555 CCCAGGGAGCTGGGGTCTCCGGG + Intergenic
1076885771 10:133261767-133261789 CCCCTGCCGCGGGGGCCCCTCGG + Intergenic
1077480614 11:2812754-2812776 CCCCGGGGGCGTGGGGCCTCGGG - Intronic
1078429767 11:11280134-11280156 CCCCGGGCGGGGGGTGCCCTGGG - Intronic
1080034983 11:27700784-27700806 CGCGGGACGCGGGGTTCCCCGGG - Intronic
1081636890 11:44727343-44727365 CGGCGCGCGGGGGGGTCCCCAGG - Intronic
1081967577 11:47178894-47178916 CCCCAGTCCCCGGGGTCCCCAGG - Exonic
1083306415 11:61764272-61764294 CCCAGAGCCCTGGGGTCCCCGGG - Intronic
1083657189 11:64235122-64235144 CGCCGGGGGCGGGGCTCCCTCGG + Intronic
1083661287 11:64252686-64252708 CCCCGGCCCCTGGGGCCCCCAGG - Intronic
1084165586 11:67373424-67373446 GCCCCGGCGCGGGGCTCCCGGGG + Intronic
1084257945 11:67955452-67955474 ACGCGGGCGCGGGGGTCCGGGGG - Intergenic
1084604016 11:70162202-70162224 CCCCGGGCAGTGGGGACCCCAGG + Intronic
1084604047 11:70162278-70162300 CCCCGGGCAGTGGGGACCCCAGG + Intronic
1084814813 11:71639777-71639799 ACGCGGGCGCGGGGGTCCGGGGG + Intergenic
1084814826 11:71639802-71639824 CCGGGGGCGCGGGGGTGCCGGGG + Intergenic
1086034894 11:82403997-82404019 CCCCGGGCGGGCGGCTCCGCCGG - Intergenic
1086887859 11:92225074-92225096 CTCCGGGCGAGCCGGTCCCCCGG - Intergenic
1087083553 11:94194940-94194962 CCCTGGGGGCTGGGGTTCCCTGG - Intergenic
1088685210 11:112279442-112279464 CCCCGGGCCCATGGCTCCCCAGG + Intergenic
1090286590 11:125505053-125505075 GGCTTGGCGCGGGGGTCCCCGGG + Intergenic
1090699256 11:129279452-129279474 CCCCGGGGACGCGGGTCCTCGGG + Intergenic
1091207889 11:133833461-133833483 CCACGGGCCCGAGGGACCCCCGG - Intergenic
1092428177 12:8390240-8390262 ACGCGGGCGCGGGGGTCCCGGGG - Intergenic
1092429258 12:8396393-8396415 ACGCGGGCGCGGGGGTCCGGGGG - Intergenic
1094839091 12:34335515-34335537 CCCCGGACCCCAGGGTCCCCAGG - Intergenic
1095875905 12:47079864-47079886 CCCCGGGCGCGCGGGAACCCCGG - Exonic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1102248285 12:111368833-111368855 CCCTGGGCCTCGGGGTCCCCCGG - Intronic
1103899324 12:124295270-124295292 TCCGGGGCGCGGGGGGCGCCGGG + Intronic
1103951894 12:124555812-124555834 CCCCGGTCCCTGGGGTCGCCTGG + Intronic
1104923498 12:132303428-132303450 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923542 12:132303572-132303594 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923758 12:132304260-132304282 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923814 12:132304436-132304458 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923928 12:132304804-132304826 GCCCGGGCGAGGGTGTGCCCAGG - Intronic
1104923933 12:132304820-132304842 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1105009744 12:132747640-132747662 CACCGAGCGCTGGGGTTCCCTGG - Intronic
1105705595 13:22965869-22965891 CCCCTGGGGCTGGGGTCCCCTGG + Intergenic
1105858499 13:24390854-24390876 CCCCTGGGTCTGGGGTCCCCTGG + Intergenic
1105943423 13:25170730-25170752 CCCCGGGCGCCGGTGTCGCCGGG + Exonic
1106555155 13:30803104-30803126 CCCAGGGCGCGGGAGCCCGCAGG - Intergenic
1106665515 13:31846966-31846988 TCCCGGGCGCTGCGGTTCCCCGG - Intergenic
1111951690 13:94713186-94713208 CCCCGGGCGCGGCGGACTCGCGG - Intergenic
1113542019 13:111115919-111115941 CGCGGGCGGCGGGGGTCCCCGGG + Intronic
1113820657 13:113209872-113209894 CCCCGGGAGCGGGGGCGCCGGGG + Intronic
1114649015 14:24271453-24271475 CGCGGGGGGCGGGGGTGCCCGGG - Exonic
1115752448 14:36505941-36505963 CCTCCTGCGCCGGGGTCCCCGGG + Intronic
1118319133 14:64743112-64743134 CCCCAGGCGAGGTGGTCCTCTGG - Exonic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1119383019 14:74240504-74240526 CCCCGAGCCCGCGCGTCCCCGGG - Intronic
1119535880 14:75402062-75402084 CCTGGGGCGAGGGGGTCCTCAGG + Intergenic
1122113920 14:99518363-99518385 CCCAGGGCTCGGGGGGCCTCCGG - Intronic
1122418228 14:101560521-101560543 ACCCGGGCGCGGGGCGCCACGGG - Intergenic
1122638065 14:103139360-103139382 TCGGGGGCGCTGGGGTCCCCAGG + Intergenic
1122771168 14:104098606-104098628 CCCCAGGCCCTGGGGTCCCCAGG + Intronic
1122795997 14:104206522-104206544 CGCCCAGCGCGGGGCTCCCCAGG + Intergenic
1122816347 14:104316022-104316044 GGCCGGGTGGGGGGGTCCCCAGG + Intergenic
1122864435 14:104597172-104597194 GCCTGGGGGCGGGGGTCGCCTGG - Intronic
1122905939 14:104801575-104801597 CCCCAGGGGCAGGGTTCCCCGGG - Exonic
1123038979 14:105482744-105482766 CCCTGGGAGCAGGGGTACCCAGG - Intergenic
1124966721 15:34437401-34437423 GCCAGGGCGCGGGGCTGCCCCGG + Intronic
1124983343 15:34583519-34583541 GCCAGGGCGCGGGGCTGCCCCGG + Intronic
1127577666 15:60307803-60307825 CCCCAGGCGTGGAGCTCCCCAGG - Intergenic
1128720153 15:69942078-69942100 CCCGTGGCGCTGGGCTCCCCAGG + Intergenic
1129659189 15:77543481-77543503 CCACGGGCTCAGGGGTCCCTGGG + Intergenic
1132398234 15:101489578-101489600 CCGCGGGCGCGGGGGGCGCGGGG - Exonic
1132683830 16:1154092-1154114 CCCGGGGCGCGGGACTCCCTCGG + Intronic
1132697921 16:1210177-1210199 ACCTGGGGGCGGGGGTCCCGTGG - Intronic
1132913556 16:2328871-2328893 CCCCGTGCGCTGGAGTCTCCCGG - Intronic
1132968637 16:2673663-2673685 CCCCGGGGGCGGGGCTCTGCGGG + Intergenic
1133115509 16:3576075-3576097 CCCAGGGTGCTGGGCTCCCCAGG - Intronic
1133350500 16:5097839-5097861 GGCGGGGCCCGGGGGTCCCCCGG + Intergenic
1133370051 16:5240113-5240135 ACGCGGGCGCGGGGGTCCGGGGG + Intergenic
1135040704 16:19114861-19114883 GGCCGCGCCCGGGGGTCCCCCGG + Exonic
1136491309 16:30610089-30610111 CCTCGGGCGCTGGCGGCCCCTGG + Exonic
1136540940 16:30927459-30927481 CCCCAGACGCCGGGGTCCCAGGG - Intronic
1136546495 16:30957886-30957908 CCTCGGCCCCGTGGGTCCCCCGG + Exonic
1140223181 16:73058430-73058452 GCCCGGACGCGGGGCTCCTCGGG - Intronic
1141280673 16:82627632-82627654 CCCAGGGCGCCCGGGCCCCCTGG + Intronic
1141608662 16:85169483-85169505 CCCGGGGCGCGCGGGGGCCCGGG + Intergenic
1141972369 16:87492513-87492535 CCCCGTGAGCGGGGGGCCCGAGG - Intergenic
1142671035 17:1487495-1487517 GCCCCCGCTCGGGGGTCCCCAGG - Intronic
1142966477 17:3585093-3585115 CCCCTGGCCTGGGGGTCCCCAGG - Intronic
1143175667 17:4953552-4953574 CCCCCGGGGTGGGGGTTCCCAGG + Intronic
1143181613 17:4987365-4987387 TGCCGGGTGCGGGGGTCTCCGGG + Intronic
1143387186 17:6538051-6538073 CCCCGGGCGGCGGTGCCCCCTGG - Exonic
1143749958 17:9021164-9021186 CCCCGGGCGTGAGGCTCTCCGGG + Intergenic
1144067998 17:11641605-11641627 TCCAGGGCTGGGGGGTCCCCGGG - Intronic
1145940924 17:28743201-28743223 CCCGGGGCTGGGCGGTCCCCGGG + Exonic
1146062057 17:29612824-29612846 CCGCGGGCGCGCGGGGCCACGGG + Intronic
1146305772 17:31728835-31728857 CCCCAGGTGCAGGAGTCCCCAGG - Intergenic
1146581200 17:34040124-34040146 CCCCGGGCCCGGGCGGCCACGGG + Intronic
1148122556 17:45221679-45221701 CCATGGTTGCGGGGGTCCCCCGG + Intronic
1148615070 17:48995860-48995882 CCCTGGGCGAGGGGGTTCCAGGG + Intergenic
1148664029 17:49361717-49361739 CCCCGGGCGCTGAGCTCCTCAGG - Intronic
1148782447 17:50129618-50129640 CCCCGGCCGCGGGGGGCTCCGGG + Exonic
1149610386 17:57954952-57954974 CCCCGGGCGCGGGGGGCGTGCGG - Intronic
1150675742 17:67245028-67245050 CCCCGGGCGCGGCGGCCCCGGGG - Intronic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1152029391 17:77832294-77832316 CCCCCGGGGCTGGGGACCCCTGG - Intergenic
1152683741 17:81683647-81683669 ACCGGGGCGCGGGGGGCACCCGG - Intronic
1152689766 17:81712604-81712626 CCCCGGGCGCGGCGATCCCCGGG - Intronic
1152736439 17:81999683-81999705 CCCCGGCCTCGGCTGTCCCCTGG + Intronic
1152861176 17:82697887-82697909 CCCCGGACACGCGGGACCCCTGG + Intronic
1152945348 17:83194905-83194927 CCTCTGGAGCAGGGGTCCCCAGG - Intergenic
1153805408 18:8705678-8705700 CCCCGCGGGCGGAGGTGCCCCGG + Intronic
1160053232 18:75455888-75455910 CCCCGCGCTCGCGGGTTCCCGGG - Intergenic
1160329310 18:77977578-77977600 CCACGGGGTGGGGGGTCCCCTGG - Intergenic
1160719369 19:590614-590636 CCCCGCGCGCCCGGCTCCCCGGG - Intronic
1160725696 19:616929-616951 CCCCGTCCGCGCGCGTCCCCCGG + Exonic
1160767458 19:814782-814804 CCACTGGAGCTGGGGTCCCCAGG - Intronic
1160772627 19:839862-839884 TCCCGGGAGCTGGGGTCCCCCGG + Intergenic
1160847810 19:1174069-1174091 CCCCGGGCGCAGGGGTCCGCGGG + Intronic
1160924164 19:1535131-1535153 CTCTGGGAGCAGGGGTCCCCTGG + Exonic
1161028161 19:2046146-2046168 CCCAAGGCGCTGGGTTCCCCAGG + Intronic
1161153609 19:2721467-2721489 CCCCGTGGGCGCGGGTCCCCGGG - Intronic
1161264672 19:3358791-3358813 GACCTGGGGCGGGGGTCCCCTGG - Intergenic
1161468653 19:4445695-4445717 ACCTGGGCGCGGGGATGCCCCGG + Intronic
1162798201 19:13097568-13097590 CTCCGGCCGCGGGTCTCCCCGGG + Intronic
1163390279 19:17026652-17026674 CCCCAGGCGCGGCGCCCCCCAGG - Exonic
1163427090 19:17245733-17245755 CCGCGGGCGCCGGGGGACCCAGG - Exonic
1163606825 19:18280325-18280347 CTCGGGGAGGGGGGGTCCCCAGG + Exonic
1164625414 19:29724401-29724423 CTGCGGGCGCGGGGGTCCCCAGG - Intergenic
1164639417 19:29812845-29812867 CTACGGGGGCGGGGGTCCCTTGG + Intronic
1165080542 19:33303611-33303633 CGCCGGGCGCTGTAGTCCCCGGG + Intergenic
1165242911 19:34481855-34481877 CCCCGCGCCCAGGGGTCCCGGGG + Exonic
1165349648 19:35268998-35269020 CGCCGGGCTCGGGGCCCCCCCGG + Intronic
1167149104 19:47698816-47698838 CCCCACGGGCTGGGGTCCCCTGG - Intronic
1167293190 19:48635612-48635634 GCCCGGGCGGGGGCGTGCCCAGG + Exonic
1167377543 19:49119820-49119842 ATCTGGGCTCGGGGGTCCCCTGG - Intronic
925068904 2:951004-951026 GGCCGGGGGCGGGGGTCCCTCGG - Exonic
925912663 2:8583567-8583589 CACCGGGCGCCGGATTCCCCGGG - Intergenic
926162831 2:10500769-10500791 TCCCGGGCTCGTGAGTCCCCGGG - Intergenic
927956522 2:27211391-27211413 CGCCGGGAGCAGGGATCCCCTGG + Intronic
929452904 2:42048412-42048434 CCCCGGGCCCGGGGCCCCCGCGG - Exonic
929501297 2:42493645-42493667 CCGCTGGCCCGGGGGTCCCTGGG + Exonic
929568771 2:43006724-43006746 CCCAGGGAGTGGGGGTGCCCTGG - Intergenic
929647010 2:43637626-43637648 CCACGGGCGCGAGGGACCGCCGG - Intronic
931671642 2:64653565-64653587 CCGCGGGCGCGGGGGGCTCCGGG - Intronic
932058215 2:68467773-68467795 CCCCGGGCGCCAGGGCCACCCGG - Exonic
932699785 2:73984856-73984878 TCCCGGGCGGGGGAGTCCCCGGG + Intergenic
933751108 2:85602540-85602562 CCCGGGACGCGAGAGTCCCCAGG + Intronic
934522030 2:95025683-95025705 ACCCGCGCGCGGGGGCGCCCAGG + Exonic
936104810 2:109614780-109614802 CCTCGGGCTCGGCGGTCACCTGG - Exonic
937083807 2:119157989-119158011 CCAGGGCCGCGGGGGCCCCCTGG - Exonic
938406294 2:131035015-131035037 CCCCGGGCGCTGCGGGCCACCGG + Intronic
941808693 2:169734376-169734398 CCCGGGGCGGGGCGGTCTCCGGG + Intronic
943692320 2:190881274-190881296 CCCCGCGCGAGGGGCTCCGCCGG - Exonic
946348375 2:219129764-219129786 CCCGGGGCGCACGGCTCCCCTGG - Intronic
946363012 2:219230347-219230369 CCCCAGGCGCGTGGCTCACCAGG - Exonic
946403994 2:219483340-219483362 CCCCAGTCTCTGGGGTCCCCAGG - Exonic
946412616 2:219522706-219522728 CGACGGGGGCGGGGGTCCCGAGG - Intronic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948116017 2:235494604-235494626 CCCCGGGCTCGGCGGCCCGCGGG + Exonic
948467444 2:238159085-238159107 CCCCAGGCTCCGGGGACCCCAGG - Exonic
948789991 2:240372189-240372211 GCTGGGGCGTGGGGGTCCCCTGG + Intergenic
948910237 2:240999060-240999082 CCCCGGGCTCGCGGGGCGCCCGG + Intronic
1170011141 20:11725416-11725438 CCCTGGGGAAGGGGGTCCCCTGG - Intergenic
1172100876 20:32483518-32483540 GCCCGGGGGCGGGGGTGGCCAGG + Intronic
1172118766 20:32585633-32585655 TCCCGGACGCGGCGGTCCCGCGG + Intronic
1172408209 20:34704561-34704583 GCCCGGGCGCGGGGGGCGCAGGG - Intronic
1172656345 20:36541064-36541086 CACCGGGCGTAGGGGTCCCTGGG + Intergenic
1173741711 20:45406601-45406623 CCCAGGGCCCGTCGGTCCCCCGG + Intronic
1173750305 20:45470622-45470644 CCCCGGACCCGGGGACCCCCGGG + Intronic
1174081619 20:47974138-47974160 GCCCCGGCGTGGGGGCCCCCTGG + Intergenic
1174390535 20:50216118-50216140 CCCAGGGAGGGTGGGTCCCCGGG + Intergenic
1174804354 20:53593441-53593463 CGCCGGGAGCGGGGGTCTGCGGG - Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175333485 20:58179994-58180016 CCCCGCGCGTGGGTGGCCCCCGG + Intergenic
1175723291 20:61300480-61300502 CCCTGGGCACAGGGCTCCCCTGG + Intronic
1175981177 20:62739442-62739464 CCCTGGGCTCAGGGGGCCCCAGG - Intronic
1176095908 20:63344542-63344564 CCCCCGGCAGGAGGGTCCCCCGG + Exonic
1176274488 20:64255962-64255984 CTCCGGGCGCAGGGGTGCCGGGG - Intronic
1176555512 21:8252672-8252694 CCGCAGTCGCGGCGGTCCCCCGG - Intergenic
1176733624 21:10522337-10522359 CGCCGGGAGCGGGGGTCCGGGGG + Intronic
1179162487 21:38909720-38909742 TCCCTGGGGTGGGGGTCCCCAGG + Intergenic
1179581584 21:42347807-42347829 CCCCGGGGGAGGCGGTCCCAGGG - Intronic
1180190838 21:46161785-46161807 CCCCGCCCGCCTGGGTCCCCGGG + Intronic
1180738265 22:18034920-18034942 CCCCCGTGGCGGGGCTCCCCTGG + Intergenic
1181032530 22:20155267-20155289 CCCCGTGAGTGGGGGACCCCAGG - Intergenic
1181082795 22:20425594-20425616 CCCTGGGCGCGCAGGGCCCCAGG - Exonic
1181329154 22:22075534-22075556 ACCAGGGCTCCGGGGTCCCCAGG + Intergenic
1181477965 22:23180400-23180422 CACAGGGCGGGGGGGCCCCCTGG - Exonic
1183393809 22:37560595-37560617 GCCCGGGCGCGCGGGTCCTCGGG + Intronic
1183504491 22:38201848-38201870 CCCCGGGGGCGGGGCTTCCAGGG + Intronic
1183535380 22:38398123-38398145 CGCCGGGAGCGGGGGTCCGGGGG - Intronic
1183650906 22:39152757-39152779 CCCCGGGGGCGGGGTTCCGATGG - Intergenic
1183720188 22:39557901-39557923 CCCGGGGCGCGGGGGGCGGCGGG - Intergenic
1184141830 22:42582010-42582032 CCGGGAGCGCGGGGGTCGCCGGG + Intergenic
1184523562 22:45009122-45009144 CCCGGGGCGCGGGGGCCCGAGGG + Intronic
1184586486 22:45451603-45451625 CCCTGGGCGAAGGGGTCCACTGG + Intergenic
1184668493 22:46000885-46000907 CCAAGGACACGGGGGTCCCCTGG + Intergenic
1184698128 22:46150806-46150828 CCCCGGGCCCCCGGGTCCCCGGG - Intronic
1184718827 22:46297205-46297227 ACTCGGGCCCTGGGGTCCCCTGG + Intronic
1185344589 22:50305786-50305808 CTCGGGGCGAGGGGGTCCCTGGG + Intronic
950043247 3:9933524-9933546 GTCCCGGCGCGGGAGTCCCCGGG - Exonic
951543768 3:23806430-23806452 CCCCAGGGGCGGGGGTTCGCGGG + Intronic
953485119 3:43287054-43287076 CCCAGGGCGCGGGGCCCCGCGGG - Intronic
953705440 3:45226516-45226538 CCCGGAGCGCGGGGGCGCCCGGG - Intergenic
954697587 3:52435865-52435887 CCCCGGGCTGGGGGCTCCTCTGG + Exonic
955687582 3:61562154-61562176 CGCCGAGCGCGGGGGGCCCGTGG + Exonic
960914378 3:122681240-122681262 CCCGGGGCGCTGCGGTTCCCCGG + Intronic
961779922 3:129315438-129315460 CCCCGGGCGCGGCCGGCTCCCGG - Exonic
961827220 3:129605493-129605515 CGCGGGCCGCGGGGGACCCCTGG + Exonic
962751003 3:138434823-138434845 CCCAGGGCGCTGGGGGCCCCGGG - Exonic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
968230783 3:197003434-197003456 CCCCGGGCGCCGGGGCCGCTGGG + Exonic
968662815 4:1805803-1805825 CTGCGGGCGCGGCGGCCCCCGGG + Exonic
968901667 4:3435038-3435060 CTCCTGGGGCTGGGGTCCCCTGG + Intronic
969016486 4:4107250-4107272 ACGCGGGCGCGGGGGTCCGGGGG - Intergenic
969682232 4:8649757-8649779 CCCCCGGCCCCGGGGGCCCCGGG - Intergenic
970407653 4:15778791-15778813 TCCCGGGCTCGGGGCTCCGCGGG + Intronic
971250747 4:24971328-24971350 CCCAGGCCGAGGGCGTCCCCCGG - Intronic
975409977 4:74038483-74038505 CCCGGCGCCCTGGGGTCCCCGGG - Intronic
975415365 4:74098992-74099014 CCCGGCGCCCTGGGGTCCCCGGG - Intronic
976129578 4:81870549-81870571 CCCCGAGAGCAGGGGTGCCCAGG - Intronic
978282538 4:107035592-107035614 CTCCCGGCGAGGGGGTCCCCAGG + Exonic
981429844 4:144646008-144646030 CCCCGCGCGAGCGCGTCCCCCGG - Exonic
982232647 4:153223063-153223085 GCCCGGGCGGGAGGGTTCCCAGG - Intronic
982460901 4:155667621-155667643 CCCAGGGCCCGGGGGACCCGCGG + Intronic
985537271 5:472485-472507 CACCTGGCGCGGAGGTCGCCCGG - Intronic
985537361 5:472817-472839 CCCCGGGCGCGGGGCTCGGTTGG + Exonic
987340459 5:16935499-16935521 CACCTGGCGCGGGTGTCCCAGGG + Intronic
991587468 5:68215523-68215545 CCCCAGCCGCGGGGATGCCCCGG - Intergenic
992106296 5:73451485-73451507 GCCCGGGCGCGAGGGCCCGCAGG - Intergenic
997291290 5:132737438-132737460 CCCCGGGCGGGGACGTCCGCCGG - Exonic
997377768 5:133409529-133409551 CCACAGGAGCGGGGGTCCTCAGG - Intronic
997510799 5:134452529-134452551 CCCCAGAAGAGGGGGTCCCCAGG - Intergenic
1001035042 5:168291611-168291633 CGCCGGGCGCCTGGGTTCCCGGG - Intergenic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1003098159 6:3157803-3157825 CCACGGGCACGGGCGACCCCTGG + Intergenic
1006634545 6:35452553-35452575 CACCGGACGCGGGGCTCCCTGGG + Exonic
1007320944 6:41028408-41028430 CCCCGAGCGCGGGGGCGCCCGGG - Exonic
1007633485 6:43285212-43285234 CCCCGGGGCGGGGGGACCCCGGG - Exonic
1007759668 6:44126839-44126861 CCCCAGGCCAGGGGGTTCCCTGG - Intronic
1010832738 6:80551114-80551136 CCCAGGTGGCGGAGGTCCCCAGG - Intergenic
1011277042 6:85642264-85642286 CCCCGGGCGCCGACGACCCCCGG + Intronic
1014741753 6:125154573-125154595 CCCGTGGCGCGCGGGGCCCCCGG + Intronic
1015842306 6:137488785-137488807 CGACGGGCTAGGGGGTCCCCGGG - Intergenic
1015880463 6:137866595-137866617 CCACGGGGTCGGGTGTCCCCTGG + Intergenic
1016386772 6:143537114-143537136 CCGCGGGGGCTCGGGTCCCCGGG - Intronic
1017842241 6:158231915-158231937 GGCCGGGGGCGGGGGTCTCCCGG + Intergenic
1018740971 6:166728351-166728373 ACCTGGACGCAGGGGTCCCCCGG + Intronic
1018940755 6:168307851-168307873 CCACGGGCCTGGGGGGCCCCAGG + Exonic
1019177282 6:170166565-170166587 CCCCGGGTGCCGGGGTCACCTGG - Intergenic
1019261821 7:86173-86195 CCGTGGCCGTGGGGGTCCCCAGG - Intergenic
1019298069 7:289641-289663 TTCCGGGCGCCGGGATCCCCGGG - Intergenic
1019336407 7:485012-485034 CCTCGAGCGCGGGGGACCCTGGG - Intergenic
1019340118 7:504887-504909 CCGCGGGCGCGTGGGCTCCCAGG + Intronic
1019475421 7:1241815-1241837 CGCCGGGCGCGGGGAGACCCCGG - Intergenic
1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG + Intergenic
1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG + Intergenic
1020268382 7:6577307-6577329 ACCCGGCCACGGAGGTCCCCAGG + Intergenic
1020560570 7:9726209-9726231 CCCCAGGCGCGGCGCCCCCCAGG + Intergenic
1022097098 7:27147923-27147945 CCTCGGTCGCCGCGGTCCCCGGG - Intronic
1022110215 7:27225553-27225575 CCCAGGGCGCGCGGCTTCCCGGG - Intergenic
1022207484 7:28179426-28179448 CCCCGGGCCCGGGAGACGCCGGG - Intronic
1025739127 7:64182330-64182352 CCTCGGGCACAGGGGTCCGCCGG - Intronic
1027219010 7:76202205-76202227 CCCCGGGCGCCTGGCACCCCCGG - Intronic
1029074950 7:97928052-97928074 ACGCGGGCGCGGGGGTCCGGGGG - Intergenic
1029445946 7:100612837-100612859 CCCCCTGGGCGGGGGTCCCGGGG + Exonic
1029546174 7:101211759-101211781 CCCTGGGCACCGGGCTCCCCAGG - Intronic
1031629667 7:124032293-124032315 CCCCTGGCTGGGGGCTCCCCCGG + Exonic
1032707325 7:134432645-134432667 CCCCGGGAGTTGGGGACCCCTGG + Intergenic
1032844953 7:135744537-135744559 CCCTGTGCGTGGGGGTCCTCTGG + Intronic
1034278950 7:149838516-149838538 CTCCGGGAGCCTGGGTCCCCGGG + Exonic
1035167417 7:156999992-157000014 CCCGGGGCCGGGGGGTCCTCAGG + Intronic
1035580601 8:737477-737499 CGCGGGGCGCGCGGGTCACCCGG - Intronic
1035747913 8:1974547-1974569 CCCGGGGTGCGGGGGTGTCCTGG + Intronic
1036259273 8:7227798-7227820 CCAGGGGCGCGGGGGTGCCGGGG - Intergenic
1036311326 8:7686393-7686415 ACGCGGGCGCGGGGGTGCCGGGG - Intergenic
1036899247 8:12659100-12659122 ACGCGGGCGCGGGGGTCCGGGGG - Intergenic
1036900316 8:12665248-12665270 ACGCGGGCGCGGGGGTCCGGGGG - Intergenic
1039527835 8:38231965-38231987 CCCCAGGCTCGGGGCTTCCCGGG - Intronic
1040564839 8:48556156-48556178 CCCTGGGCACGGGGGCACCCTGG - Intergenic
1041712943 8:60910070-60910092 CCCCGGGCGCGCAGGGCCCGCGG - Intergenic
1042399651 8:68331084-68331106 CCACGCGCGCGTGGCTCCCCGGG + Exonic
1044666753 8:94640528-94640550 CCCGGGGCGCGGAGCTGCCCAGG - Intergenic
1044692871 8:94896180-94896202 CCCTGAGCGCGGTGGTCCCCGGG + Intronic
1044821815 8:96160433-96160455 CCCCGGGCGCAGGAGCCGCCAGG - Exonic
1045231247 8:100309614-100309636 GCCCAGGCGCGGGCGTCTCCCGG - Intronic
1045737991 8:105318785-105318807 CTCCGGGCGCTGGGCTCCTCCGG - Exonic
1047422444 8:124718350-124718372 GACCTGGAGCGGGGGTCCCCTGG - Intronic
1047961681 8:130016146-130016168 CGGCGGGCGCGGGGGTCCCGGGG - Intronic
1049384924 8:142338364-142338386 CCCAGCACGAGGGGGTCCCCAGG + Intronic
1049558503 8:143295868-143295890 CCCCGGGCGTTGGGGTCTCTTGG + Exonic
1049621105 8:143598667-143598689 CCCCGGGCGCAGGGGACCCCGGG + Exonic
1049762560 8:144337782-144337804 CGCCGGGCGCGGGGGCTCCGGGG + Intergenic
1051174015 9:14346121-14346143 CCGCGGGCGCGGGGGGCGCGTGG + Intronic
1053003526 9:34590485-34590507 CCCCGCGCGAGGGGGTGACCGGG - Intergenic
1053149262 9:35732430-35732452 CCCCGAGGGCGGGGGTTCCGGGG - Exonic
1056406653 9:86282086-86282108 TCCCGGGGGTGGGCGTCCCCGGG - Intronic
1056787593 9:89604164-89604186 CGCCGCGCGTGGGGGTCGCCGGG - Intergenic
1057305775 9:93911197-93911219 CTCCGGGCAGGGTGGTCCCCTGG - Intergenic
1058866596 9:109167009-109167031 CCCGGGGGGCCGGGGACCCCGGG - Exonic
1059414735 9:114155810-114155832 CCCTGGGCGCGGGGCTGCGCTGG + Exonic
1060856011 9:126915215-126915237 CCAGGGGCGCGCTGGTCCCCGGG + Intronic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1061149103 9:128818848-128818870 GCCCGGGCCGCGGGGTCCCCCGG - Exonic
1061208460 9:129177436-129177458 GCCGGGGCGCGAGGGTCCCGCGG + Exonic
1061415576 9:130445236-130445258 CCCCGGGGGCGCGAGTCCCCGGG + Intronic
1061517228 9:131096860-131096882 CCCTGGGCGCGGGGCTTACCCGG - Exonic
1061975855 9:134067806-134067828 CCCCGGGCGCCCGGTTCACCCGG + Intronic
1062039233 9:134396506-134396528 TTCCGGGCGGGGGGGTCCCCAGG + Intronic
1062342643 9:136100583-136100605 CCCTGGGCTCTGGGGCCCCCTGG - Intergenic
1062447620 9:136602217-136602239 CCCCGGCCGCAGGAGTCCCGTGG - Intergenic
1062625940 9:137441562-137441584 CCCCGGGGGCGGGGCGACCCTGG - Intronic
1189308602 X:40005395-40005417 CCCGGGGCGCGGGCGAGCCCTGG + Intergenic
1190245657 X:48688795-48688817 GCCTGGGGGTGGGGGTCCCCGGG - Exonic
1195923190 X:110002694-110002716 CGCCGGGCGCTCGGTTCCCCTGG - Intronic
1198267366 X:135022094-135022116 CCCCAGGCCCGAGGGTCTCCCGG + Exonic
1198268521 X:135032727-135032749 CCCCAGGCCCGAGGGTCTCCCGG - Exonic
1199772779 X:150984540-150984562 CCCCGGCCCCGCGCGTCCCCCGG + Intronic
1199975815 X:152894375-152894397 CCCTGGAGGCAGGGGTCCCCAGG - Intergenic
1200000189 X:153056250-153056272 CCCCCGCCACGGGGGCCCCCGGG - Intergenic