ID: 966716915

View in Genome Browser
Species Human (GRCh38)
Location 3:183021959-183021981
Sequence GTGGACAGTAGGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 492}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966716915_966716926 22 Left 966716915 3:183021959-183021981 CCATCCACCTTCCTACTGTCCAC 0: 1
1: 0
2: 3
3: 32
4: 492
Right 966716926 3:183022004-183022026 TCCACAGACTCCTCTCTCAGTGG 0: 1
1: 0
2: 6
3: 15
4: 239
966716915_966716922 -1 Left 966716915 3:183021959-183021981 CCATCCACCTTCCTACTGTCCAC 0: 1
1: 0
2: 3
3: 32
4: 492
Right 966716922 3:183021981-183022003 CCTTCCCCACAAGGAACAACTGG 0: 1
1: 1
2: 3
3: 16
4: 179
966716915_966716919 -10 Left 966716915 3:183021959-183021981 CCATCCACCTTCCTACTGTCCAC 0: 1
1: 0
2: 3
3: 32
4: 492
Right 966716919 3:183021972-183021994 TACTGTCCACCTTCCCCACAAGG 0: 1
1: 0
2: 2
3: 9
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966716915 Original CRISPR GTGGACAGTAGGAAGGTGGA TGG (reversed) Intronic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
901163767 1:7199725-7199747 GTGGAAAGGAGGATGGTGGCTGG + Intronic
901441710 1:9282143-9282165 GAGGACTGCAGGAAGGTGCACGG - Intergenic
901699820 1:11039315-11039337 GTGGATGGAAGGATGGTGGATGG + Intronic
902099196 1:13971778-13971800 GAGGACAGTACCAAGGGGGATGG - Intergenic
902127343 1:14226901-14226923 GTGGACAGTGGGAAAGTGTGAGG + Intergenic
902918953 1:19655358-19655380 GTGGACTGTGGGAAGGTGTTGGG - Exonic
904433338 1:30479178-30479200 GTGGAGGGTGGGGAGGTGGAGGG - Intergenic
904594252 1:31633085-31633107 GTGGACAGTAGGTGGGTAGGTGG - Intronic
904915200 1:33965213-33965235 GTGGAAAGTGGGAAGCAGGAGGG - Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905204499 1:36335509-36335531 GTGGACAGTTGGAGGCTGGGCGG - Intergenic
905405258 1:37728218-37728240 GTGGCAAATAGGAAGCTGGAGGG + Intronic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
906016602 1:42587291-42587313 TTGGAAAGTAGGAAGTTGGCTGG - Intronic
906149578 1:43579722-43579744 GGGGACAGTATGAGGGTAGAAGG - Intronic
906566260 1:46803305-46803327 GTGGGCTGGAGGAAAGTGGAAGG + Intronic
907471948 1:54679817-54679839 GGGGGCAGCAGGAAGGTGGGAGG - Intronic
909070566 1:70988531-70988553 CTGGTCAGTAGGAAGGAGGAAGG - Intronic
909401237 1:75233359-75233381 ATAGACAGTGGGAACGTGGAAGG - Intronic
913048697 1:115096131-115096153 GGGGCCTATAGGAAGGTGGAAGG - Intergenic
913372153 1:118111631-118111653 TTGGACTGGAGGAAGCTGGAAGG + Intronic
913653479 1:120940014-120940036 AGGGAAAGAAGGAAGGTGGAGGG + Intergenic
914167618 1:145189014-145189036 AGGGAAAGAAGGAAGGTGGAGGG - Intergenic
914351337 1:146842890-146842912 GTGGATAGGTGGATGGTGGATGG + Intergenic
914519170 1:148400138-148400160 AGGGAAAGAAGGAAGGTGGAGGG + Intergenic
914643663 1:149634173-149634195 AGGGAAAGAAGGAAGGTGGAGGG + Intergenic
915299941 1:154946119-154946141 GGAGCCAGCAGGAAGGTGGAAGG - Exonic
915348808 1:155212082-155212104 GTGGACACTAGGGAGCTGCAAGG - Intronic
915471540 1:156128701-156128723 GTGCAAAGGAGGAAGGTGAATGG - Intronic
915936118 1:160091272-160091294 GTGCATAGTAGGGAGGTGGTTGG - Intergenic
915980177 1:160415499-160415521 GTGGACAGCAGGAACCTGGGTGG + Intronic
918170225 1:181989274-181989296 GGGGACAGTAAAAAGGTGGCAGG - Intergenic
919714974 1:200766763-200766785 ATGGGAAGTAGTAAGGTGGAAGG + Intronic
921074983 1:211693371-211693393 GTGGGCAGTAGGAAGAAAGATGG - Intergenic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922729495 1:227942345-227942367 GTGCAGAGCAGGAAGGAGGAAGG + Intronic
922899756 1:229127446-229127468 GTGGCTAGTGGGAAGGTGCAGGG + Intergenic
923533758 1:234832119-234832141 GGGGACAGTAGAAATGGGGATGG - Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
1062833618 10:622336-622358 GGGGAAAGGAGGAAGGGGGAGGG + Intronic
1063047008 10:2402089-2402111 GTGAACAGGAGCAAGGGGGATGG - Intergenic
1063613217 10:7580674-7580696 GAAGACAGCAGGAATGTGGAGGG + Intronic
1063847328 10:10145218-10145240 GGGAGCAGTAGGAAGGAGGAGGG - Intergenic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064026633 10:11853798-11853820 GTGTGCAGTAGGGAGGAGGAAGG - Intronic
1064080175 10:12301985-12302007 CTGCCCAGTAGGAAGGAGGAAGG + Intergenic
1066341677 10:34540392-34540414 ATGGAAGGAAGGAAGGTGGATGG + Intronic
1066585939 10:36935576-36935598 GGGGCCAATAGGATGGTGGAGGG - Intergenic
1067163020 10:43842965-43842987 GAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1067694886 10:48527566-48527588 GTGAACAGAAGGAAGGATGATGG + Intronic
1068041573 10:51831701-51831723 CTGGCCAGTAGGATGGAGGAAGG + Intronic
1068056848 10:52021617-52021639 GTAGACAGTAGGCAGGTGGATGG + Intronic
1068132235 10:52909151-52909173 GAGGACAGTACCAAGGGGGATGG + Intergenic
1068558240 10:58482140-58482162 GTGGAAAGAAGGAGGGAGGAAGG - Intergenic
1069514026 10:69063516-69063538 GTGGACAGGAGCTGGGTGGAGGG + Intergenic
1070782340 10:79145003-79145025 GAAGAAAGAAGGAAGGTGGAGGG - Intronic
1071449070 10:85777317-85777339 GTGGACAGTAGGCTGGAGGTAGG - Intronic
1071803066 10:89086380-89086402 GCAGACAGTTGGATGGTGGATGG + Intergenic
1072335164 10:94391392-94391414 ATGGGCAGTAGGAAGAAGGATGG - Intergenic
1073916989 10:108417124-108417146 ATGGACAGTAGTAAGTTGGTAGG - Intergenic
1074481016 10:113820707-113820729 AGGGACAGTGGGAAGGTAGAGGG + Intergenic
1075192408 10:120321846-120321868 GGGGCCATGAGGAAGGTGGAGGG + Intergenic
1076107339 10:127834257-127834279 CTGGGCAGGAGGAAGCTGGAGGG - Intergenic
1078406983 11:11079045-11079067 GTGAACAGTGGGATAGTGGAAGG + Intergenic
1078582941 11:12553092-12553114 GTGGAAAGGAGGCAGGGGGATGG - Intergenic
1080349588 11:31368365-31368387 GTGGACAGAAGGGAGTTTGAGGG + Intronic
1080382514 11:31788354-31788376 GTGGATGGTTGGAGGGTGGAGGG - Exonic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082120685 11:48376667-48376689 GTAGACAGTAGAAACGTGGTTGG + Intergenic
1084288628 11:68147488-68147510 GGGGCCAGGAGGAAGTTGGAGGG + Intergenic
1084372668 11:68754239-68754261 GAGGACAGTAGCAAGAGGGATGG - Intergenic
1084904732 11:72336847-72336869 GTGGACACAGGGAAGGTGCATGG - Intronic
1085240092 11:75045931-75045953 ATGGGCAGTAGGAAGAAGGATGG - Intergenic
1085300436 11:75455368-75455390 GAGGGCAGGAGGAAGGTGGGGGG + Intronic
1086504709 11:87493291-87493313 GTGGACAGGAGGAGTGGGGAGGG + Intergenic
1086938302 11:92767926-92767948 GTGGCCAGTAGCACAGTGGAAGG - Intronic
1087241586 11:95787986-95788008 TTGGACAGTAGCCAAGTGGAAGG - Intronic
1087684872 11:101251094-101251116 ATGGACAGTAGGAAGAAAGATGG - Intergenic
1087812515 11:102623515-102623537 GTGGGAAGTAGGAGGCTGGAGGG - Intronic
1088797425 11:113275172-113275194 GGGGACAGCAGGGAGGAGGAGGG - Intronic
1089081276 11:115777989-115778011 GTAGACAGGAGGGAGGAGGAAGG + Intergenic
1089092076 11:115886325-115886347 GTGGTCTGTAGGAGGGTGGTGGG + Intergenic
1089166404 11:116480626-116480648 ATGAACAGTGGGAAGATGGATGG + Intergenic
1089284079 11:117394535-117394557 ATGCACAGTAGGAAGGTGCTGGG + Intronic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089358662 11:117872372-117872394 GTGGACAGTAGGGGAGAGGAAGG + Intronic
1089442629 11:118529916-118529938 GTGGACTTTAAGAAGGTGGCTGG + Intronic
1089612906 11:119679547-119679569 GTGGACAAGAGGCAGGTGCAAGG - Intronic
1089887688 11:121844109-121844131 TTGGCCAGCAGGAAGGAGGAAGG + Intergenic
1090035708 11:123247816-123247838 GTGGTCAGTAGGAATATTGAGGG - Intergenic
1090071814 11:123550560-123550582 GTGGGGTGGAGGAAGGTGGAGGG + Intronic
1090413670 11:126526460-126526482 GTGCTCCCTAGGAAGGTGGATGG + Intronic
1090460869 11:126890564-126890586 GTGGACAGAAGGCACCTGGAGGG + Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1091058196 11:132438561-132438583 GTGGGCAGCAGGAAGGTGGAAGG + Intronic
1091624598 12:2112477-2112499 GAGAACAGGAGGAAGGTGAAGGG + Intronic
1091795976 12:3297721-3297743 GTGGGGAGTAGGCAGGTTGAAGG + Intergenic
1092125137 12:6069902-6069924 ATGGACAGTTGGAAGGATGATGG + Intronic
1092563548 12:9641694-9641716 GTGGACAGTAGGAGGGCAGTGGG - Intergenic
1093021971 12:14212368-14212390 GGGAACAGTAGGAAAGGGGAAGG + Intergenic
1093040986 12:14379152-14379174 GAGGACAGTACCAAGGGGGATGG - Intronic
1094250432 12:28353883-28353905 GGGGCCAATTGGAAGGTGGAGGG + Intronic
1096774519 12:53955859-53955881 GGGGTCTGTGGGAAGGTGGAGGG - Intronic
1097270059 12:57768512-57768534 GAGGACAGGAGGATGGTAGAAGG + Exonic
1097345563 12:58488420-58488442 GTGGAGGTTAGGAAGGGGGAAGG - Intergenic
1098385132 12:69910392-69910414 TTGGGCAGTCGGGAGGTGGAGGG + Intronic
1098539606 12:71639699-71639721 AAGGACAGTGGGAAGGTAGAGGG + Intronic
1101028159 12:100634242-100634264 ATGGACAGTAGGAAGAAAGATGG + Intergenic
1101159357 12:101957833-101957855 GGGGCCAGTAGGAAGGGAGACGG + Intronic
1101182561 12:102235304-102235326 ATTGACAGTAAGAAGGTAGAAGG - Intergenic
1101574961 12:105988799-105988821 GTGCACAGTATAAAGGTGAATGG - Intergenic
1102044640 12:109822199-109822221 GTGGGCAGTGGGGAGGTGGGTGG + Intronic
1102440890 12:112963286-112963308 GGGCACAGCAGGAAGGTGGGTGG - Intronic
1102578988 12:113874012-113874034 GAGAACAGCAGCAAGGTGGAGGG + Intronic
1102926093 12:116827627-116827649 GTGGACAATAGGTAAGTGAATGG - Intronic
1103234121 12:119358073-119358095 GAGGACAGTACCAAGGGGGATGG + Intronic
1103268170 12:119648431-119648453 GTGGACATTAGCCAGGAGGAAGG - Intergenic
1104092295 12:125526939-125526961 GTGGATAGAAGGGTGGTGGATGG - Intronic
1104730036 12:131100012-131100034 GTTGACAGTAGGTTGGTTGAGGG + Intronic
1104928696 12:132327246-132327268 GAGGACAGGAGGAAGCGGGATGG + Intronic
1105973184 13:25449981-25450003 GGGGACTTTAGGAGGGTGGAGGG - Intronic
1106311977 13:28562756-28562778 GGGGACAGAAAGAAGCTGGATGG - Intergenic
1107495862 13:40925055-40925077 GAGGACAGTACCAAGGGGGATGG + Intergenic
1109502358 13:63254917-63254939 GAGGACAGTAGCAAGTGGGATGG + Intergenic
1109570545 13:64183374-64183396 GTGGAAAATTGGAAGGAGGAAGG - Intergenic
1110958146 13:81582734-81582756 TTTGAAAGAAGGAAGGTGGAAGG - Intergenic
1111402186 13:87753299-87753321 TTGGAAGGTAGGAAGGAGGAAGG + Intergenic
1113571364 13:111360657-111360679 GTGGACCCTTGGAAGGGGGAAGG - Intergenic
1114346146 14:21797349-21797371 GGGGCCAGTAGGAAAGTGGCTGG - Intergenic
1114655854 14:24315205-24315227 GGGGACAGTAGGCAGGTGATTGG + Intronic
1114962494 14:27911216-27911238 GAGGACAGTACTAAGGAGGATGG - Intergenic
1115268399 14:31525711-31525733 GAGGACAGTATCAAGGAGGATGG + Intronic
1115443266 14:33460638-33460660 GTGGAAAGTAGGAGGGTAGGAGG - Intronic
1116780025 14:49226883-49226905 AGGGACAGTAAGAAGGTGGTAGG - Intergenic
1116933432 14:50713127-50713149 GTGGACAGTGGAAAAGTGGTGGG + Intergenic
1118935619 14:70285145-70285167 GAGGACAGTACCAAGGGGGATGG + Intergenic
1119575628 14:75719017-75719039 GTGGAGAGTGGGATGGTGGTAGG + Intronic
1119971823 14:78979491-78979513 GTGAACAGTAGTTGGGTGGAAGG - Intronic
1120154932 14:81082993-81083015 GGGGACACTAGGAAAATGGAAGG + Intronic
1120183070 14:81365893-81365915 GTGAACAGTAAGAGGGTCGAGGG - Intronic
1120588780 14:86349608-86349630 GCTGACAATAGAAAGGTGGATGG - Intergenic
1120929500 14:89834594-89834616 CGGGAAAGTAGGAAGGTGCATGG + Intronic
1121006919 14:90496424-90496446 GGGGACAGGAGGAAAGGGGAGGG - Intergenic
1121029945 14:90649760-90649782 GTGGATGGTTGGATGGTGGATGG - Intronic
1121523122 14:94599838-94599860 GTGGAGAGTAGGGATGTGGAGGG + Intronic
1121624603 14:95374942-95374964 GAGGAAAGAAGGAAGGGGGAAGG - Intergenic
1121624634 14:95375045-95375067 GAGGAAAGAAGGAAGGGGGAAGG - Intergenic
1121780459 14:96618840-96618862 ATAGACAGGAGGAAGGAGGAGGG - Intergenic
1122037250 14:98957716-98957738 GTGGACAGGAAGAAGCTGGCCGG + Intergenic
1122503978 14:102219905-102219927 GTGGAGAGTGGGACAGTGGAGGG + Intronic
1122600550 14:102919592-102919614 GTGGATGGTAGGTAGATGGAAGG - Intergenic
1122895526 14:104754791-104754813 GGGGCCAGGAGGAAGGTGCAGGG + Intronic
1122910268 14:104824407-104824429 ATGGATGGTAGGATGGTGGATGG + Intergenic
1122910292 14:104824519-104824541 ATGGACAGTAGGATGGTGGGTGG + Intergenic
1122978789 14:105181797-105181819 GAGGAGAGTAGGGAGCTGGAGGG + Intergenic
1124135840 15:27035710-27035732 GTGGACAGCAGGATTGGGGAAGG + Intronic
1126484860 15:49169090-49169112 GTATACAGGAGGAAGGGGGAAGG - Intronic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1126802369 15:52310630-52310652 GTGCACTGAAGGCAGGTGGATGG - Exonic
1126852679 15:52806453-52806475 GTGGACAGCAGTAGGGTGAAGGG + Intergenic
1127095917 15:55512220-55512242 ATGGACAGTAGGAAGAAAGATGG + Intergenic
1127700401 15:61494419-61494441 GTGGGCAGTAGAAAGGTCTAAGG - Intergenic
1130042423 15:80415982-80416004 GTGGAGAGTGGGCAGGGGGAAGG - Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130846750 15:87754876-87754898 ATGCACAGAGGGAAGGTGGAAGG - Intergenic
1131185243 15:90268336-90268358 GAGATAAGTAGGAAGGTGGAAGG - Intronic
1132097170 15:98995821-98995843 GTGAAGAGGAGGAAGGTGGTGGG - Intronic
1133611046 16:7433687-7433709 ATGGACAGAAGGATGGTAGAAGG - Intronic
1133929153 16:10218102-10218124 ATGGATAGAAGGAAGGGGGAAGG - Intergenic
1134301502 16:12995620-12995642 CTTAACAGTGGGAAGGTGGAAGG - Intronic
1134392689 16:13834012-13834034 GAGAAGAGTAGGAAGCTGGAAGG - Intergenic
1134998828 16:18759811-18759833 GTGGAGAGTAGGTGGATGGATGG + Intergenic
1135880181 16:26248017-26248039 GAGGACAGTAGCAAGAGGGATGG - Intergenic
1135916668 16:26611094-26611116 GTGGATAGGAGGAAGTTGGGAGG - Intergenic
1136655599 16:31707255-31707277 GTGGAGGGTGGGAAGCTGGATGG - Intergenic
1138813194 16:60174735-60174757 GAGGACAGTACCAAGGAGGATGG - Intergenic
1139946368 16:70645079-70645101 GGGAAGAGTAGGAAGGAGGAGGG + Intronic
1139982701 16:70872660-70872682 GTGGATAGGTGGATGGTGGATGG - Intronic
1140032321 16:71348611-71348633 GTGGAGGGTAGGAAGGAGAAAGG - Intergenic
1140377393 16:74455572-74455594 GTCGACAGCAGGAAGGTACAAGG - Intronic
1140803790 16:78513798-78513820 GTGTAAAGTATGCAGGTGGATGG - Intronic
1140889194 16:79270669-79270691 GGTGACAGTAGGAAGGAGGAGGG + Intergenic
1141029069 16:80572102-80572124 GAGGACAGTACCAAGGGGGATGG + Intergenic
1141110262 16:81265982-81266004 GTGGATAGTAGACAGATGGATGG - Intronic
1141421571 16:83921176-83921198 GTGGATGGAAGGAAGATGGATGG + Exonic
1141421622 16:83921401-83921423 GTGGATGGAAGGAAGGAGGATGG + Exonic
1141876061 16:86825295-86825317 GTGGACAGGAGGGAGGTGCTAGG + Intergenic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1142152756 16:88519967-88519989 ATGGATAGTGGGTAGGTGGATGG + Intronic
1142234547 16:88915548-88915570 GTGGACAGGGGGAGAGTGGACGG + Intronic
1142708675 17:1711294-1711316 GTGGAGTGGAGTAAGGTGGAAGG - Intergenic
1143809704 17:9461317-9461339 GTGGAGGGTAGGAAGGTGAGAGG + Intronic
1145948921 17:28800376-28800398 GTGGACAGATGTGAGGTGGAGGG + Intronic
1146939192 17:36832292-36832314 ATGGACAGATGGATGGTGGATGG - Intergenic
1147809962 17:43161444-43161466 ATGGACAGTAGGAAGAAAGATGG + Intergenic
1147924693 17:43939091-43939113 GTGGAGTGGGGGAAGGTGGATGG - Intergenic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1148743159 17:49904217-49904239 GTGGCCAGTTGGATGGTGAAGGG - Intergenic
1148917409 17:50993706-50993728 GTGCCCAGCAGGTAGGTGGATGG + Intronic
1150481884 17:65517129-65517151 GTGGTCAGGAGGACAGTGGAAGG - Intergenic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1151221147 17:72614017-72614039 GTGGAGTGTAGGATTGTGGAGGG - Intergenic
1151232210 17:72693216-72693238 GAGGACAGTGGGAGGGTGGGTGG - Intronic
1152312569 17:79559875-79559897 GTGGATGGTGGGTAGGTGGATGG + Intergenic
1153601437 18:6784468-6784490 GTGGAGGGTAGGAAGGTGGTTGG - Intronic
1157072414 18:44423383-44423405 GTGGGGGGTAGGAAGGTGCAGGG + Intergenic
1157263722 18:46198472-46198494 GTGAAAAGTAGGAAGGTGAAAGG - Intronic
1157700256 18:49757792-49757814 CTGGACAGTGGGACGGTGAATGG - Intergenic
1159010822 18:63057590-63057612 TTGGAAAGAAGGAAGGTGGCAGG - Intergenic
1159807646 18:72975206-72975228 GTGGACAGTAGGACTGTGTGGGG + Intergenic
1159857392 18:73605364-73605386 GTGGACTGAAGGTTGGTGGATGG - Intergenic
1160094966 18:75862740-75862762 GTGGACAATGGGAAGATGAACGG + Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1160395370 18:78566954-78566976 GGTGACACCAGGAAGGTGGATGG - Intergenic
1160502576 18:79409599-79409621 ATGGAGAGTAGGTAGATGGATGG - Intronic
1160588023 18:79923286-79923308 GTGGACAGGTGGGTGGTGGATGG + Intronic
1161287292 19:3475438-3475460 GTGGATAGTGGGTGGGTGGATGG + Intronic
1161347776 19:3776720-3776742 GTGGATAGTGGGTAGATGGATGG + Intergenic
1161347788 19:3776774-3776796 GTGGATAGTGGGTGGGTGGATGG + Intergenic
1161821305 19:6532754-6532776 GTAGAAAGGAGGAAAGTGGATGG - Intronic
1162062844 19:8107267-8107289 ATGGACAGAAGGAGGGGGGATGG + Intronic
1162085817 19:8248566-8248588 GTGGACAGATGGATGATGGATGG + Intronic
1162979349 19:14228602-14228624 GTGGGCAGGAGGATGGAGGATGG + Intergenic
1163171641 19:15535586-15535608 GTGGATAGGTGGAAGGTGGATGG - Intronic
1163350568 19:16774161-16774183 TGGGAGAGTGGGAAGGTGGATGG - Intronic
1164037253 19:21466052-21466074 GTGGAGGGTGGGAAGCTGGATGG - Intronic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1164879349 19:31718092-31718114 GTGGCCAGTAGAAAGGTTTATGG - Intergenic
1164916647 19:32057510-32057532 GAGGATAGCAGGAAGATGGAAGG - Intergenic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166391033 19:42409027-42409049 GTGGGGAGTAGGATGGTGCAGGG + Intronic
1166645605 19:44529595-44529617 GAGGAGAGAAGGGAGGTGGAGGG - Intronic
1167079768 19:47271027-47271049 GTGGAGAGTAGACAGGAGGAAGG - Intronic
925028040 2:625072-625094 GTGGCGCGGAGGAAGGTGGATGG - Intergenic
925787858 2:7450427-7450449 GTGGACAGGTGGAAGATGGAGGG - Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
927004911 2:18838167-18838189 GTGGACAGTTTGAAGCTGAATGG + Intergenic
927320452 2:21738329-21738351 GTGGGGAGTGGGAAGGTTGATGG + Intergenic
927856760 2:26532616-26532638 GTTGACAGAAGCAAGGTGGTAGG + Intronic
927927401 2:27023589-27023611 CTGGAGAGTCGGGAGGTGGAGGG - Intronic
928843766 2:35644045-35644067 TTGGACAGAAGCAATGTGGAAGG + Intergenic
928899881 2:36305670-36305692 GTGGACAGCACCAAGATGGAAGG - Intergenic
929366304 2:41160434-41160456 GTGAACAGGAGGAAGGTGCTTGG + Intergenic
929450661 2:42034927-42034949 GAGGACAGAAGGGTGGTGGAGGG + Intergenic
929590159 2:43140332-43140354 GCGGACAGGAGGTTGGTGGACGG + Intergenic
930525169 2:52519748-52519770 GTGGATAGTAGGAAGGACAAGGG + Intergenic
932592230 2:73074408-73074430 GAAGACAGCAGGAAGGTTGAGGG + Exonic
933291959 2:80447812-80447834 GTGGAAGGTGGGAGGGTGGAGGG + Intronic
933456031 2:82520354-82520376 CTGGACAGTAGGAAAATGAATGG - Intergenic
934153385 2:89171774-89171796 GGAGACAGGAGGAAGGAGGAAGG - Intergenic
934213851 2:90010157-90010179 GGAGACAGGAGGAAGGAGGAAGG + Intergenic
934278696 2:91592844-91592866 GGGGAGGGTAGGAAGGGGGAAGG - Intergenic
935042514 2:99446845-99446867 GTGGACAGGAGGAGAGTTGAGGG - Intronic
936056290 2:109264411-109264433 GTGGATCGTGGGGAGGTGGATGG - Intronic
936060579 2:109293238-109293260 GAGGACAGAGGGATGGTGGAGGG + Intronic
936928382 2:117761350-117761372 TTGGCCAAAAGGAAGGTGGAAGG - Intergenic
937726860 2:125176635-125176657 GAGGACAGTACCAAGGGGGATGG - Intergenic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
938061870 2:128261230-128261252 GGGGACAGTGAGAAGGTGCAAGG + Intronic
938981464 2:136531123-136531145 GAGGACAGTATTAAGGTGCATGG - Intergenic
939091375 2:137783426-137783448 GGGGACAGTACCAAGGGGGATGG + Intergenic
939309952 2:140463169-140463191 GTGGCCAGTGGGAGGGTGGGTGG + Intronic
940071036 2:149688127-149688149 CTGAACAGTGGCAAGGTGGATGG - Intergenic
940454637 2:153881143-153881165 GTGGTCAGTTGGCAGGTGGCAGG + Intronic
943993529 2:194730158-194730180 GGGGCCTGTTGGAAGGTGGAGGG + Intergenic
944444880 2:199779509-199779531 GTGCACATGTGGAAGGTGGAGGG - Intronic
944482717 2:200174576-200174598 GAGGACAGTATGATGGGGGATGG + Intergenic
944580186 2:201125579-201125601 GTGGAAAGGTGGAAGGTGGCAGG + Intronic
944756136 2:202763905-202763927 GTGGCCTGTAGGAAGAGGGAGGG - Intronic
945421801 2:209647164-209647186 GAGGACAGTACCAAGGGGGATGG + Intronic
946346930 2:219118460-219118482 GTAGGCAGTGGGAAGATGGAGGG + Intronic
946796853 2:223363486-223363508 GGGGACAGCAGGGAGGTGGTGGG + Intergenic
947152658 2:227130916-227130938 GTGGAGGGTAGGGAAGTGGATGG - Intronic
948025286 2:234771565-234771587 GAGGAAGGTAGGGAGGTGGATGG + Intergenic
948232404 2:236359660-236359682 GTTGACGGCAGGAAGCTGGAGGG - Intronic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169139953 20:3222066-3222088 GTGGACACTAGGAATCTGGGTGG + Intronic
1169369008 20:5014308-5014330 GTGGAAAGTAGGAGGGAGAATGG + Intergenic
1170361181 20:15548103-15548125 GTGGACAGATGGATGGTGGATGG - Intronic
1170405544 20:16032241-16032263 GTGGACCCTTGGAGGGTGGAGGG + Intronic
1170636862 20:18114181-18114203 GTAGACAGTAGAAGGATGGAAGG - Intergenic
1170957199 20:20992014-20992036 GTGGGAAGGAGGAACGTGGAAGG - Intergenic
1171396337 20:24836223-24836245 GTGGAGGGTGGGCAGGTGGAGGG - Intergenic
1171396348 20:24836253-24836275 GTGGAGGGTAGGCAGCTGGAGGG - Intergenic
1172123737 20:32613201-32613223 ATGCACAGTAGAAAGATGGATGG + Intergenic
1172187138 20:33038000-33038022 TTGGACAAAAGGAAGGTGGATGG - Intronic
1173090817 20:39969319-39969341 GGGGCCAGTTGGGAGGTGGAGGG - Intergenic
1173295459 20:41751603-41751625 GTGAACAGTAGGATGGAGGAGGG - Intergenic
1173348051 20:42219087-42219109 GTGTACACTAGGAAGGCGGCTGG + Intronic
1173888392 20:46481661-46481683 GTGGATGGGATGAAGGTGGAGGG + Intergenic
1174998281 20:55597380-55597402 GTGAACAGAAGCAAGGTGAATGG + Intergenic
1175407459 20:58744300-58744322 GTAGATGGTAGGTAGGTGGATGG + Intergenic
1175817248 20:61889681-61889703 GTGGATAGTTGGATGATGGATGG + Intronic
1175817313 20:61890032-61890054 GTGGATAGTTGGATGATGGATGG + Intronic
1175934837 20:62509827-62509849 GTGGACAGGTGGATTGTGGAGGG - Intergenic
1178394706 21:32232730-32232752 GTGGTTACCAGGAAGGTGGAAGG + Intergenic
1178507063 21:33171028-33171050 GTGGACAGGTGAAAGCTGGAGGG - Intergenic
1178519060 21:33271959-33271981 TTGGAAAGAAGGAAGGCGGAAGG + Intronic
1179727514 21:43348574-43348596 GTGGACAGTAGGAGGGGGCTGGG + Intergenic
1180086148 21:45508841-45508863 GTGGACAGGGTGCAGGTGGATGG + Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180671185 22:17554797-17554819 GAGGACAGAAGGATTGTGGATGG + Intronic
1180749705 22:18115870-18115892 GTGAAGAGGAGGGAGGTGGAGGG - Intronic
1181406728 22:22690228-22690250 GTGGACAGGGGGAAGCTGGTTGG + Intergenic
1181665173 22:24390222-24390244 GAGGACGCTAGGAAGGTGGAAGG - Intronic
1181847057 22:25719305-25719327 CTGGACAGTTAGGAGGTGGAAGG + Intronic
1182051803 22:27317960-27317982 GTGGAAAGCAGGAGGGTGGAGGG - Intergenic
1182297143 22:29316275-29316297 GTGGGCAGGAGGAAGGTAGGAGG - Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1183100018 22:35578267-35578289 ATGGAAGGAAGGAAGGTGGATGG + Intergenic
1183166256 22:36149188-36149210 GTGGACAGAGGGAGGTTGGAGGG + Intronic
1183986904 22:41575093-41575115 CTGGCCAGGAGGTAGGTGGAGGG + Exonic
1184410462 22:44323191-44323213 GTGGACAGATGGATGGTGGATGG - Intergenic
1184534262 22:45076051-45076073 GTGGGGGGTAGGGAGGTGGAAGG + Intergenic
1184822375 22:46918914-46918936 GGGGACAGAAGGAAGGAGAACGG - Intronic
1184857925 22:47156645-47156667 GTGGACAGGAGAAGGGTGCAGGG - Intronic
1185216106 22:49600801-49600823 GTAGACAGGAGGCAGGAGGAGGG + Intronic
949591596 3:5499986-5500008 GTGAACAGCAGGATGGGGGAGGG + Intergenic
950053333 3:10008148-10008170 GGGCACAGCAGCAAGGTGGAGGG - Intronic
950085547 3:10254984-10255006 GTGGGAAGGAGGAAGGGGGAAGG - Intronic
950085551 3:10254991-10255013 GTGGGAAGTGGGAAGGAGGAAGG - Intronic
950304972 3:11910433-11910455 GGGCACAGCAGCAAGGTGGAGGG - Intergenic
950358116 3:12428694-12428716 GTGACCAGTTGGAGGGTGGAGGG + Intronic
950734259 3:14992577-14992599 GTGGAGAGTACTAAGGTGCAGGG + Intronic
951794474 3:26523492-26523514 GTGAAGAGTAGGAAGGATGAGGG - Intergenic
952535373 3:34303785-34303807 GAGGACATTAGGAAGGAGGTTGG + Intergenic
952846435 3:37691414-37691436 GAAGACAGTGGGAAGATGGAGGG + Intronic
954156709 3:48689032-48689054 GTGGATAGTAGTAGGGAGGAAGG - Intronic
955094451 3:55783212-55783234 GTGCACAGTACTAAGGTGCATGG + Intronic
957006022 3:74947913-74947935 GAGGACAGCACCAAGGTGGATGG + Intergenic
958092655 3:88896034-88896056 GTGAACAGTAGAAGGGGGGAGGG - Intergenic
959012401 3:101093336-101093358 ATAGACATTAGGAAGGTGGGAGG + Intergenic
959645649 3:108697221-108697243 GTGGCCTGTTGGAGGGTGGAGGG + Intergenic
960570665 3:119182256-119182278 GTGAACAGAGGGAAGGTGGAAGG + Intronic
960636082 3:119786295-119786317 GAGGACAGGAGGAATGTGTAGGG + Intronic
961511270 3:127405235-127405257 TGGGTGAGTAGGAAGGTGGATGG + Intergenic
962240655 3:133748200-133748222 GTGGTCAGTAGGAAACTGGGAGG + Intronic
962791380 3:138814616-138814638 GTGGAGGAAAGGAAGGTGGAGGG - Intronic
963304219 3:143632471-143632493 GGGGTCAGTAGGTAAGTGGAGGG - Intronic
964720211 3:159763203-159763225 GCGGCGAGGAGGAAGGTGGAAGG + Intronic
965803975 3:172523547-172523569 CTGGGCAGTAGGAAAGGGGAGGG - Intergenic
966282676 3:178251270-178251292 ATGGACATCCGGAAGGTGGAGGG + Intergenic
966364196 3:179165063-179165085 GAGGAGAGTAGAAAGGTAGAAGG - Intronic
966410382 3:179641093-179641115 GAGGACAGTACCAAGGAGGATGG - Intergenic
966485118 3:180460189-180460211 GGGGACAGTAGGGAGGATGAGGG - Intergenic
966569316 3:181423555-181423577 GTAGACAATAAAAAGGTGGAGGG - Intergenic
966716915 3:183021959-183021981 GTGGACAGTAGGAAGGTGGATGG - Intronic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969445980 4:7244949-7244971 GTGGGCAGTTGGAAGGGGGGTGG + Intronic
969510395 4:7614375-7614397 GTGGATGGTGGAAAGGTGGATGG - Intronic
969584419 4:8083852-8083874 GGGGAAAATAGGAAAGTGGAAGG - Intronic
969713173 4:8855963-8855985 GCGGACAGTAGCATGCTGGAAGG + Intronic
969789957 4:9486608-9486630 GTGGAAAGTATAAAGGTGGTTGG + Intergenic
972082447 4:35170937-35170959 TTGGAAGGTTGGAAGGTGGAAGG - Intergenic
973760103 4:54107835-54107857 GAGGAAAGGAGGAAGGTGGCTGG - Intronic
974277273 4:59739428-59739450 GTGGACTATTAGAAGGTGGAGGG - Intergenic
974552565 4:63397043-63397065 GTGGACTATTGGAAAGTGGAGGG - Intergenic
975411491 4:74056644-74056666 GTTGACAGTAGGAAAGAGGTAGG + Intergenic
976385234 4:84449239-84449261 GTGGACTCTAGGAGTGTGGAAGG - Intergenic
976753733 4:88477244-88477266 GGGGAGAGGAGGAAGGGGGAGGG + Intronic
976982890 4:91253916-91253938 GAGGACAGTATTAAGGGGGACGG + Intronic
978315443 4:107430744-107430766 CTAAAGAGTAGGAAGGTGGAGGG - Intergenic
979568749 4:122189982-122190004 GTGGTCTATAAGAAGGTGGAGGG - Exonic
980291936 4:130855418-130855440 GTGGCCAGGAGCAAGGTGGCTGG - Intergenic
981783028 4:148446215-148446237 CAGGACAGTGGGAATGTGGAAGG - Intergenic
982862415 4:160469930-160469952 GGGGAGAGTAGGAAAGTGAAGGG - Intergenic
983015384 4:162606744-162606766 GAGGACAGTACCAAGGGGGATGG - Intergenic
984208006 4:176809907-176809929 CTGGAAAGGAGGAAAGTGGATGG - Intergenic
985390669 4:189489143-189489165 GGGGACTGGAGGCAGGTGGAGGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986075457 5:4332384-4332406 GAAGACAGTAGGAAGGAGGAGGG - Intergenic
986161486 5:5233493-5233515 GTGGCCTGTTGGAAGGTGGAGGG - Intronic
987262838 5:16221071-16221093 GTGGAGACTAGGAAGGGTGAAGG + Intergenic
987463453 5:18243845-18243867 GTGCACAGTGAGAAGGTGGTAGG - Intergenic
988422619 5:31024635-31024657 GTGGGCAGGAGGTAGGAGGAGGG - Intergenic
988835970 5:35032684-35032706 GTGGAGTGTTGGAAGTTGGAAGG - Intronic
989567585 5:42916421-42916443 GTGGATACTAGCACGGTGGAAGG + Intergenic
989641368 5:43586036-43586058 GTGGACAGTAGAGAGATGGATGG - Intergenic
990460126 5:56023816-56023838 AAGTACAGAAGGAAGGTGGAGGG + Intergenic
990799034 5:59578752-59578774 GTGGAGATTAGGTAGGTGGAAGG - Intronic
991725354 5:69530389-69530411 AAGGACAGTAGGAAAGTAGAAGG - Intronic
992327451 5:75674953-75674975 GTAGAGAGAAGGAAGTTGGATGG - Intronic
994014629 5:94951117-94951139 CTGGACAGTTGGAAGGATGAGGG - Intronic
994051494 5:95367173-95367195 CTGGAGACTAGGAAGGTGGTGGG - Intergenic
994084507 5:95743651-95743673 GAGGAAAGAAGGAAGGGGGAAGG - Intronic
998164511 5:139835318-139835340 GTGGACAGGTGGAAGATGGAAGG - Intronic
998371830 5:141666659-141666681 GAGGACAGGAGAAAGGGGGATGG + Intronic
998569886 5:143247582-143247604 ATAGACAGTAGGTGGGTGGATGG + Intergenic
998917918 5:147036168-147036190 GGGGTCTGTTGGAAGGTGGAGGG - Intronic
999532142 5:152475815-152475837 TGAGACAGTAGGAAGGAGGAAGG - Intergenic
999775748 5:154811896-154811918 GGGCACAGTAGCAAGGAGGATGG - Intronic
1001234078 5:170014739-170014761 GTGGGCAGTAGGCAGGTGGAGGG + Intronic
1001377519 5:171276105-171276127 GTGCACAGCATGAAGGTGAAAGG + Intronic
1001594798 5:172891310-172891332 GTGGACGGTAGGAATGGGGCAGG - Intronic
1002259069 5:177981849-177981871 GTGGACACATGGATGGTGGATGG + Intergenic
1002392961 5:178930085-178930107 GAGGACAGTACCAAGGGGGATGG + Intronic
1002821307 6:727468-727490 GGGGAGAGAAGGAAGGAGGAGGG - Intergenic
1004764074 6:18704655-18704677 GTAGAGAGTAGAATGGTGGAGGG - Intergenic
1004892680 6:20116497-20116519 AGGGACAGAAGGAAGGAGGAAGG + Intronic
1005420129 6:25640279-25640301 GTTGACAGGAGGCAGGAGGATGG + Intergenic
1005675932 6:28154855-28154877 GTGTACAGTGGGGAGGTGGAAGG - Exonic
1005812633 6:29529022-29529044 GTGGCCAGCTGGGAGGTGGAAGG - Intergenic
1005966543 6:30730730-30730752 GTGGACAGAAGGGAAGTGGAGGG + Intronic
1006292464 6:33149866-33149888 GGGGAAAGTATGAAGGTGGAAGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007510342 6:42369954-42369976 GAGGTCAGGAGGAAGGTGAAGGG - Intronic
1007635095 6:43294952-43294974 GTGGTAAGTAGGGTGGTGGATGG - Intergenic
1007702293 6:43772133-43772155 GGAGACAGTAGGAAGGGGTAGGG - Intronic
1009030774 6:58055784-58055806 GTGGACAGAAAGAAGGAGAAGGG + Intergenic
1009206630 6:60810245-60810267 GTGGACAGAAAGAAGGAGAAGGG + Intergenic
1009482903 6:64182837-64182859 GTAGACAGGAGTAGGGTGGAAGG - Intronic
1012826799 6:104156430-104156452 GTGGGGAGTAGGGAGGGGGAGGG - Intergenic
1013277306 6:108598185-108598207 GGGGACAGTAGGGAGGAAGAAGG - Intronic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013606109 6:111750264-111750286 GAGGACAGTACCAAGGAGGATGG - Intronic
1015374206 6:132491617-132491639 GAGGCCAGCAGGATGGTGGAAGG - Intronic
1015675793 6:135746955-135746977 ATGGAAAATATGAAGGTGGAGGG - Intergenic
1015894814 6:138007094-138007116 GGGGGCAGAAGGAAGCTGGAAGG - Intergenic
1016201817 6:141419306-141419328 ATAGACGGTAGGTAGGTGGATGG - Intergenic
1016352199 6:143180035-143180057 GAGGACAGAAAGACGGTGGAAGG - Intronic
1016920159 6:149284912-149284934 GTGGGCATTAGGAAGGTGTGGGG - Intronic
1017012264 6:150070584-150070606 GGGAACAGGAGGAAGGTAGAAGG + Intergenic
1017302583 6:152879645-152879667 GAGGACAGCAAGATGGTGGAAGG + Intergenic
1017687479 6:156928009-156928031 GAGGACAGTAAGGAGGAGGAAGG + Intronic
1017743521 6:157427172-157427194 GAGCACAGGAGGAAGGAGGAAGG + Intronic
1017974707 6:159346884-159346906 GTGCAGATTAGGAAGGTGGCAGG - Intergenic
1018425574 6:163677402-163677424 GCAGGCAGAAGGAAGGTGGAAGG + Intergenic
1018681622 6:166270196-166270218 GAGGACAGGAGGATGGAGGAGGG + Intergenic
1019046013 6:169146782-169146804 GTGGACACCAAGAAGGGGGAGGG - Intergenic
1019549095 7:1593475-1593497 GTGGACAGTAGCATTGGGGAGGG + Intergenic
1019730609 7:2627486-2627508 ATGGAGGGAAGGAAGGTGGAAGG + Intergenic
1020812874 7:12866914-12866936 GTAGCCAGTAGGGGGGTGGAGGG + Intergenic
1021001631 7:15338906-15338928 GTGGACAGTAGAAGGTTGGTTGG + Intronic
1021849087 7:24790464-24790486 ATGGGCAGTAGGAAGAAGGATGG + Intergenic
1022219471 7:28298231-28298253 GGGGCCTGTAGGAAGGTGGGTGG - Intergenic
1022332593 7:29394542-29394564 GTGGCAATTAGGAAGGTGCACGG - Intronic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022623919 7:32014612-32014634 GGGGCCTGTCGGAAGGTGGAGGG - Intronic
1026227142 7:68452409-68452431 TTGGACAGTAGGCAGGAAGATGG - Intergenic
1026483874 7:70801135-70801157 CAGGACAGTAGGATGGTGAAAGG - Intergenic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1027591046 7:80119703-80119725 GTGGACAGTAAAGAGGAGGAGGG - Intergenic
1027659208 7:80968791-80968813 GGGGAGAGTGGTAAGGTGGAAGG + Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1030058857 7:105607273-105607295 GTGGAGAGTTGGAGGGTGGGTGG - Exonic
1030070531 7:105693983-105694005 GGGGAAAGGAGGAGGGTGGAAGG + Intronic
1030695212 7:112577712-112577734 GAGGACAGTACCAAGGGGGATGG + Intergenic
1030938712 7:115618143-115618165 GAGGACAGTACCAAGGGGGATGG + Intergenic
1031995268 7:128226487-128226509 ATGGACAATAGGAGGATGGAAGG - Intergenic
1031995273 7:128226510-128226532 ATGGACAATAGGAGGATGGAAGG - Intergenic
1032739521 7:134724817-134724839 GAGGGCAGTAGAAAGGAGGAAGG - Intergenic
1033423352 7:141221747-141221769 GAGGGCAGCAGGAAGGTGGCTGG + Intronic
1033459582 7:141533229-141533251 GGGGACTGAGGGAAGGTGGAGGG + Intergenic
1036596253 8:10215061-10215083 GTGGACTGTAGGTTGGAGGATGG + Intronic
1037810165 8:22082111-22082133 GTGGCCTGGAGGCAGGTGGAGGG - Exonic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038103907 8:24412136-24412158 GGGGCCAGTTGGAGGGTGGAGGG + Intergenic
1038594310 8:28872619-28872641 CTAGTCAGTAGGAAGGAGGAAGG - Intronic
1039076109 8:33691856-33691878 GAGGACAGTAGCAAGAGGGATGG - Intergenic
1039447467 8:37644077-37644099 GTGAGCAGAAGGCAGGTGGAAGG + Intergenic
1039639864 8:39207056-39207078 GTCCACAATAGGAATGTGGATGG + Intronic
1039845630 8:41323608-41323630 CAGGACAGGAGGGAGGTGGAGGG + Intergenic
1040468546 8:47717230-47717252 GTGAAGAGAATGAAGGTGGAAGG - Intronic
1042164510 8:65932863-65932885 GTGGATAGGAGGTAGATGGATGG + Intergenic
1042537082 8:69869996-69870018 GAGGGCAGGAGGAAGATGGAAGG - Intergenic
1042813617 8:72853430-72853452 GAGGAAAGTAGGATGGTGCAAGG - Intronic
1044224239 8:89701372-89701394 ATGGACAGTGGAAAGGTGGTAGG - Intergenic
1044734686 8:95268060-95268082 ATGGAGAGAAGGAAGGTAGACGG + Intronic
1045545703 8:103126355-103126377 CTGCACTGTAGGAAGGTTGAAGG + Intergenic
1046447958 8:114347704-114347726 GGGGCCTTTAGGAAGGTGGAGGG + Intergenic
1047665969 8:127091436-127091458 GGACACAGCAGGAAGGTGGATGG + Intergenic
1047805494 8:128355327-128355349 GTGGACAGGTGGTTGGTGGAGGG - Intergenic
1047998178 8:130356955-130356977 GTGGAAAGTAGGAAGGGAGATGG - Intronic
1048167619 8:132077338-132077360 GTCTAGAGGAGGAAGGTGGAGGG + Intronic
1048303963 8:133270675-133270697 GGTGACAGTAGGAAGCTGTAAGG + Intronic
1048897252 8:139003210-139003232 GTGGACAGCAGGAGGGTGGCAGG - Intergenic
1048919521 8:139215306-139215328 GAGGACCTTAGGAAGGAGGAGGG - Intergenic
1048927603 8:139284624-139284646 GTGGGCAGGGGGAAGGTTGACGG - Intergenic
1048979765 8:139697005-139697027 GTGGACGGATGGATGGTGGATGG + Intronic
1048979784 8:139697087-139697109 GTGAACAGATGGATGGTGGATGG + Intronic
1048979802 8:139697172-139697194 GTGGACAGATGGATGGTGGATGG + Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1049377030 8:142294153-142294175 GTGGCCAGAGGGAAGGTGGAGGG + Intronic
1049438560 8:142598816-142598838 GTGGACAGGAGGCCGGTGGCAGG + Intergenic
1049641767 8:143719182-143719204 GAGGGCAGCAGGGAGGTGGAGGG - Intronic
1051093732 9:13440606-13440628 GAGGACAGTAGGCAGGGGAAAGG + Intergenic
1051190044 9:14501807-14501829 GGGGAGAGAAGGAAGGAGGAAGG - Intergenic
1052681960 9:31704755-31704777 GTGGAGAGTAGGAAAGTAGGTGG - Intergenic
1055395823 9:75873943-75873965 GAGGACAGTACCAAGGTGGGTGG + Intergenic
1056983657 9:91341189-91341211 GTGGGCAGTGGGAGGCTGGAAGG - Intronic
1057022186 9:91707847-91707869 GTGGACAGGAGGATGGGGGTTGG + Intronic
1057159923 9:92882396-92882418 CTGGAAGGTGGGAAGGTGGAGGG + Intergenic
1057218754 9:93244388-93244410 CAGGAGAGTATGAAGGTGGAGGG - Intronic
1057568321 9:96184435-96184457 AAGGAGGGTAGGAAGGTGGAAGG + Intergenic
1058077052 9:100661791-100661813 GTACAAAGTAGGAAGGTGTAAGG + Intergenic
1058279184 9:103090004-103090026 GAGGACAGTACCAAGGGGGATGG - Intergenic
1059311334 9:113390744-113390766 GTGGGCAGTAGGAGTGTGGGTGG + Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060423599 9:123486785-123486807 GTGGTCAATAGGAGGGTGGAGGG - Intronic
1060967694 9:127720928-127720950 GAGGAAAGGAGGAAGGGGGAAGG - Intronic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1061913533 9:133737617-133737639 GGGCACAGTCGGAAGGAGGAGGG - Intronic
1061930791 9:133832116-133832138 GAGGACAGGAAGAAGGTGCAGGG + Intronic
1062097919 9:134712292-134712314 GGGGACAGGAAGAAGGGGGAAGG - Intronic
1062112301 9:134788769-134788791 GTAGACAGGTGGATGGTGGATGG + Intronic
1062475807 9:136726610-136726632 AGGGATAGTGGGAAGGTGGAGGG - Intergenic
1062590334 9:137271798-137271820 AGGGACAGGAGGAGGGTGGAGGG - Intronic
1203793978 EBV:166390-166412 GTGGAGAGTAGGGAGGGGGAGGG - Intergenic
1186333938 X:8565991-8566013 GAGGAAAGAATGAAGGTGGATGG - Intronic
1186613163 X:11158654-11158676 GAGGACAGTATGCAAGTGGATGG - Intronic
1188457451 X:30382810-30382832 ATGGACACTAGGAAGGTTGGAGG - Intergenic
1189326216 X:40112963-40112985 GTGGACTGGAGGAAGGTGAGGGG - Intronic
1189357996 X:40326098-40326120 GAGGACAGTACCAAGGGGGATGG + Intergenic
1192296440 X:69854160-69854182 GGGGCCTGTCGGAAGGTGGAGGG - Intronic
1192946399 X:75968579-75968601 GTGGACAGCAGTCAGCTGGATGG + Intergenic
1194549600 X:95280035-95280057 GTGGTCTATCGGAAGGTGGAGGG + Intergenic
1195703501 X:107722323-107722345 TTGGACAGGAGGAAGCTGAAAGG - Intronic
1199229331 X:145417629-145417651 ATGGATAGTAGGGAGGTGGTAGG + Intergenic
1199519866 X:148723198-148723220 CTGGACAGTAGAAAGGTAGCAGG + Intronic
1200115170 X:153766805-153766827 GAGGACCAGAGGAAGGTGGAAGG - Intronic
1201544185 Y:15142606-15142628 TTGGACACTTGGAAGGTGGGAGG - Intergenic