ID: 966717579

View in Genome Browser
Species Human (GRCh38)
Location 3:183029349-183029371
Sequence CTGGTGACTTAAGACGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966717577_966717579 -7 Left 966717577 3:183029333-183029355 CCAGCTGGATGCTCCACTGGTGA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG 0: 1
1: 0
2: 0
3: 6
4: 61
966717573_966717579 12 Left 966717573 3:183029314-183029336 CCTCCGATTATTGTCATTACCAG 0: 1
1: 0
2: 0
3: 0
4: 51
Right 966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG 0: 1
1: 0
2: 0
3: 6
4: 61
966717572_966717579 20 Left 966717572 3:183029306-183029328 CCAGGTGACCTCCGATTATTGTC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG 0: 1
1: 0
2: 0
3: 6
4: 61
966717574_966717579 9 Left 966717574 3:183029317-183029339 CCGATTATTGTCATTACCAGCTG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG 0: 1
1: 0
2: 0
3: 6
4: 61
966717571_966717579 26 Left 966717571 3:183029300-183029322 CCTTCTCCAGGTGACCTCCGATT 0: 1
1: 0
2: 0
3: 11
4: 132
Right 966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966717579 Original CRISPR CTGGTGACTTAAGACGAACA TGG Intronic
901174596 1:7289687-7289709 CTGGTGTCCTTAGAAGAACAGGG + Intronic
902071092 1:13738816-13738838 CTGGTGACTACAGACAAAAACGG - Intronic
910379745 1:86613734-86613756 CTGGTGACATCAGGCAAACAGGG - Intergenic
920291816 1:204928850-204928872 CTGGTGGCTTATGAATAACATGG + Intronic
924185424 1:241484191-241484213 ATGGTCACTTAAAACAAACACGG - Intergenic
1063110527 10:3032826-3032848 CTGGTGACTTCAGAAAATCAAGG + Intergenic
1070484575 10:76917550-76917572 CTGGTGACTGAAGGGGAAAATGG - Intronic
1079982530 11:27166208-27166230 TTGGTGGCTTAAGACAACCATGG + Intergenic
1090710202 11:129376820-129376842 TTGGTCACTTAAGACAAACGAGG - Intronic
1106759899 13:32858184-32858206 TTGGTGACTTTAGAAGAATATGG + Intergenic
1114929147 14:27445697-27445719 CTGGTGACTTTATAAGAAGAGGG + Intergenic
1118904251 14:70011972-70011994 CTGGTGACACAGGACGACCATGG + Intronic
1119632603 14:76246734-76246756 CTGGTGACTGAAGATGCACTTGG + Intronic
1119986909 14:79148560-79148582 CTGCTGACTTCATAAGAACATGG + Intronic
1126894331 15:53242058-53242080 CTGGTGACTTTAGACATACTAGG + Intergenic
1129246548 15:74282430-74282452 CTGCTGGCTTAAGATGAACGGGG - Intronic
1133877091 16:9745115-9745137 CTGCTGAGTTAAGAAGAGCAAGG + Intergenic
1139157868 16:64466036-64466058 GTGGTGACTTAGGACTAAGAGGG - Intergenic
1150962259 17:69926905-69926927 ATGGTGACTTAGGATGGACATGG + Intergenic
1155134002 18:22969129-22969151 CTGATGACTTAAGACCAATGTGG - Intronic
1162846038 19:13393441-13393463 CTGGTGACCTCAGAGGCACAAGG + Intronic
1163109258 19:15149153-15149175 CTGGTGCCTTACCAGGAACAGGG + Intergenic
1164881407 19:31735486-31735508 CTGGTGGCTTAAGTCCAACATGG - Intergenic
927336735 2:21933169-21933191 GTGGTGAGTTAAGACCATCATGG + Intergenic
929759341 2:44793570-44793592 CAGAAGACTTAAGAGGAACAGGG + Intergenic
938137872 2:128774133-128774155 CTGCTGACTTAAGGAGAAGATGG + Intergenic
943424502 2:187714088-187714110 GTGGTGACTTCAGAAGAAGATGG - Intergenic
943908021 2:193525464-193525486 CTGGTGACTCAAGACCCACAGGG - Intergenic
946701267 2:222416674-222416696 CTAGTGCCTTAAGAAGAAGAAGG + Intergenic
1172004940 20:31812605-31812627 CTAATGACGTCAGACGAACAAGG - Intergenic
1173687232 20:44932211-44932233 CTGGTGAGTCAAGACCCACAAGG - Intronic
1176689332 21:9884012-9884034 CTGGGGCCTTCAGACTAACAAGG - Intergenic
954931136 3:54282620-54282642 CTGGTGACTTAAGAATCACAAGG - Intronic
956322257 3:68009813-68009835 CTGGAGATTTAAGACCTACAAGG - Intronic
957363066 3:79183888-79183910 GTAATGACTTAAGAAGAACAAGG + Intronic
958018761 3:87972457-87972479 CTGGTGACTACAGATGCACAAGG + Intergenic
958658881 3:97040254-97040276 CTTGAGACTTAAGACACACAGGG - Intronic
960774092 3:121229133-121229155 CTGGTTACTTAAGAAGAAAGAGG - Intronic
960882539 3:122360015-122360037 CTGTTGACTTAGGACAAAAATGG - Intronic
961827069 3:129604788-129604810 CTGGGGCCTGAAGACGCACAGGG - Intronic
966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG + Intronic
967320560 3:188190866-188190888 CTAGTGAAATAAGAAGAACAGGG - Intronic
979274499 4:118799984-118800006 CTGATGATTTAAGAGGAAGAGGG + Intronic
980352723 4:131701823-131701845 CTGGGGCCTTCAGACTAACAAGG - Intergenic
980647217 4:135657374-135657396 CTGGTGACTTATCAGGATCATGG + Intergenic
981107752 4:140900550-140900572 CTGGTAATTGAAGACGAGCAAGG + Intronic
981723908 4:147828349-147828371 CTGGTGGCTCAAAACCAACAGGG - Intronic
984009601 4:174355195-174355217 CTGGTGACTTCAGAGGAAAGGGG + Intergenic
986285599 5:6356109-6356131 CTGTTGGCTTAAGAGGACCAAGG - Intergenic
991471425 5:66973005-66973027 CTGGTGAATCAAGATGAACATGG - Intronic
1000121517 5:158202443-158202465 CTGGTGACTTAGGAACACCAGGG - Intergenic
1000999386 5:167991350-167991372 CTGGGAACATAGGACGAACAAGG + Intronic
1006913690 6:37580885-37580907 CTGCTGACCCACGACGAACATGG - Intergenic
1017710645 6:157164336-157164358 CTGGTGATTAAAGATGGACACGG + Intronic
1018877015 6:167830265-167830287 CTGGTAAGTTAAAACCAACAGGG - Intronic
1026545209 7:71316330-71316352 CTGGTCACTCAAGCTGAACAAGG + Intronic
1032638060 7:133733004-133733026 CTGATTACTGAAGACGAACAAGG - Intronic
1037139344 8:15501464-15501486 CTAGTGATTTAAGATGAATATGG - Intronic
1037707870 8:21330947-21330969 CTGGTGACCTAGGACCATCATGG - Intergenic
1040704535 8:50109895-50109917 GTGGTGACTTAAGACAAAGGTGG - Intronic
1053779992 9:41597888-41597910 CTGGGGCCTTCAGACTAACAAGG + Intergenic
1054167949 9:61808131-61808153 CTGGGGCCTTCAGACTAACAAGG + Intergenic
1054669597 9:67772773-67772795 CTGGGGCCTTCAGACTAACAAGG - Intergenic
1059973708 9:119693849-119693871 CTGGTGACTTAACTGGAACAAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060370180 9:123061774-123061796 ATGGTGACTTTAAAAGAACACGG - Intronic
1199738274 X:150706165-150706187 CTGGTGACTTTATAGGAAGACGG - Intronic
1199899866 X:152162419-152162441 GTGGTGACTTAAGAAGACCTTGG + Intergenic