ID: 966718330

View in Genome Browser
Species Human (GRCh38)
Location 3:183036232-183036254
Sequence AGCCAGGATGAACCCCACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966718330 Original CRISPR AGCCAGGATGAACCCCACTA TGG Intronic
902556808 1:17251656-17251678 AGCCAGGATGTAACCCAGTTTGG + Intronic
902943186 1:19815005-19815027 AGCCAGAATGACCCCCAGCAGGG + Exonic
902973685 1:20073489-20073511 AGCCTGGCTGAAACCCACTTGGG + Intronic
905467543 1:38166729-38166751 AGCCAGCATGAGCCCCACATGGG + Intergenic
916255157 1:162779770-162779792 AGCCAAGATGAACTTCAATATGG + Intronic
922438579 1:225631240-225631262 AGCCACAATTAACCCCACCAAGG + Intronic
1065382181 10:25101733-25101755 AGCCAGAATGAACTCCAATAGGG + Intergenic
1073897301 10:108177473-108177495 AGCCAGGATTAAATCCACAATGG + Intergenic
1075106032 10:119540645-119540667 AGCCAGGTTGCACCCCAAAAAGG - Intronic
1085391270 11:76183519-76183541 AACCAGGCTGAGCCCCACTCCGG - Intergenic
1085585156 11:77695889-77695911 AGCCATGATGAACCCTATGATGG - Intronic
1090189614 11:124759615-124759637 AGCCAGGCTGAAGGCCTCTAAGG + Intronic
1094411027 12:30169289-30169311 AGCCAGGAAGAACCCACCTTGGG + Intergenic
1095162902 12:38937616-38937638 AGTCAGTATAAACCCCACTAAGG + Intergenic
1095250515 12:39973444-39973466 ATCCATGAGGAACCCCTCTATGG - Intronic
1095271890 12:40228156-40228178 AGCCATGATGAAACACAGTATGG - Intronic
1097399867 12:59115701-59115723 ACCCAGTATGAACCTCTCTATGG - Intergenic
1100055536 12:90504462-90504484 AGCCAGGACTAACACCACGATGG - Intergenic
1103432249 12:120898480-120898502 AACCATGAAGAACCACACTAAGG + Intronic
1106203482 13:27565854-27565876 AGCCAGGATTGACCCTACTAGGG - Intronic
1106666150 13:31852774-31852796 ATGAAGGATGAACCCCACTCAGG + Intergenic
1109833501 13:67825362-67825384 AGGCAGGATGAACCCGAAAATGG - Intergenic
1111813402 13:93120086-93120108 AGCCAGGAGAAATCCCAATAGGG + Intergenic
1115910913 14:38255676-38255698 AGCCAGGAGAAACCCCGCAAAGG + Exonic
1124123332 15:26911522-26911544 AGCTAGAATGAAGCCCACCATGG + Intronic
1130554514 15:84913390-84913412 AGGCCAGATAAACCCCACTAAGG - Intronic
1132438046 15:101828406-101828428 AGCCATTATGAAACACACTATGG - Intergenic
1138352442 16:56353165-56353187 AGCCAGGCTGTAGCCCACTCTGG + Intronic
1141861582 16:86720320-86720342 AGCCACGATGATGCCCACTGGGG - Intergenic
1151032512 17:70757942-70757964 AGCAAGTATGAAACCCACCAGGG + Intergenic
1156024569 18:32637259-32637281 ACTCAGAATGAACCCCACAAGGG - Intergenic
1158421372 18:57297599-57297621 AGCCAGGAAGAGCCACATTAGGG - Intergenic
1158944107 18:62433496-62433518 AGCCAGAATGAACAATACTAGGG + Intergenic
1163822235 19:19502563-19502585 AGGAAGGGTGAACCCCACAATGG - Intronic
1164879103 19:31715689-31715711 AGCCAGGAGGAGCCCCGCCAGGG + Intergenic
928291097 2:30037956-30037978 AGCCAGGAGGAGCCACACTGGGG + Intergenic
932279212 2:70475034-70475056 AAGCATGATGAACCCCACTGGGG - Intronic
934658709 2:96131855-96131877 AGGCAGGAAGAGCCCCACGAGGG - Intronic
934708631 2:96501616-96501638 AGCCAGGCTGGACCCCACCCAGG - Intronic
937134383 2:119540374-119540396 AGCCAGGAAAAGCCCCACTGAGG + Intergenic
937871908 2:126792205-126792227 AGCCAGGATGGAGCCCACGTAGG + Intergenic
945500182 2:210563160-210563182 AGCCAGGTTAAACACAACTATGG - Intronic
945841440 2:214892177-214892199 ATCCAGGATGAAGCCCAGTTAGG - Intergenic
946629264 2:221648537-221648559 AGACAGGATGAATTCCACCAAGG + Intergenic
948180360 2:235974574-235974596 ATCCAGGATCAACCACACAATGG - Intronic
1168755667 20:315681-315703 AGGCAGGATGAAGCCAACTCAGG - Intergenic
1175826746 20:61940613-61940635 AGCCAGGACGATGCCGACTACGG - Exonic
1179407081 21:41135358-41135380 AGTCAAGATGTTCCCCACTATGG + Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1184117902 22:42432600-42432622 AGACAGGGTGAAGCCCACCAGGG - Intergenic
950435225 3:12975275-12975297 AGCCATGAGCATCCCCACTATGG - Intronic
952692926 3:36230991-36231013 ATCCAGGATGCACCCTACCATGG + Intergenic
954956189 3:54520184-54520206 GGCCAGGAAGAACTGCACTAGGG - Intronic
955316281 3:57941814-57941836 AGCCATGGTCAACCCCACCATGG + Intergenic
960920412 3:122741002-122741024 AGCCTGGTTAAACCCCACTGAGG - Exonic
966718330 3:183036232-183036254 AGCCAGGATGAACCCCACTATGG + Intronic
968736605 4:2300530-2300552 AGCCAGGAGGAGCCCCTCTCTGG - Intronic
969163137 4:5279323-5279345 AGCCAGTTTGAAACCCAGTAAGG + Intronic
971259591 4:25044049-25044071 TGCCAGGAAGACCCCCACTCAGG + Intergenic
971592787 4:28490163-28490185 ATCCAGGATTAAACCCAGTAAGG + Intergenic
972688033 4:41369783-41369805 AGCCAGGCTGTTCCTCACTAGGG + Intronic
975851156 4:78573919-78573941 AGCCAGCTTGATCCACACTATGG + Intronic
985140129 4:186831470-186831492 ATCCATGATGAACCCCTCAAGGG + Intergenic
985615401 5:917021-917043 GGCCTGGAGGAACCCCTCTATGG - Exonic
985764059 5:1767831-1767853 AGCCAGAAGGAGCCCCACTGAGG + Intergenic
993757065 5:91744699-91744721 AGCCAGGATGAGCCACAAGAAGG - Intergenic
998425087 5:142019525-142019547 AGCAAGGTAGAACCCCACTTTGG - Intergenic
1005784322 6:29227504-29227526 AGCCAAGATGAGGCCCACTGAGG + Intergenic
1006887570 6:37395362-37395384 AGCCAGGCTGAAACTCACAAAGG - Intergenic
1012199316 6:96385958-96385980 AACCAAGATGAACCCTACTCTGG + Intergenic
1012584403 6:100904768-100904790 ACCCAGAATGACCCACACTAGGG + Intergenic
1012675606 6:102107957-102107979 AGCCAGGATGAGCCACAGAAAGG - Intergenic
1014913049 6:127117309-127117331 AGCCAGGGTGTGCCCCACTCAGG + Intergenic
1020048565 7:5063594-5063616 AGCCAGAGTCAACCCCACAATGG + Intronic
1020392935 7:7678160-7678182 AGCCAGTATGAAGACCAGTATGG - Intronic
1022603524 7:31785227-31785249 AGCCAGCATTCACCCCACAAAGG + Intronic
1044525839 8:93250493-93250515 AGCCAGGAGGAACCCTGCTCTGG + Intergenic
1046780565 8:118210338-118210360 AGCCAGGATGAAACCTGCTCTGG + Intronic
1049674045 8:143881907-143881929 AGCCAGGACGGAACCCACTCTGG + Intergenic
1050402533 9:5271268-5271290 AGCAAGTATGAACCCCAGTAGGG - Intergenic
1058602599 9:106686528-106686550 AGCCAGGTTTAACCCCAGGATGG - Intergenic
1186924491 X:14317923-14317945 AGCCAGTATGAAAACCAGTACGG + Intergenic