ID: 966718332

View in Genome Browser
Species Human (GRCh38)
Location 3:183036244-183036266
Sequence GCATAGGAAGGGCCATAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966718332_966718341 30 Left 966718332 3:183036244-183036266 CCCCACTATGGCCCTTCCTATGC 0: 1
1: 0
2: 0
3: 17
4: 133
Right 966718341 3:183036297-183036319 GTAGACATTCAATCACAGGATGG 0: 1
1: 0
2: 0
3: 5
4: 143
966718332_966718339 8 Left 966718332 3:183036244-183036266 CCCCACTATGGCCCTTCCTATGC 0: 1
1: 0
2: 0
3: 17
4: 133
Right 966718339 3:183036275-183036297 TATGACACTATGAAGTCTCTAGG 0: 1
1: 0
2: 1
3: 6
4: 118
966718332_966718340 26 Left 966718332 3:183036244-183036266 CCCCACTATGGCCCTTCCTATGC 0: 1
1: 0
2: 0
3: 17
4: 133
Right 966718340 3:183036293-183036315 CTAGGTAGACATTCAATCACAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966718332 Original CRISPR GCATAGGAAGGGCCATAGTG GGG (reversed) Intronic
900308478 1:2022334-2022356 AGATGGGAAGGGCCAGAGTGCGG - Intronic
900997019 1:6128291-6128313 GGATGGGAAGGGCCATTGTTGGG - Intronic
904019123 1:27448867-27448889 GCATATAAAGGGCCATATTGTGG - Intronic
904859738 1:33526900-33526922 GCATAGGACTGGCCAGTGTGTGG - Intronic
906724111 1:48031138-48031160 GCAGTGGAAGGCCCAGAGTGTGG - Intergenic
912556119 1:110517428-110517450 GCACAGGGAGGGCAATGGTGAGG + Exonic
912591456 1:110824814-110824836 GCATGGGAAGGGCTGTAGTGTGG - Intergenic
915107806 1:153545245-153545267 GCATGGGGAGGGGCAAAGTGAGG + Intronic
915244018 1:154543748-154543770 GGAAAGGAAGGGCCATTCTGGGG - Intronic
915918264 1:159954298-159954320 ACATAGGGAGGGGCTTAGTGAGG - Intergenic
917440487 1:175064442-175064464 GCATAGGAAGGGGCATGATGGGG + Intergenic
917830934 1:178885182-178885204 ACATAGGAAGTGCCATAGTTTGG + Exonic
1064955978 10:20910578-20910600 GCATTGGAAGGGCCACATTTGGG + Intronic
1071152737 10:82653732-82653754 GCAGAGGAAGGGCAATGGTTTGG + Intronic
1072857809 10:98968136-98968158 GCATAAGAGTGGCCATTGTGAGG - Intronic
1079832439 11:25285235-25285257 GAATAGGAAGGGCCAAGGAGAGG + Intergenic
1080255220 11:30282533-30282555 GCACAGGAAAGGACATGGTGAGG + Intergenic
1080621114 11:33987826-33987848 TAAGTGGAAGGGCCATAGTGGGG + Intergenic
1088154476 11:106786528-106786550 GCACAGGAATGTCCATCGTGTGG + Intronic
1090567764 11:128014446-128014468 CCAAAGAAAAGGCCATAGTGTGG + Intergenic
1090777156 11:129975659-129975681 GCAGAGGAAGGGCCAGTGGGAGG - Intronic
1091124688 11:133083453-133083475 GCCTGGGAAGGGCCAGAGAGGGG + Intronic
1091974186 12:4811382-4811404 GCACAGGCAGGGCAATGGTGAGG - Exonic
1092002878 12:5045662-5045684 GCACAGGCAGGGCAATGGTGAGG - Exonic
1095989068 12:48021755-48021777 GCCTAGGAAGGCCCTAAGTGTGG + Intronic
1098483909 12:70998688-70998710 GCATGGTAAGGATCATAGTGAGG + Intergenic
1112222407 13:97504226-97504248 GCAAAGGAAGGAGGATAGTGGGG + Intergenic
1113811879 13:113147658-113147680 GCAGAGGAAGGGGAAGAGTGGGG + Intronic
1117851015 14:59969597-59969619 GCAGAGGGCTGGCCATAGTGGGG + Intronic
1122406793 14:101505600-101505622 GCATAGGCAGAACCAGAGTGTGG + Intergenic
1126738193 15:51752073-51752095 GCACAGGAAGGGGAAAAGTGGGG - Intronic
1128572252 15:68742316-68742338 GCATAGGAAGGGAAATAGAAAGG + Intergenic
1131962439 15:97803909-97803931 ACCTGGGAAGGCCCATAGTGAGG - Intergenic
1132786319 16:1658724-1658746 GCATAGGAAGGGTCATGAGGTGG + Intronic
1135869984 16:26140748-26140770 GCAAGGGAAAGGCCACAGTGAGG - Intergenic
1136507248 16:30712582-30712604 TCCTAGGAAGGGCCAAAGGGTGG + Intronic
1136615998 16:31398890-31398912 TCAGAGGAAGGACCTTAGTGTGG + Intronic
1136773165 16:32858435-32858457 GAACAGGAAGGCCCATGGTGGGG - Intergenic
1136897450 16:34003084-34003106 GAACAGGAAGGCCCATGGTGGGG + Intergenic
1139448362 16:67012588-67012610 GCATAGGGACTGCCACAGTGGGG - Intergenic
1141873419 16:86805369-86805391 GCAGTGGAAGGGGCAGAGTGGGG - Intergenic
1203075588 16_KI270728v1_random:1120545-1120567 GAACAGGAAGGCCCATGGTGGGG - Intergenic
1147960104 17:44162108-44162130 GCAAAGGAAGGCCCAAAGTGAGG - Exonic
1150380293 17:64714751-64714773 GCTTAGGAAAGGGCATAGTGGGG + Intergenic
1150776184 17:68083533-68083555 GCTTAGGAAAGGGCATAGTGGGG - Intergenic
1151443246 17:74147413-74147435 TCATAAGAAGGGCCAAAGTGAGG + Intergenic
1152884589 17:82842155-82842177 GCTTAGGAAAGGCCAAGGTGGGG - Intronic
1153202440 18:2659796-2659818 GCTTAGCAAGTGCCATAGTAAGG + Intronic
1154176305 18:12088654-12088676 GAACAGGCAGGGCCATGGTGTGG - Intergenic
1154415635 18:14173994-14174016 GAACAGGCAGGGCCATGGTGGGG + Intergenic
1155914689 18:31544851-31544873 GCATCTGAAGGGCCCTAGAGAGG + Intronic
1160717117 19:581490-581512 GCCCAGGAAGGGCCAGAGGGCGG - Exonic
1163197339 19:15732393-15732415 GATAAGGAAGGGCCATACTGAGG - Intergenic
1164037269 19:21466110-21466132 GCCTAAGAAGGGCCATAATTGGG - Intronic
930392935 2:50784820-50784842 GGACAGGAAGATCCATAGTGGGG + Intronic
931347183 2:61457305-61457327 CCATAGGAAGGGCCAAACTGAGG + Intronic
932958994 2:76390051-76390073 AAATTGGAAGGGTCATAGTGAGG + Intergenic
934578021 2:95415194-95415216 CCAAAGGATGGGCCATACTGAGG - Exonic
934601417 2:95661508-95661530 CCAAAGGATGGGCCATACTGAGG + Intergenic
936534786 2:113303677-113303699 CCAAAGGATGGGCCATACTGAGG + Intergenic
936829891 2:116631135-116631157 GCATATGACTGGCCCTAGTGAGG - Intergenic
937452287 2:122011483-122011505 GGACAGAGAGGGCCATAGTGGGG + Intergenic
939306994 2:140425169-140425191 GCATAGGATGGGCAATATAGGGG - Intronic
948332217 2:237178503-237178525 CCCTTGGAAGGGCCACAGTGGGG + Intergenic
948827798 2:240581852-240581874 GCAGATGAAGGGCCATGGAGGGG - Intergenic
1169350286 20:4863181-4863203 GGATAGGCAGGGGCAAAGTGTGG - Intronic
1169350442 20:4863991-4864013 GGATAGGCAGGGGCAAAGTGTGG - Intronic
1171238655 20:23547866-23547888 GCACAGGAAGGGACAGTGTGTGG + Intergenic
1172753191 20:37265565-37265587 GCCCAGGAAGGGCCTTAGTGTGG - Intergenic
1174698557 20:52584799-52584821 GCAGTGGAAGGGGCATAGAGTGG + Intergenic
1175050708 20:56152729-56152751 GCTTAGGAAGGGCCAATGTGGGG - Intergenic
1175160474 20:57004296-57004318 GCACAGGAAGTGCCAGGGTGGGG - Intergenic
1175206996 20:57318706-57318728 GTACAGGAAGGGACGTAGTGAGG - Intergenic
1176368037 21:6045442-6045464 GCATAGAAGGGGCAACAGTGGGG + Intergenic
1176857693 21:13985282-13985304 GAACAGGCAGGGCCATGGTGGGG - Intergenic
1176866906 21:14058917-14058939 GAACAGGCAGGGCCATGGTGGGG + Intergenic
1177432798 21:21012500-21012522 GCACAGGAAAGGCCATATAGAGG + Intronic
1177865291 21:26505912-26505934 GCAGAGAAAGGGTCAAAGTGGGG - Intronic
1179755482 21:43493100-43493122 GCATAGAAGGGGCAACAGTGGGG - Intergenic
1181041612 22:20195091-20195113 GCAGAGAAAGGGCCATCCTGGGG - Intergenic
1182669786 22:31985975-31985997 GCATAGAAAAGGTTATAGTGTGG + Intergenic
1183101884 22:35589165-35589187 GCATGGGCAGGGGCAGAGTGTGG - Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
950186292 3:10947734-10947756 GTATAGGAAGGGTCAGAATGGGG + Intergenic
954809344 3:53238552-53238574 GCAGCAGAAGTGCCATAGTGGGG - Intronic
963179224 3:142336505-142336527 GCAGGGGAAGGGGAATAGTGAGG + Intronic
966718332 3:183036244-183036266 GCATAGGAAGGGCCATAGTGGGG - Intronic
968712110 4:2126774-2126796 GGACAGGAAAGGCCAGAGTGAGG + Intronic
969047547 4:4347652-4347674 GCATGGGAAGTGTCATATTGTGG - Intergenic
970936899 4:21582507-21582529 GAATAGGAAGGGCAATGATGGGG - Intronic
971778035 4:30993217-30993239 GCATTGGAAGAGCCATAGGTAGG - Intronic
976818161 4:89174515-89174537 GCTTAAGAAGGGGCAGAGTGAGG - Intergenic
979659075 4:123231812-123231834 GCATAGGAAGGCCCAAGGAGAGG + Intronic
986210573 5:5667674-5667696 GCACAGCAAGGGCCTTTGTGGGG - Intergenic
991552388 5:67854512-67854534 GCATAGGAACTGACATAGTGTGG + Intergenic
997850940 5:137332096-137332118 GCCTAGGCAGGGCCAGAGAGGGG - Intronic
998203186 5:140141679-140141701 CCATAGGAGAGGACATAGTGGGG + Intergenic
998514425 5:142739858-142739880 GCATAGGAAGGGAGGTAGGGAGG - Intergenic
1000551850 5:162675903-162675925 GCATAGGTAGGGCCACATGGAGG + Intergenic
1003584941 6:7380149-7380171 TCATAGGAAGGACTATAGTATGG + Intronic
1004629978 6:17411922-17411944 GCTTAGAAAGGGCTATAGAGGGG + Intronic
1006643553 6:35500878-35500900 GCATAGGAAGGACAACTGTGGGG + Intronic
1007910050 6:45504458-45504480 GCATAGGAAGAGCCCTAGACTGG - Intronic
1008444831 6:51576084-51576106 GCATAGGAAGGTCCTTGGTGTGG + Intergenic
1012433426 6:99189883-99189905 GGAAAGGAAGGGCCACAGGGTGG + Intergenic
1012809535 6:103939719-103939741 GCAGAGGAAGGACAAAAGTGGGG + Intergenic
1013375206 6:109508379-109508401 GCATAAGAAGGACCTCAGTGAGG - Intronic
1020109496 7:5440039-5440061 GCACCTGAAGGGCCAGAGTGAGG + Intronic
1022558565 7:31325508-31325530 GCTTGGGCAGGGCCATAGAGGGG - Intergenic
1022866521 7:34427345-34427367 ACATGGGAAAGGCCATCGTGTGG + Intergenic
1024075042 7:45813870-45813892 GCATGGGAGGGGCCAGTGTGAGG - Intergenic
1024118957 7:46218157-46218179 GTGTAGGATGGACCATAGTGTGG + Intergenic
1024213304 7:47225975-47225997 GGAGAGGAAGTGGCATAGTGAGG - Intergenic
1025129528 7:56368251-56368273 GCATGGGAGGGGCCAGTGTGAGG + Intergenic
1025129710 7:56368980-56369002 GCATGGGAGGGGCCAGTGTGAGG + Intergenic
1026238246 7:68548212-68548234 GGATAGGAAGGGCAATAATTTGG + Intergenic
1026256114 7:68713351-68713373 GGATAGGAAGGCCCATAGAGAGG + Intergenic
1027358745 7:77385799-77385821 GAATAGGGAGGCCCATAGGGTGG + Intronic
1028116272 7:87001491-87001513 CCAGAGGAAGTGGCATAGTGAGG + Intronic
1028884176 7:95912774-95912796 GCAGAGGAAGGACAAAAGTGTGG - Intronic
1031860222 7:126970880-126970902 GCATAGGGAGGTCCAAAGAGAGG + Intronic
1032020472 7:128405029-128405051 GCATCAGAAGGGGCAGAGTGGGG - Intronic
1035530862 8:349909-349931 GCAGAGGAAGGGCCATGATGGGG + Intergenic
1041702285 8:60804740-60804762 GCATAGGAAAGGCCTAAGTTAGG + Intronic
1043862946 8:85342535-85342557 GCATAGGAGGGGAATTAGTGTGG - Intronic
1044744976 8:95362972-95362994 GCACAGCAAGAGCCAAAGTGGGG + Intergenic
1046654444 8:116877398-116877420 GCATAAGAAGGGTAAAAGTGAGG - Intergenic
1048802595 8:138207640-138207662 TCATAGGAAGGCACATACTGTGG + Intronic
1052956092 9:34254256-34254278 GCATAGGCAGGACCAGCGTGTGG + Exonic
1053691152 9:40588158-40588180 GAACAGGAAGGCCCATGGTGGGG - Intergenic
1054273652 9:63049333-63049355 GAACAGGAAGGCCCATGGTGGGG + Intergenic
1054302412 9:63389129-63389151 GAACAGGAAGGCCCATGGTGGGG - Intergenic
1054401182 9:64715623-64715645 GAACAGGAAGGCCCATGGTGGGG - Intergenic
1054434793 9:65199949-65199971 GAACAGGAAGGCCCATGGTGGGG - Intergenic
1054495596 9:65821732-65821754 GAACAGGAAGGCCCATGGTGGGG + Intergenic
1054750102 9:68897051-68897073 GCAAAGCAAGGGCAATATTGGGG - Intronic
1055802944 9:80060467-80060489 GCTTAGGAAGGGAAATATTGTGG + Intergenic
1058700961 9:107599845-107599867 GGACAGGAAGGGCCACAGTGGGG - Intergenic
1058906612 9:109487179-109487201 GCAGAGGAAGAGCCAAGGTGTGG + Intronic
1060597925 9:124859164-124859186 AAATGAGAAGGGCCATAGTGTGG - Intronic
1187265644 X:17730276-17730298 GCATAGGAAGTGGCAGAGTTGGG - Intronic
1187814029 X:23211518-23211540 GCAAAGGAAGGAACATGGTGAGG + Intergenic
1189904274 X:45742039-45742061 GCATAGTAAAGGCCATCGTGAGG + Intergenic
1192430350 X:71107511-71107533 GAAAAGGAAGGGCCAGACTGAGG + Exonic
1194759809 X:97782536-97782558 GAATAGGAAGGACCAAAGAGAGG - Intergenic
1195249876 X:103032438-103032460 GCATGGGTAGGGCTTTAGTGTGG - Intergenic
1196456021 X:115892229-115892251 GCACAGGGAGGGGCACAGTGGGG + Intergenic
1199493005 X:148422070-148422092 GCATGGTAAGGGCAATACTGGGG - Intergenic
1199663958 X:150081923-150081945 GGATAATAAGGGCCATAATGGGG + Intergenic
1199690632 X:150306580-150306602 GCAGAGTGAGGGCCAGAGTGAGG - Intergenic
1200125596 X:153812757-153812779 TCATCAGAAGGGCCACAGTGTGG - Intronic