ID: 966721240

View in Genome Browser
Species Human (GRCh38)
Location 3:183064527-183064549
Sequence GCTGGTGGCGTGCCATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966721240_966721247 9 Left 966721240 3:183064527-183064549 CCTGCTCATGGCACGCCACCAGC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 966721247 3:183064559-183064581 GCGCACAAGTGCAGCACCAGCGG 0: 1
1: 0
2: 0
3: 5
4: 71
966721240_966721250 29 Left 966721240 3:183064527-183064549 CCTGCTCATGGCACGCCACCAGC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 966721250 3:183064579-183064601 CGGGCTGCACGCCAGCTCCCCGG 0: 1
1: 0
2: 1
3: 15
4: 215
966721240_966721248 10 Left 966721240 3:183064527-183064549 CCTGCTCATGGCACGCCACCAGC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 966721248 3:183064560-183064582 CGCACAAGTGCAGCACCAGCGGG 0: 1
1: 2
2: 1
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966721240 Original CRISPR GCTGGTGGCGTGCCATGAGC AGG (reversed) Intronic
900417108 1:2540335-2540357 GCAGCTGGCGTGCCCTGCGCAGG - Intergenic
901448075 1:9320073-9320095 CCTGGCGGCCTGCCCTGAGCAGG - Intronic
901881515 1:12196791-12196813 CCTGGTGGCGTGCGTAGAGCAGG + Intronic
902631163 1:17705526-17705548 GCTGGGGCTGGGCCATGAGCTGG + Intergenic
903832882 1:26185039-26185061 GCGGGTGTCATGCCGTGAGCTGG + Exonic
905477535 1:38239441-38239463 GCTGGGGGAGTGCCATGTGCTGG - Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906846348 1:49197269-49197291 GCTCGTGGTTTACCATGAGCAGG + Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
908169268 1:61488522-61488544 ACTGGTGGGGGGCCATGAGAAGG + Intergenic
911831439 1:102554965-102554987 GGTGGTTGCTTGCCATCAGCAGG - Intergenic
914747752 1:150512120-150512142 GCTGGTGCCGGGAGATGAGCTGG - Intronic
914962507 1:152219259-152219281 GCTGGAGGAGTGCCCTGAACTGG + Exonic
914998120 1:152562472-152562494 CCTGGTGAGGTTCCATGAGCTGG - Intronic
920184082 1:204149914-204149936 GCTGGTGGCCTGCTATGTGGAGG - Exonic
920963743 1:210685472-210685494 CGTGGTGGCATGCCAGGAGCAGG + Intronic
923216177 1:231850130-231850152 TCTGGTAGTGTGCCAAGAGCAGG + Intronic
923955323 1:239011582-239011604 GCTGGTGGCTGGCCAGGGGCTGG - Intergenic
924727431 1:246683532-246683554 GCTGCTGCGCTGCCATGAGCGGG + Intergenic
1065044047 10:21729625-21729647 GCTGGTGAGGTGACAAGAGCTGG - Intronic
1066464430 10:35640418-35640440 CCTGGTGGCGGGCCACGAGAAGG - Exonic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1067688075 10:48479696-48479718 GCTGGGAGCTGGCCATGAGCAGG + Exonic
1073381171 10:103079058-103079080 GCAGGTTGCGTGCCAGTAGCAGG - Exonic
1076681687 10:132175479-132175501 GCTGGTGGGGTCCCTTGAGCCGG + Intronic
1077041836 11:528263-528285 GCTGGTGGCGAGTCCTGAGCAGG + Intergenic
1077045832 11:544802-544824 GCTGGGGCCCTGCCATGAGGGGG + Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078188088 11:9069268-9069290 GCTGCAGCCGTGCCATGAGGTGG + Intronic
1080861835 11:36156691-36156713 GCTGGGTGGGTGCCATGAGGAGG - Intronic
1081285771 11:41268199-41268221 GCTGGGGGCCTGCCATGCTCTGG + Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1084311193 11:68317274-68317296 GCTGGTGGGGTCCCAAGAGCTGG + Intronic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1090975108 11:131673351-131673373 GCTGGTGGCCTTCTCTGAGCAGG + Intronic
1092392736 12:8095624-8095646 GCTGGTGTCGTGACAGGAGCAGG - Exonic
1097185548 12:57194528-57194550 GGTGGTGGCCTGCGGTGAGCAGG + Intronic
1102960875 12:117092538-117092560 GCTGGGGGGGTCCCATGATCTGG + Intronic
1107889904 13:44905213-44905235 GCTGGAGTCCTGCCCTGAGCTGG - Intergenic
1107910489 13:45101017-45101039 GCTGCTGGCATGCGAGGAGCTGG + Intergenic
1112501577 13:99947160-99947182 GCAGGAGCCGTGCCATGAGTAGG - Intergenic
1113661370 13:112108285-112108307 GCAGGTGGGGTGGCAGGAGCTGG - Intergenic
1117351520 14:54886001-54886023 GCTGGTAGCATTCCAGGAGCTGG - Intronic
1118346639 14:64945947-64945969 GCAGGTGGCGTGCCTGGGGCTGG + Exonic
1118630452 14:67697677-67697699 GCAGGTGGTGTTCCATGAGAGGG + Intergenic
1122596841 14:102899599-102899621 GCTGGAGGAGTGCCTGGAGCTGG - Intronic
1122628753 14:103097879-103097901 GCTGGTGAGGTGTCATCAGCGGG + Intergenic
1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG + Intergenic
1125143663 15:36440411-36440433 GCTGGTGGAGTACCCTGAGGAGG + Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128906338 15:71471193-71471215 GCTGGTTGAGTGTCATGAGTGGG - Intronic
1129928094 15:79384076-79384098 GATGGTGGTGTGACCTGAGCTGG + Intronic
1129988921 15:79944713-79944735 GCTAGTAGCGTTCCAGGAGCTGG + Intergenic
1133326177 16:4943665-4943687 GTTGGTGGCCTCCCATGAGCTGG - Intronic
1133614696 16:7465049-7465071 GCAGGAGGCGTGCCATGCCCTGG - Intronic
1133760881 16:8797581-8797603 GCGGGTGGCGAGCCTTGAGGGGG - Intronic
1134057762 16:11181129-11181151 GCTGGTGGCCTCCAATGGGCTGG - Exonic
1137506194 16:49056003-49056025 GCTGGAGGAGAGGCATGAGCTGG + Intergenic
1137576542 16:49603884-49603906 CCTTGTGGCTTGCCAGGAGCAGG + Intronic
1143021093 17:3917551-3917573 CTTGCTGGCGAGCCATGAGCTGG + Intergenic
1146290234 17:31601519-31601541 GCAGGTGGCCTGAGATGAGCAGG - Intergenic
1147157758 17:38552779-38552801 GCTGGTGCCCGGCCCTGAGCTGG - Exonic
1147232135 17:39027283-39027305 GCTGGCGCCGCGCCCTGAGCCGG - Intergenic
1147922623 17:43927360-43927382 GCTGGCGCCGTGCACTGAGCGGG + Intergenic
1148947476 17:51276869-51276891 GGAGGTGGCGTGCCCTGAGAAGG - Intronic
1150725278 17:67646654-67646676 GCTGGTGTGGTGGCATGTGCTGG - Intronic
1151757414 17:76082704-76082726 GCTGGGGGCGGGCCATGACAGGG + Exonic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1157508840 18:48253081-48253103 GCTGGAGCAGTGCCCTGAGCTGG + Intronic
1161557372 19:4951494-4951516 GCTAGGGGGGTGCCATCAGCTGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163375715 19:16929041-16929063 GCTGGTGGAGATCCATGACCTGG + Exonic
1163499760 19:17669350-17669372 GCTGGGTGCGGGCCATGACCTGG - Intronic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1168594468 19:57664333-57664355 GCTGGCGGCGGGCGAGGAGCTGG + Intergenic
1202683237 1_KI270712v1_random:29210-29232 GCTGGGGGCGGGCAATAAGCCGG - Intergenic
925184150 2:1835834-1835856 GCTGGAGCCCTGCCATGGGCTGG - Intronic
925592018 2:5519380-5519402 GTTGGAGGCCTGCCAGGAGCAGG + Intergenic
925893311 2:8453265-8453287 GCTGCTGCCGTACCATTAGCTGG - Intergenic
928854765 2:35790206-35790228 GGTGGTTGTGTGCCATAAGCTGG + Intergenic
929966637 2:46542159-46542181 GGTGGTGGCGGTCCTTGAGCTGG - Intronic
934649433 2:96082551-96082573 CTTGGTGCCTTGCCATGAGCAGG + Intergenic
948862635 2:240760307-240760329 GCTGGCGGAGCGCCAAGAGCGGG - Intronic
948916139 2:241035878-241035900 GGTGGGGGCGTGCCATGGGGTGG + Intronic
1168808616 20:688397-688419 CCTGGTGACGTGCCAGGACCTGG + Intergenic
1170570054 20:17627521-17627543 GCTGGAGGCGGGCCAGGCGCGGG - Exonic
1171415733 20:24979366-24979388 GGAGGTGGCGTGCCCTGTGCTGG - Intronic
1173835155 20:46120009-46120031 GATGGTGTCTTGCAATGAGCTGG + Intronic
1174592781 20:51659192-51659214 GCAAGTGGAGTGCCATGAACTGG - Intronic
1177793680 21:25749437-25749459 GCTGCTGCCCTGCCATGATCTGG + Intronic
1179887927 21:44322322-44322344 GCTGGTGGTCTGCCCAGAGCAGG + Intronic
1180067668 21:45420718-45420740 GCTGGAGGTGTGGCATGTGCAGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181035586 22:20168407-20168429 GCTGGTGGCGAGCCATGATGGGG - Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1183513167 22:38247769-38247791 CCTGGTGGCATGTGATGAGCAGG + Exonic
1184178495 22:42803613-42803635 GCTGGGGGACTGCCATCAGCTGG - Intronic
1184425906 22:44409235-44409257 TCTGGTCGCGTCCCAGGAGCTGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
956692881 3:71893988-71894010 ACTTCTGGCCTGCCATGAGCAGG - Intergenic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
967740445 3:192997601-192997623 GCTGCTGCCGAGCCATGAACTGG - Intergenic
967983196 3:195077772-195077794 GGTGGTGCCGTGCCATGTGGAGG - Intronic
969060745 4:4432391-4432413 GCTGCCCGTGTGCCATGAGCAGG - Intronic
969696639 4:8738715-8738737 GCAGGAGGTGGGCCATGAGCTGG - Intergenic
973530934 4:51836208-51836230 GCTGGTGGGGTAGCATGAGTGGG + Intergenic
976830033 4:89305338-89305360 GCTGGTGGAGTGCCCTGACAGGG - Intronic
990923544 5:60994131-60994153 GCTGGGTGTGTGCCATGATCAGG - Intronic
999870674 5:155747055-155747077 GCAGGTGGCCAGACATGAGCAGG - Intergenic
1002448336 5:179303678-179303700 GCCTGTGGGCTGCCATGAGCTGG - Intronic
1002566878 5:180117106-180117128 GGTGGCGGCCTGCCAGGAGCCGG - Intronic
1003602345 6:7529286-7529308 GCTATTGGCTTGCCATGAGCTGG - Intergenic
1010572577 6:77495543-77495565 GCTAGTGGCTTGCAATGGGCAGG + Intergenic
1014570891 6:123006156-123006178 GCTGGTGGCGGGCCCAGAGGAGG + Intronic
1017382293 6:153844739-153844761 GCTGGTGGCTTGCCACGTGGGGG + Intergenic
1019188560 6:170236164-170236186 GCAGGTGACGTGTCATTAGCCGG + Intergenic
1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG + Exonic
1021941809 7:25685901-25685923 GCTGGTCGGTTGCCCTGAGCAGG - Intergenic
1023191274 7:37585606-37585628 GCTGGTGTTGTGACAGGAGCAGG + Intergenic
1024626525 7:51212633-51212655 ACTGGTGGGGTGGCATGAACAGG - Intronic
1026936147 7:74257003-74257025 TCTGCTGGCGTGCCAAGATCAGG + Intergenic
1031322920 7:120355476-120355498 GGTGGGGGGGTGCAATGAGCTGG + Intronic
1033663726 7:143422170-143422192 GCTGGTGGCAGGTCATGGGCAGG + Intergenic
1034224648 7:149473346-149473368 ACACGTGGCGTGCCATGAGTGGG - Exonic
1036619660 8:10416096-10416118 GCAGGTGCCGTGCCAGGTGCTGG - Intronic
1049020915 8:139957225-139957247 CCTGGGAGGGTGCCATGAGCAGG + Intronic
1049275432 8:141717896-141717918 GGAGGGGGCGTGCCAGGAGCTGG - Intergenic
1049290014 8:141796868-141796890 GCTGGTGCCCTGCCAGAAGCCGG + Intergenic
1055532038 9:77194195-77194217 GCTGGTGGAGGCCCATGTGCAGG + Intronic
1060719169 9:125963304-125963326 GCTGGTGTCCTGTCATCAGCAGG + Intronic
1062062473 9:134503836-134503858 GCTGGTTCCTTGGCATGAGCTGG - Intergenic
1062178850 9:135179867-135179889 ACTGGTGGCATGGCCTGAGCAGG + Intergenic
1185932559 X:4219245-4219267 ACTGATGGAGTGCCAGGAGCTGG - Intergenic
1186412357 X:9355000-9355022 GCGTGTGGAGTGCCATGACCGGG + Intergenic
1187698235 X:21941309-21941331 GCTGGGGGCGTGCGCCGAGCGGG + Intronic
1198329241 X:135606236-135606258 GCAGGCAGCGTGCCAGGAGCTGG - Intergenic