ID: 966721326

View in Genome Browser
Species Human (GRCh38)
Location 3:183064950-183064972
Sequence CAGTTTGCACAGAGAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 13, 2: 39, 3: 115, 4: 439}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966721326_966721328 -10 Left 966721326 3:183064950-183064972 CCTTTCTCTCTCTGTGCAAACTG 0: 1
1: 13
2: 39
3: 115
4: 439
Right 966721328 3:183064963-183064985 GTGCAAACTGGTTGAATGAATGG 0: 20
1: 30
2: 62
3: 57
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966721326 Original CRISPR CAGTTTGCACAGAGAGAGAA AGG (reversed) Intronic
901264309 1:7898403-7898425 CAAGATGGACAGAGAGAGAAGGG + Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
903980131 1:27180248-27180270 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
904953794 1:34266336-34266358 CAGGATGCACAGAGAGTGAATGG - Intergenic
906225827 1:44120349-44120371 AAGCTTGCCCAGAGAGAGCAGGG + Intronic
906650616 1:47509949-47509971 CATTTTACCCAGAGAGATAAAGG + Intergenic
906852804 1:49270013-49270035 CAGATTGCACAGAGAGAGGTTGG - Intronic
906942112 1:50264548-50264570 CAGTTTGCAGAGACAGATCATGG + Intergenic
907159597 1:52360601-52360623 CAGCTTCCGCAGAGGGAGAATGG - Intronic
907357331 1:53886972-53886994 CAGCTTGGGCAGAGACAGAAAGG + Intronic
907710449 1:56875933-56875955 CAGTGAGAACAGAAAGAGAATGG + Intronic
908289347 1:62646553-62646575 GTGTGTGCACAGAGAGAGAGAGG - Intronic
908502838 1:64761369-64761391 CAGTTTCAAAAGAGGGAGAAGGG + Intronic
908956639 1:69637966-69637988 AGTTTTGCAAAGAGAGAGAAAGG + Intronic
909456476 1:75855456-75855478 CAGGTTTCGCAGAGAGAGCATGG - Intronic
909825048 1:80117229-80117251 CAGTCTGCACAGAAAGAAAGAGG + Intergenic
909863614 1:80637995-80638017 CAGTTTGCACTGGGAGAGGGAGG - Intergenic
910028828 1:82690507-82690529 CAGTGGGGAGAGAGAGAGAAAGG - Intergenic
912111166 1:106345090-106345112 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
912507188 1:110164391-110164413 CAGTTTGTTCAGAGATAAAATGG + Intronic
912816987 1:112837395-112837417 TAGTATGCCCAGAGAGAGCACGG - Intergenic
913030453 1:114897433-114897455 CAGTTTGCACAGGGAAGGGAGGG + Intronic
914379185 1:147101083-147101105 CAGTTAGCAAAGAGAGAGCAGGG + Intergenic
915656484 1:157365151-157365173 CAGTTTGCACAGGAAGAGGGAGG + Intergenic
915672803 1:157504420-157504442 CAGTTTGCACAGGAAGAGGGAGG - Intergenic
915824044 1:159056678-159056700 CAGTTTGCACAAGGAGAGGGAGG + Intergenic
915946679 1:160157711-160157733 GAGTATACACAGAGAGAGAGAGG + Intronic
915957107 1:160230316-160230338 CAGTTTGAAAGGAGAGAGAGGGG - Intronic
916626085 1:166556657-166556679 TGGTTTGCTCAGAGAGAGAGGGG - Intergenic
917076821 1:171214467-171214489 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
917654409 1:177112091-177112113 CAGATTGCACATATAGAGGAGGG - Intronic
918122370 1:181550833-181550855 CAGTTTGTACTGAGAGGGAGGGG + Intronic
918878632 1:190084489-190084511 CAGTTTGCACTGGGAGAGGGAGG - Intergenic
918939751 1:190977399-190977421 CAATTTAGACAGAGAGTGAATGG - Intergenic
919156628 1:193774565-193774587 AAGCTTGCCAAGAGAGAGAAAGG - Intergenic
920061699 1:203231225-203231247 CAGTTTACACAGATAGTAAATGG - Intronic
920157838 1:203969878-203969900 CAGTCTGCACAGAGAGAGAGAGG + Intergenic
920830150 1:209457222-209457244 CAGTGTGGAAAGAAAGAGAAAGG - Intergenic
921021558 1:211240382-211240404 CCATTTGCAGAAAGAGAGAAGGG - Intergenic
921278478 1:213542503-213542525 CAGCATACACTGAGAGAGAAAGG - Intergenic
921613689 1:217242146-217242168 CAATTTGCACAGGGAGATGAGGG + Intergenic
922057898 1:222059005-222059027 TACTTTGCACAGGTAGAGAATGG - Intergenic
922221179 1:223609816-223609838 CAGTTTTCACAGATAGTCAAAGG - Intronic
922567780 1:226612123-226612145 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
923262487 1:232280804-232280826 GAGTTTGAAAAGAAAGAGAAAGG + Intergenic
923874317 1:238030973-238030995 CAGATGGGAAAGAGAGAGAAAGG + Intergenic
924296790 1:242595402-242595424 CAGTTTGCACAGAGAGGAAGAGG - Intergenic
924538274 1:244957155-244957177 CAATTTGCAAATAAAGAGAAGGG - Intergenic
924583552 1:245342447-245342469 CAGTCTGGACAAGGAGAGAATGG + Intronic
1062867170 10:865512-865534 CAGTGTGCCCAGAGACAGCAAGG - Intronic
1063384249 10:5606224-5606246 GAGTTTATACAGAGAGAGACAGG - Intergenic
1064110152 10:12531613-12531635 CATTTTGCACAGAAAGAGCGTGG + Intronic
1064602796 10:17010208-17010230 CAGTGTGAAAAGAGACAGAAAGG - Intronic
1065252294 10:23827915-23827937 CTGTTTGCCCAGGGAAAGAATGG + Intronic
1066178645 10:32938316-32938338 CAGTTTCCACACAAAGGGAATGG + Intronic
1066585548 10:36930425-36930447 CAGTTTGTGTAGAGAGACAATGG - Intergenic
1066802617 10:39207721-39207743 CAGTTTTCATAGACAGACAAGGG + Intergenic
1066977022 10:42378512-42378534 CGGTTTGCACAGAGAGATAAAGG + Intergenic
1066995398 10:42558456-42558478 CAGTATGCAAAAATAGAGAAAGG - Intergenic
1068952901 10:62794961-62794983 CAGTTAGCTCACATAGAGAAGGG - Intergenic
1069225975 10:65944584-65944606 CATTGTGCAGGGAGAGAGAAGGG + Intronic
1070752933 10:78974389-78974411 CAGATTACACAGGGAGAAAAAGG + Intergenic
1071012298 10:80953051-80953073 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1072470887 10:95712024-95712046 CAGATTCCACAGAGGGAGAGAGG - Intronic
1073746938 10:106479864-106479886 CAGTTTGCATTTAGAGACAAAGG - Intergenic
1073811544 10:107157521-107157543 CATTTTGCAAAGAGAAAAAAGGG + Intronic
1073851526 10:107624586-107624608 AAGAATGCACAGAGAGGGAAAGG - Intergenic
1075663521 10:124214814-124214836 CAGTCTGCAGAGAGAGACCATGG + Intergenic
1076644477 10:131943226-131943248 CAATTCGCACAGAAATAGAAAGG - Intronic
1076654175 10:132011293-132011315 CAGTTTGCAGAGAGAGAAAGAGG - Intergenic
1076961808 10:133769008-133769030 CAGATTGCAAAAAGAGAGAGAGG - Intergenic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1080010768 11:27457142-27457164 CAGTTTGCTCAGTGATAAAATGG + Intronic
1080196151 11:29611830-29611852 CATTTTGCATAGAAAGAGGATGG - Intergenic
1080690077 11:34549121-34549143 CAGTTTGGGCAGGGAGAAAATGG - Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1080810734 11:35701843-35701865 CAGTTTGCACAGAGAGAGAGAGG + Intronic
1081090220 11:38855858-38855880 TAGTTTGCACAGTGATAGCAGGG + Intergenic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1081742279 11:45449032-45449054 CAGTCTACACAGAGATACAAAGG + Intergenic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1082747795 11:56984954-56984976 CAGTTTACACAGGGAGAGGGAGG + Intergenic
1083125756 11:60564217-60564239 TAGTTTGCACAGGGAGAGGGAGG + Intergenic
1083376444 11:62226639-62226661 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
1084875388 11:72128555-72128577 CATTTTGCACAGGGAGAGAGAGG + Intronic
1085299408 11:75449611-75449633 CTGTTTGCAGGGAGAGGGAAGGG + Intronic
1085902587 11:80719455-80719477 CAGTTTGTGTAGAGAGACAATGG + Intergenic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1086143401 11:83523984-83524006 CCTTTTGCACAGAGGAAGAAGGG - Intronic
1086586101 11:88453840-88453862 CATTTTGCATAAGGAGAGAAGGG + Intergenic
1087272279 11:96123725-96123747 CAGTGTGCACAGATGGGGAAGGG + Intronic
1087308272 11:96508842-96508864 CATTCTTTACAGAGAGAGAAGGG + Intergenic
1087464952 11:98492563-98492585 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1087878291 11:103385311-103385333 CATGATGAACAGAGAGAGAAAGG - Intronic
1088919810 11:114252647-114252669 CAACTTTCTCAGAGAGAGAAAGG - Intergenic
1090168517 11:124577512-124577534 CAGCAGGCACACAGAGAGAATGG + Intergenic
1090255431 11:125280528-125280550 CAGTCTACTCAGAAAGAGAATGG + Intronic
1090266825 11:125358701-125358723 CAGTTAGCCCAGGGAGAGGAAGG - Intronic
1090579741 11:128146791-128146813 CAGTTTGCGAAGAGTGTGAAAGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091019467 11:132086729-132086751 TGGTTTGCACAGGGAGAGAGGGG + Intronic
1091359956 11:134971306-134971328 GAGGTTTAACAGAGAGAGAATGG - Intergenic
1092585692 12:9899081-9899103 CAGTTTGCACAGGGAGAGGCAGG + Intronic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094239950 12:28211196-28211218 CAGTTTGAACAGAGAAAAAGAGG + Intronic
1094316738 12:29144468-29144490 CAGTTTGCACAGGGAGAGACAGG + Intergenic
1095808940 12:46351090-46351112 TAGTTTGGAGAGGGAGAGAAAGG - Intergenic
1096066878 12:48748085-48748107 AAGTTAGCTCAGAGTGAGAATGG - Intergenic
1096246197 12:49988685-49988707 CAGTTTGGACAAAGAGAGACTGG + Intronic
1096290251 12:50336208-50336230 CAGTAGGGAGAGAGAGAGAAAGG - Intronic
1096439781 12:51631198-51631220 CAGATGGCACAGATAGAAAAGGG - Intronic
1097349734 12:58535755-58535777 CAGTCTGGAAAGAGAGAGGAAGG - Intergenic
1097499796 12:60388193-60388215 CAGTTTGCACAGGAAGAGGGAGG + Intergenic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1098559646 12:71857853-71857875 CAGTTACCACAGGCAGAGAAGGG - Intronic
1098587445 12:72170833-72170855 CTATTTGTGCAGAGAGAGAAAGG - Intronic
1098805507 12:75016468-75016490 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1099163511 12:79274436-79274458 CAGTCTGCACAGGAAGAGAGGGG - Intronic
1101058228 12:100942358-100942380 CTGTCTGCACACAAAGAGAAAGG - Exonic
1101196234 12:102385661-102385683 GAGTTTTCAGAGAGAGAGCATGG - Intergenic
1101660350 12:106759761-106759783 CAGTTAGGAAAGAGGGAGAAGGG - Intronic
1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG + Intergenic
1102052775 12:109875076-109875098 TAATTTGGAAAGAGAGAGAAGGG + Intronic
1102572591 12:113836106-113836128 GAGTTTGAAAAGAGAGAGCAAGG - Intronic
1102726004 12:115065655-115065677 CAGTTTTCACACCTAGAGAATGG - Intergenic
1103216846 12:119208256-119208278 CAGTTTGCAGGGAGAGATAGTGG - Intronic
1103345848 12:120249758-120249780 CAACTTCCAAAGAGAGAGAAGGG + Intronic
1104063373 12:125286398-125286420 CAGTTTCTACATATAGAGAATGG + Intronic
1104360967 12:128132842-128132864 CGGATTTCACAGAGAGAAAAAGG + Intergenic
1104628896 12:130382559-130382581 CAGTTTGCAAATGGAGAGAATGG - Intergenic
1104800443 12:131551952-131551974 CAGGTTGGACAGAGAAAAAAGGG + Intergenic
1104964276 12:132502020-132502042 CTGTTTGTACAGAGAGTGCATGG + Intronic
1105561454 13:21496296-21496318 CTGTGTGCACACAGAGAGAAAGG - Intronic
1106624223 13:31403613-31403635 CAGTTTGCATAGAGAGAAAGAGG - Intergenic
1106704699 13:32267971-32267993 CAGTTTGCACAAAGACACTATGG - Intronic
1107111623 13:36704227-36704249 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1107612643 13:42131758-42131780 CATATTGGACAGAAAGAGAAAGG + Intronic
1108204235 13:48072026-48072048 CAGTTTGCACACGGAGAAAGAGG - Intronic
1108507962 13:51129620-51129642 TGGTTTGCACAGAGAAAGAAAGG - Intergenic
1108905327 13:55463610-55463632 AAGTCTGCACATACAGAGAAAGG + Intergenic
1109013016 13:56974655-56974677 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1109388776 13:61667045-61667067 CAGATTGCACAGAGAGAAAGAGG + Intergenic
1110257157 13:73444972-73444994 CAGTTTGCCCAGGGAGAGGGAGG - Intergenic
1110541842 13:76714599-76714621 CATTTAGCACACAAAGAGAATGG + Intergenic
1110623895 13:77629983-77630005 CAGTTTTTACATAGAAAGAAAGG + Intronic
1111133013 13:84000269-84000291 CAGTTTGCACAGGGAGATGGAGG - Intergenic
1112310958 13:98317182-98317204 CAGGTACCAGAGAGAGAGAAGGG + Intronic
1112549243 13:100404231-100404253 CAGTTTGCACAGGGAGAAGGAGG + Intronic
1113968746 13:114172010-114172032 CAGTTTGCACAGAGAAAAAGAGG + Intergenic
1114334823 14:21677250-21677272 CAGTTTACACAGGGAAAGAGAGG - Intergenic
1114392214 14:22322218-22322240 CAGTTCACACAGAGAAACAATGG - Intergenic
1114912355 14:27216578-27216600 CAGTTTGCATAGAGAGAAAGAGG + Intergenic
1115130211 14:30045675-30045697 CAGTTTGCACACAGAGAGAGAGG - Intronic
1115543477 14:34444049-34444071 CATTTTGCACAGGGAGAAAGCGG - Intronic
1116233399 14:42247437-42247459 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1116235489 14:42274110-42274132 TGGTTTGCACAGAGAGAGAGAGG + Intergenic
1116483552 14:45419516-45419538 AGGTTTGCACAGAGACAGAGAGG - Intergenic
1116576737 14:46584951-46584973 CAGTTTACATAGAGAGAAAGAGG + Intergenic
1116726210 14:48563992-48564014 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1117308315 14:54497834-54497856 TGGTTTGCACAGAGAGAGGGAGG + Intergenic
1117705256 14:58460046-58460068 AAGTTTACAGAAAGAGAGAAAGG + Exonic
1118472295 14:66085779-66085801 CAGCATGCAAAGAGAGAAAAAGG + Intergenic
1118999632 14:70870686-70870708 CAGTTTGTACAGGTAGAGAGAGG + Intergenic
1119411143 14:74431308-74431330 CCCTTTACACAGAGGGAGAAAGG - Intergenic
1119677191 14:76564705-76564727 CAGTTTGAAGACAGAGAGAGAGG + Intergenic
1119783310 14:77293834-77293856 CACTGTGCAAAGGGAGAGAAAGG - Intronic
1120314352 14:82872456-82872478 CAATTTGCACAGGGAGAGGGAGG - Intergenic
1120429001 14:84390000-84390022 CATTTAGCACACATAGAGAATGG + Intergenic
1121389045 14:93558652-93558674 TGGTTTGCACAGAGAGCGAGAGG + Intronic
1121565085 14:94903461-94903483 CATTTTGCAAAAAGAAAGAAGGG + Intergenic
1121867139 14:97373108-97373130 TAATTTGCAGAGAGAGGGAAAGG + Intergenic
1124242143 15:28037502-28037524 CAATTGGGACAGAGAGTGAAGGG - Intronic
1125684407 15:41555268-41555290 TACTGTGCCCAGAGAGAGAAAGG + Intergenic
1126249961 15:46555841-46555863 CAGTTTGGTCAGGGATAGAAAGG + Intergenic
1127567971 15:60212191-60212213 CAGTTTACACAGTGAAAAAAGGG - Intergenic
1127632309 15:60838494-60838516 CATCTTGCACAGAGACAGAGTGG - Intronic
1129691378 15:77715609-77715631 CAGTTTCCACAAAGAAATAATGG + Intronic
1132520639 16:386332-386354 GAGTGTCCACAGAGAGAGAGGGG - Intronic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1134295560 16:12942280-12942302 GAGCTTGCACTGAGAGGGAAAGG + Intronic
1134370215 16:13616602-13616624 ATGTTTACACAAAGAGAGAAAGG + Intergenic
1134556403 16:15169332-15169354 CAGTTTGCACAGTGAAAGAAGGG - Intergenic
1134691905 16:16196591-16196613 CAGGAGGCACAGAGAGAGTAGGG + Intronic
1134916983 16:18081045-18081067 CAGTTTGCACAGTGAAAGAAGGG - Intergenic
1135304776 16:21358675-21358697 CAGTTTTCAAAGAGACAAAAAGG - Intergenic
1135353784 16:21752527-21752549 AAGTTTGGAAAGAGAGAGAAAGG - Intronic
1135452273 16:22568665-22568687 AAGTTTGGAAAGAGAGAGAAAGG - Intergenic
1136301517 16:29337801-29337823 CAGTTTTCAAAGAGACAAAAAGG - Intergenic
1137600076 16:49750444-49750466 CAGTTGGCAGAAAGAGAGGAAGG - Intronic
1139272736 16:65698958-65698980 CTGTCTGCAGAGAGAGAGAGAGG + Intergenic
1139308661 16:66009636-66009658 GACTATGCACAGAGAAAGAATGG + Intergenic
1139412649 16:66776676-66776698 TAGATTGAACAGAGGGAGAATGG + Intronic
1139524361 16:67504826-67504848 AAGTTTACTGAGAGAGAGAAGGG - Intergenic
1139777089 16:69323181-69323203 CATTTTGTACATACAGAGAAAGG + Intronic
1140535968 16:75710009-75710031 TGGTTTGCATAGAGAGAGAGAGG - Intronic
1140743278 16:77960479-77960501 CAGATTGCACAGAGAAAGCTAGG + Intronic
1140947152 16:79779604-79779626 GAGATTGCCCAGAAAGAGAAAGG - Intergenic
1141367328 16:83455832-83455854 CAGCTAGCACAGAGAAGGAAAGG - Intronic
1141384599 16:83608292-83608314 CAGTTTTCACAAAGGGACAAAGG + Intronic
1141543066 16:84741709-84741731 CAGTTTGCACAGTTAGTGACAGG + Intronic
1142063220 16:88044498-88044520 CAGTTTTCAAAGAGACAAAAAGG - Intronic
1142978900 17:3660327-3660349 CTGTTTGTACAGAAAGAGACCGG + Exonic
1145266458 17:21381880-21381902 CAGTAAACACAGAGAGTGAATGG + Intronic
1146443918 17:32921281-32921303 CGGTTTGCACAGAGAAAGAGAGG - Intergenic
1146551702 17:33785994-33786016 CAGTTTCCACACTGGGAGAATGG - Intronic
1148519958 17:48263897-48263919 GCGTTTGCACAGAGCAAGAAAGG + Intronic
1148633222 17:49128243-49128265 CACTTTCCAGAGAGGGAGAATGG + Intergenic
1149030481 17:52077416-52077438 CAGTTGGCACAGAAATAGTATGG - Intronic
1149496421 17:57120965-57120987 GAGTTTGCACAAATAGAAAATGG - Exonic
1150207283 17:63418704-63418726 CAGCTAGCACAAAGAGACAACGG + Intronic
1152443471 17:80325328-80325350 CAGTTTGGACAGAGAGACCCTGG + Intronic
1152599604 17:81255458-81255480 CAGGTTGCGCAAAGACAGAAAGG + Intronic
1152850205 17:82629394-82629416 GAGGTTCCACAGAGAGAGCAGGG - Intronic
1154365264 18:13702206-13702228 CAGTTTGCACAGGGAGAGAGAGG - Intronic
1154495156 18:14950703-14950725 GAGGTTTAACAGAGAGAGAATGG + Intergenic
1155713641 18:28912517-28912539 CTGTTTGCACAGAAAGAGAGAGG - Intergenic
1155803551 18:30138985-30139007 CAGTTTACACAGAGAGAAAGAGG + Intergenic
1156097782 18:33556570-33556592 CAGTTTGTACATATACAGAAAGG - Intergenic
1156698454 18:39795769-39795791 CAGTTTGCAGAGGGAGAGGGAGG + Intergenic
1156985313 18:43344109-43344131 CAGTTTTCCCAGAGATAGAGTGG + Intergenic
1157013428 18:43680606-43680628 CAATTTGAACAGAGAGAAAGAGG + Intergenic
1157542542 18:48521935-48521957 CAGTTTCCCCAGGGAGAGAATGG + Intergenic
1158033143 18:52991591-52991613 AAGTTTTCACAAAGAGGGAATGG - Intronic
1159693847 18:71528133-71528155 CAGTATGGAAAGAGAGAAAACGG - Intergenic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1160057686 18:75500049-75500071 CTGTTTCCACAGAGAAAGGAAGG - Intergenic
1160225243 18:77006858-77006880 GTGTTTGCACAGAGAGAGAGAGG + Intronic
1160966487 19:1749058-1749080 CAGTTTGCACTGTGGGAAAATGG - Intergenic
1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG + Intronic
1162205242 19:9050858-9050880 CAGTTTGCCCAGATATAGCATGG + Intergenic
1162599630 19:11658070-11658092 CAGTATGCCCTGAGAGAGAGAGG + Intergenic
1163724960 19:18917721-18917743 CAGCTCGGACAGAGAGAGAGTGG + Intronic
1164461195 19:28449521-28449543 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1164843728 19:31414155-31414177 CAGAATGCACAGAGAGAGATGGG + Intergenic
1165614492 19:37187755-37187777 CAGCTTGAACACAGAGAAAAGGG + Intronic
1167388172 19:49176936-49176958 CACTTTCCACAGAGAGAAACTGG - Intronic
925242487 2:2344132-2344154 CAGACTGCAAAGGGAGAGAAGGG + Intergenic
925483097 2:4298177-4298199 CAGTTTAAACAGAGATAAAATGG + Intergenic
925507356 2:4583369-4583391 GAGTGTGGTCAGAGAGAGAAAGG + Intergenic
926500628 2:13648847-13648869 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
926503623 2:13684045-13684067 CAGTCTGCACAGAGAGAAAGAGG - Intergenic
926805596 2:16707748-16707770 CACTTTTATCAGAGAGAGAAGGG - Intergenic
926926994 2:17996825-17996847 CAGTTTGCACAGGGAGAGGGAGG - Intronic
927274891 2:21254397-21254419 CAGTGTGCTCACAGAAAGAATGG + Intergenic
928344743 2:30481162-30481184 TAGTTAGCACAGAGGTAGAAGGG + Intronic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
929243923 2:39681803-39681825 CAGTTTTTACAAAGGGAGAAAGG + Intronic
930075483 2:47402670-47402692 CAGTTTGCTTAGAAAGAAAAAGG + Intergenic
930924749 2:56803448-56803470 CAGTTTAAACAGACAGAGATAGG + Intergenic
931745144 2:65285383-65285405 CAGGTCGCACAGCTAGAGAATGG - Intergenic
931984019 2:67724216-67724238 CAGTCTGCAAAGAGAGAAAAAGG + Intergenic
932588167 2:73045134-73045156 CAGTTTTCTCAGAGAGGGGATGG - Intronic
933192973 2:79357527-79357549 CAGATAGAAAAGAGAGAGAATGG + Intronic
933279422 2:80316593-80316615 AAGTCTGAACAGAGAGAGAGAGG + Intronic
934725542 2:96615579-96615601 CAGTTTTCAGAGAAAGAAAAAGG + Intronic
936530626 2:113274580-113274602 CATTTTGCTGTGAGAGAGAAAGG - Intronic
936744390 2:115557164-115557186 CAGTATGTACAGAGAGAGAGAGG - Intronic
937711589 2:124985792-124985814 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
937808641 2:126174910-126174932 CATGTTGAACAGAGAGAGAAGGG - Intergenic
938462842 2:131509156-131509178 CAGGCTGCCCAGAGAGAGAGTGG - Intergenic
939584532 2:143990472-143990494 AAGTTTGCACTGAGAAAGACTGG + Intronic
939783409 2:146477670-146477692 AAGTTAGCTCAGAGAGTGAAAGG + Intergenic
939881767 2:147639510-147639532 GAGTTTGCACCCAGAGAGATGGG + Intergenic
940569166 2:155408102-155408124 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
940642999 2:156366818-156366840 CAGGATGCACAGAGTGAGAGAGG + Intergenic
941244649 2:163081162-163081184 AAGTTTTTACAGAGAGAGAATGG - Intergenic
941249866 2:163148315-163148337 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
941324689 2:164099093-164099115 CTGCTGGCACACAGAGAGAATGG + Intergenic
941373388 2:164696087-164696109 CAGTTTGCTCAGACATAAAAAGG + Intronic
941531377 2:166675423-166675445 CAGTTTGCACAGAGAAAAAGAGG + Intergenic
941544827 2:166835909-166835931 CAGTTGGCACAGGAAGAGAAAGG - Intergenic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
942322014 2:174744012-174744034 CACTTTGCATAGAAGGAGAATGG + Intergenic
943258611 2:185629494-185629516 CCTTTTGCACAGAGAGAGGAAGG + Intergenic
943420145 2:187659296-187659318 CAGTTTCCACAGGAAGAGAAGGG - Intergenic
943889606 2:193270322-193270344 TTGATTGCACAGAAAGAGAATGG - Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944619428 2:201498759-201498781 CTGTGTGCACAGAGAAAGAGAGG - Intronic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946297197 2:218794541-218794563 CAGTTTGCCCAGGGAGAGGGAGG + Intronic
946617777 2:221528042-221528064 CTGTGTGCACAGAGAAGGAAGGG - Intronic
947288881 2:228549481-228549503 CAGTATACCCAGAGAGAGAGAGG + Intergenic
948000024 2:234560158-234560180 CAGTTTGCAGAATGGGAGAAGGG + Intergenic
1169634804 20:7677571-7677593 CAGTTTTGACAGAGACAGAATGG + Intergenic
1169737111 20:8849024-8849046 CAGTTTGTCCTGGGAGAGAATGG + Intronic
1170222275 20:13953185-13953207 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1172179966 20:32996869-32996891 GAGTGTGCATGGAGAGAGAATGG - Intronic
1172408290 20:34704863-34704885 CAGGTTGCAAAGAGAAAGTAGGG - Intronic
1172763328 20:37336922-37336944 CAGTCTGGTCCGAGAGAGAAGGG - Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173326394 20:42037456-42037478 TAGTTTGCACAGAGCAGGAAAGG - Intergenic
1173581744 20:44151909-44151931 CAGGTGGAAAAGAGAGAGAAAGG - Intronic
1174850060 20:53985299-53985321 CAGTTTGCCCAGAGGCAGAGAGG + Exonic
1175434204 20:58931184-58931206 GAGGTGGCACAGAGAGAGGAGGG + Intergenic
1176998227 21:15580685-15580707 CAGGTTGCATAGAAAGAGAAAGG + Intergenic
1177225120 21:18244485-18244507 AATTTAGCACAGAAAGAGAAAGG + Intronic
1177533935 21:22399988-22400010 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1177543086 21:22520787-22520809 CAGCTTGCACAGAGAGAAGGAGG - Intergenic
1178619533 21:34161614-34161636 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1178699569 21:34821492-34821514 CGGTTTGCAGAGGGGGAGAAGGG + Intronic
1179011503 21:37559721-37559743 CTGTTTTCTCAGAGAGAGACTGG + Intergenic
1179159737 21:38884470-38884492 CAGATTCCACAGAGAGAGACTGG - Intergenic
1179270671 21:39848130-39848152 CAGTTTGCAAAGAGAGAGGGTGG + Intergenic
1179841940 21:44082212-44082234 CAGTTCGGTCAGAGAGAGAAGGG + Intronic
1181020414 22:20098747-20098769 CAGCATGCACACAGAGAGAAAGG - Intronic
1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG + Intergenic
1182163070 22:28143086-28143108 CAGTTTCCACAGAGAGGGAAAGG - Intronic
1182352379 22:29706061-29706083 CAGTTTGCTCAGCTAGAAAACGG + Intergenic
1183035470 22:35137908-35137930 CAGGTTGCACAGTGAGACAGAGG + Intergenic
1183113425 22:35669949-35669971 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
1184534657 22:45078137-45078159 CCATTGGCACAGAGAGAGGATGG + Intergenic
1184994831 22:48197840-48197862 AAATTGACACAGAGAGAGAAGGG - Intergenic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
950315833 3:12001535-12001557 GAATTTTCACAGAGAAAGAAAGG - Intergenic
951256180 3:20452437-20452459 CAGTTTTCACAGGGAGAGAGTGG + Intergenic
951345973 3:21547308-21547330 CAGTTTGCACAGGGAGAGGGAGG - Intronic
951417271 3:22440132-22440154 CAGCTGGGACAGAAAGAGAATGG + Intergenic
951821699 3:26821101-26821123 CAGTTTGCAGAGGAAGAGAGAGG - Intergenic
951841700 3:27041238-27041260 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
952225156 3:31367527-31367549 GAGTTTGGAGGGAGAGAGAAAGG - Intergenic
952404220 3:32991238-32991260 CAATTTGCAAAAAGAGACAAAGG + Intergenic
952590255 3:34944314-34944336 CAGATGGGACAGAGAGAGGAAGG - Intergenic
953135885 3:40181363-40181385 CACTTTGCACTGGGACAGAAGGG + Intronic
953677761 3:45016530-45016552 AAGTTTGCACAAAGGGATAAGGG + Intronic
954603427 3:51890628-51890650 CTGATTGCAAAGAGAGAGAGTGG - Intergenic
955666364 3:61353579-61353601 CAGAGGGCACAAAGAGAGAAAGG + Intergenic
956555422 3:70516658-70516680 CAGTTTCCACACAGATTGAAAGG - Intergenic
957153463 3:76516958-76516980 TATTTTGCACAGTGAAAGAATGG + Intronic
958744328 3:98114227-98114249 CAGTTTACACAGGGAGAGGGAGG - Intergenic
958824802 3:99017471-99017493 AAGCTTGGGCAGAGAGAGAAGGG - Intergenic
960285530 3:115824326-115824348 CAGTTTGCACCCATAGACAAGGG - Intronic
960514746 3:118590881-118590903 TGGTTTGCACAGAGGAAGAAAGG - Intergenic
961595745 3:128014784-128014806 CAGTTTTCACAGAGAGAGAAAGG - Intergenic
962033400 3:131625089-131625111 CAAGGTGCAAAGAGAGAGAAAGG - Intronic
962405694 3:135097959-135097981 AAGTTGGCACAGAGGGAGGATGG - Intronic
962619421 3:137162437-137162459 CACTTTCCAGAGAGAGACAAGGG - Intergenic
963251340 3:143105870-143105892 CAGTTTGCACAGGGAGAGAAAGG - Intergenic
963576166 3:147063069-147063091 CAGTCTGCACAGACAGAAAGAGG - Intergenic
963834796 3:150047467-150047489 CCATTTGCACGGAGAGAAAAGGG - Intronic
964304378 3:155325202-155325224 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
964700396 3:159559201-159559223 AACTCTGCACAGATAGAGAAAGG + Intronic
964744583 3:160000513-160000535 CAGTTTAGCAAGAGAGAGAAGGG - Intergenic
964855563 3:161141902-161141924 CAGTTTGCACAGAGAGAGAGAGG - Intronic
965354754 3:167659792-167659814 CAGTTTTCTCAGAGAGGCAATGG - Intergenic
965514944 3:169611185-169611207 CAGTTTCCCAAGAGACAGAATGG - Intronic
966044802 3:175534877-175534899 CAGTGTGAACAAAGAAAGAAAGG - Intronic
966523742 3:180899523-180899545 CAGTTTGCACAGGGAGAGGGAGG - Intronic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
966916440 3:184586858-184586880 CAGTTAGCAAGAAGAGAGAAGGG + Intronic
966962510 3:184954209-184954231 CAGTGTGCACTGAGAGAGCATGG - Intronic
967058403 3:185850194-185850216 AAGTGGGCACAGAGAGTGAAGGG + Intergenic
967529058 3:190528833-190528855 CAGGTTGGACAGAGAGAGATTGG + Intronic
967746284 3:193059575-193059597 CAGTTTAAAGACAGAGAGAAAGG - Intergenic
968381509 4:100689-100711 CAGTTTGCACAGGGAGACGGAGG - Intergenic
968665813 4:1821850-1821872 CAGCTTGCCCAGACAGTGAAGGG - Intronic
969127966 4:4968115-4968137 CAGTTTGCTCAGATAAGGAAAGG - Intergenic
969240854 4:5896352-5896374 CAGCTTGCACGGAGACAGAAAGG + Intergenic
969367191 4:6703364-6703386 CAGTTTGAGCAGGGAGAGATGGG - Intergenic
970520976 4:16883567-16883589 CAGTTTCCACACTGATAGAATGG - Intronic
972631801 4:40848552-40848574 CAATGGGGACAGAGAGAGAAAGG - Intronic
973626234 4:52775301-52775323 CAGCCTGCACAGAGCGAGACCGG + Intergenic
974189936 4:58491743-58491765 CAGTTTGCACAGAGAGAAACAGG + Intergenic
974225391 4:59036280-59036302 CAGTTAACACAGAAAGAAAAGGG - Intergenic
974649005 4:64730123-64730145 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
974963791 4:68735767-68735789 CACTTTGCACAGGGAGAGAAAGG + Intergenic
975019505 4:69468961-69468983 CAGTTTGCACAGAGAAAAAGAGG - Intergenic
975424377 4:74209137-74209159 CAGTTTGCACAGGGAGAGTGAGG + Intronic
975756643 4:77578128-77578150 CAGTTTGCACAGGGAGAGGGAGG - Intronic
975974138 4:80075660-80075682 CAGTTGGCAAAGAGTGAGAAGGG - Intronic
978065649 4:104396894-104396916 CACTTTGTATATAGAGAGAAAGG + Intergenic
978416151 4:108478340-108478362 CATTTTGGACAAAGAGAGAGAGG + Intergenic
978951015 4:114559516-114559538 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
979104630 4:116668151-116668173 CGGTTTGCACAGGGAGAGGGAGG - Intergenic
979507425 4:121514302-121514324 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
981144961 4:141313263-141313285 GAGTGAGCACAGATAGAGAAAGG - Intergenic
981255968 4:142660661-142660683 CAGTTTGCATGGAGAGAGGGAGG - Intronic
981324176 4:143427497-143427519 CGGTTTGCACAGGGAGAGGGAGG + Intronic
981567222 4:146114069-146114091 TAGCTTGCCCAGAGGGAGAAGGG + Intergenic
982399623 4:154952738-154952760 CAGTTTGCACAGGGAGAGAGAGG + Intergenic
982477620 4:155872637-155872659 CAGTTTGCACAGGGAGAGGGAGG + Intronic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
982670510 4:158314449-158314471 CAGTTCTCACAGAGAAAGATGGG - Intergenic
983280535 4:165675798-165675820 GAGTTTGTACAGACATAGAAAGG + Intergenic
983409520 4:167379239-167379261 CAGTTAGCTCAGAGATAGATTGG + Intergenic
983929519 4:173437874-173437896 CAAGATGCACAAAGAGAGAACGG + Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
985465039 4:190186489-190186511 CAGATTGCAAAAAGAGAGAGAGG - Intergenic
986073650 5:4312465-4312487 CTGTTTGCACAGTGAAAGGAAGG - Intergenic
986172831 5:5327579-5327601 CAGTTTCCCAAGAGAGAGCAGGG - Intergenic
986213778 5:5699035-5699057 CAGTCTGCACAGGGAGGGAGAGG - Intergenic
986601118 5:9474188-9474210 CAGATTGATCAGTGAGAGAAAGG + Intronic
986796635 5:11219028-11219050 GAGGCTGCTCAGAGAGAGAAAGG - Intronic
987842109 5:23235079-23235101 CAGTTTGCACAGAGAGCAAGAGG + Intergenic
988157803 5:27477225-27477247 CAGTTTGCACAGGGAGAGAGAGG - Intergenic
988568597 5:32341951-32341973 CAGTTTGTACAGGGAGAGAGAGG + Intergenic
988899602 5:35718124-35718146 CAGTTTGCACAGGGAGAGGTAGG + Intronic
989213435 5:38880067-38880089 CAGTCTGCAGAGAGTGAGAAAGG + Intronic
989715172 5:44454410-44454432 CAGTTTTAACAGAGAGAGGGAGG + Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
990012220 5:51013179-51013201 CAGGTTTGACAGAGAGAAAAAGG + Intergenic
990336169 5:54774860-54774882 CAGTTTGCACAGCGGCAAAAGGG + Intergenic
990762486 5:59145366-59145388 AATTTTGCATACAGAGAGAAGGG + Intronic
991009736 5:61870426-61870448 AAGTTTCCAAAAAGAGAGAAGGG - Intergenic
991062392 5:62391613-62391635 TAATTAGAACAGAGAGAGAAAGG - Intronic
991975539 5:72180636-72180658 CAGTTTGAGCAGACAAAGAACGG - Intronic
993257551 5:85612149-85612171 AAGTTGGGACAGAGAGAGAGAGG + Intergenic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG + Intergenic
994401970 5:99291709-99291731 CATTTTGCAGATAAAGAGAAAGG - Intergenic
994505821 5:100641834-100641856 CAGTTTGCACAGGGAGAGGCAGG - Intergenic
994562557 5:101394858-101394880 AGGTTTGCACAGAGAGGGAGAGG - Intergenic
995393468 5:111663673-111663695 CAGTTTGCTCAGGGAGAGGAAGG + Intronic
995581581 5:113607951-113607973 CAGTTTGCCCAGAGACAGAGAGG - Intergenic
995848267 5:116517834-116517856 CATTTTCTACAGAGAGAGGAAGG - Intronic
996084325 5:119288826-119288848 TAGTCTCCAAAGAGAGAGAAGGG + Intronic
996575428 5:124972679-124972701 CAGTTTGCACAGGGAGAGACAGG - Intergenic
997166162 5:131661808-131661830 TAATTTGCACAGAGAGAGAGAGG - Intronic
998869735 5:146540315-146540337 CAGGTTGCACAGGCAGAAAATGG + Intergenic
999004898 5:147964695-147964717 AAGTGTGCACAGAGTAAGAAAGG - Intergenic
999230878 5:150061138-150061160 CAGATGGCAGAGAGAGAGAGAGG + Intronic
999359628 5:150972117-150972139 AGGTTTGCCCAGAGAGAGAGAGG + Intergenic
999362129 5:150994225-150994247 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
999376703 5:151091706-151091728 CTAGTTGCAGAGAGAGAGAAAGG - Intronic
999790185 5:154932454-154932476 GAGTTTGATCATAGAGAGAAGGG - Intronic
1000278148 5:159757730-159757752 CAGTTTTCCTAGAGTGAGAAGGG - Intergenic
1000415679 5:160981135-160981157 CAGTTTGCACGCAGAGAGAAAGG - Intergenic
1000741265 5:164973219-164973241 CAGTTTGCACAGGAAGAGGGAGG + Intergenic
1001215481 5:169852064-169852086 CTGTCAGCACAGAGAGAGAGAGG + Intronic
1002855944 6:1038381-1038403 TGGTTTGCACACAGAGAGACTGG - Intergenic
1003724365 6:8743507-8743529 CAGTTCACACAGAGACAGCAAGG - Intergenic
1003905736 6:10698054-10698076 AAGTTTGCAAGGAGGGAGAAAGG + Intronic
1004765513 6:18722122-18722144 CATTTTGCACAGAAAGAGAGAGG - Intergenic
1005076989 6:21918445-21918467 CAGGTTGCAAGGAGAGAGGACGG + Intergenic
1005448794 6:25953305-25953327 CAGTTTTCACTAAGAGAGAGAGG + Intergenic
1006196736 6:32247654-32247676 TCATTTGCACAGAGAGAGAAAGG - Intergenic
1006252957 6:32806074-32806096 CAGTTGGCAGCTAGAGAGAAAGG - Intergenic
1007353219 6:41290886-41290908 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1008157941 6:48040055-48040077 CACTTTGAACAGCAAGAGAATGG + Intronic
1009632260 6:66214372-66214394 CAGTTTGCACAGGGAAAGGGAGG - Intergenic
1009907544 6:69888277-69888299 CAGTTTGCACAGGGAGACGGAGG + Intronic
1009907852 6:69891164-69891186 CAGTTTGCACAGGGAGAGGGAGG + Intronic
1010703906 6:79084756-79084778 CAGCTGACACACAGAGAGAAAGG - Intergenic
1010872373 6:81058944-81058966 CCGTTTGCACGGGGAGAGGAAGG + Intergenic
1011512006 6:88111807-88111829 CATTTTGGAAAGATAGAGAAGGG - Intergenic
1012239176 6:96852629-96852651 CAGTATTGCCAGAGAGAGAATGG - Intergenic
1012583842 6:100899004-100899026 CAATTTGCACAGGGAGAGGGAGG - Intergenic
1012595373 6:101032272-101032294 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1012804716 6:103879295-103879317 CAGTTTGCACAGGGAGAAGGAGG - Intergenic
1014111603 6:117623839-117623861 CAGTTTGCACAGAGAAAAAGAGG - Intergenic
1014163227 6:118194731-118194753 CGGTTTGCACAGAGAGAGAGGGG + Intronic
1014738306 6:125120757-125120779 CAGTTTGCATAGAGAGAAAGAGG - Intronic
1015085190 6:129282395-129282417 CAGTTCCCACATATAGAGAAAGG - Intronic
1015813482 6:137184863-137184885 CAGTTTACACAGGGAGAGAGAGG + Intergenic
1015859054 6:137656486-137656508 CAGTTTGCACAGGGAGCGGGAGG - Intergenic
1015950495 6:138547943-138547965 CAAATTGTACAGAGAGAGAAAGG + Intronic
1016108459 6:140191313-140191335 TGTTTTGCACAGAGAGAGAAAGG + Intergenic
1016162001 6:140893996-140894018 CAGTTTACACAGGGAGAGAGAGG + Intergenic
1016206169 6:141471346-141471368 AGGTTTGCACAGGGAGAGAGAGG + Intergenic
1016233434 6:141833020-141833042 CAGTTTGCACAGGGAGAGACAGG - Intergenic
1016279466 6:142398635-142398657 CAGTGTGCAAAGATATAGAAAGG - Intronic
1016283662 6:142448559-142448581 CAGTTGGCACGGAGTTAGAAGGG + Intergenic
1016708121 6:147137687-147137709 CTGTTTGAACAGAGAGTAAATGG + Intergenic
1017113920 6:150959301-150959323 AAGCTTACGCAGAGAGAGAATGG - Intronic
1017343885 6:153357228-153357250 CAGTTTGCACAGGGAAAGGGAGG - Intergenic
1017559696 6:155614292-155614314 CAGTTTGCAGAGGGAAAGAGAGG + Intergenic
1020257336 7:6509424-6509446 CACTGTGCCCAGAGAGGGAAAGG - Intronic
1020555427 7:9664201-9664223 CAGTTTCCACAGGGAGAGGGAGG + Intergenic
1020646880 7:10825299-10825321 TAGTTTGTACAGAGAGAGCAAGG - Intergenic
1021084662 7:16408316-16408338 GAGTTTGCACTGAGACACAAGGG + Intronic
1021891653 7:25192168-25192190 CAGTTTGTACAGAGAGAAAGAGG + Intergenic
1022315489 7:29241377-29241399 CAGTTTCCACATAGAAAGAGTGG + Intronic
1022322160 7:29297622-29297644 TAGTTTGCACAGAGAGAGGGCGG + Intronic
1022678974 7:32526495-32526517 CAGTTTGCACAGGGACAGAGGGG + Intronic
1023709224 7:42974248-42974270 CAGTTTGCACTGTGTGAGGATGG + Intergenic
1024146709 7:46524002-46524024 CAGTTTGCACAGAAAGACAGAGG - Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024328839 7:48136226-48136248 CAGTTTACACAGACAGAAAGAGG + Intergenic
1024438050 7:49382005-49382027 CAGTTTGCACAGGGAGAGAGAGG - Intergenic
1024599543 7:50968099-50968121 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
1026034792 7:66823231-66823253 CAGTTTGCCCAGATGCAGAATGG - Intergenic
1027707490 7:81552538-81552560 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1028438992 7:90837539-90837561 CAGATTACACAGAAAGAGATGGG + Intronic
1030245854 7:107383995-107384017 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1031268908 7:119619816-119619838 TAGTTTTCACAGAGGGAAAAGGG - Intergenic
1032251465 7:130261532-130261554 CAGTTTGCACAAGGAGAGGCAGG - Intergenic
1032346646 7:131122628-131122650 CAGTTTCCCATGAGAGAGAAAGG + Intronic
1032347309 7:131128161-131128183 CAGCTTGAACATAAAGAGAAGGG + Intronic
1032565909 7:132942961-132942983 CTGGTTGCAAACAGAGAGAAAGG + Intronic
1032847697 7:135765927-135765949 CATATTGGACAGAGGGAGAAAGG + Intergenic
1033677516 7:143557540-143557562 GATTTTACACTGAGAGAGAAGGG + Intergenic
1033694318 7:143771900-143771922 GATTTTACACTGAGAGAGAAGGG - Intergenic
1033850206 7:145485813-145485835 TGGTTTGCACAGAGAGAAAGAGG + Intergenic
1033866138 7:145692373-145692395 CAGTTTACACAGGGAGAGGGAGG - Intergenic
1033904875 7:146190821-146190843 CTGTTTAGAAAGAGAGAGAAGGG - Intronic
1034971431 7:155422187-155422209 CAGACAGCACAGGGAGAGAAGGG + Intergenic
1035843580 8:2839249-2839271 GAGCTTGTCCAGAGAGAGAACGG - Intergenic
1035981018 8:4372089-4372111 GACTTTGCACTGAGATAGAAAGG - Intronic
1036190199 8:6663116-6663138 CAGTGCTCACAGAGAGGGAAAGG + Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037188788 8:16097451-16097473 TTGTTTGCAGAGAGAGGGAATGG - Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037809180 8:22076277-22076299 AAGATTGTACAGAGAGAGGAGGG + Intronic
1038217658 8:25577512-25577534 AAGTGGGCACAGAGCGAGAAGGG - Intergenic
1038814600 8:30888485-30888507 GAGTTTGGGGAGAGAGAGAAAGG - Intronic
1039519216 8:38156267-38156289 CACTTTTCACAGAGAGAGACAGG - Intergenic
1039669687 8:39581985-39582007 CAGCTTGGACACAGAAAGAAGGG - Intergenic
1040418934 8:47221216-47221238 CAGTTTGCACAATGAGACCAAGG + Intergenic
1040758441 8:50808811-50808833 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1040990802 8:53347532-53347554 CAGTTTTCACAGTGAGAGGGAGG - Intergenic
1043412754 8:80015674-80015696 CAGTTTGAAGAGACAGAGCAAGG + Intronic
1043784152 8:84375925-84375947 CAGTTTGCAAGGAAAGAAAATGG - Intronic
1043978776 8:86614442-86614464 CAGTGGGGAGAGAGAGAGAATGG - Intronic
1044016785 8:87055438-87055460 GAGCTTGCACAGGGAGGGAAGGG - Intronic
1044223171 8:89693462-89693484 CAGCTTTCATAGAGAAAGAAAGG - Intergenic
1044422926 8:92019387-92019409 GTGGTTGCACAGACAGAGAAAGG + Intronic
1045803418 8:106128096-106128118 CAGTTTGCACAGATGGTTAAGGG - Intergenic
1045864826 8:106852892-106852914 AAGATTGGAGAGAGAGAGAAAGG + Intergenic
1047859573 8:128950139-128950161 CATTTTGCACAGAGAGATTAAGG + Intergenic
1048021432 8:130542843-130542865 CAGTTTGCACACAGCCAGAAAGG - Intergenic
1048359519 8:133685721-133685743 CAGTTTGCTCATAGAAACAATGG + Intergenic
1048525270 8:135196669-135196691 AAATTTGCACAGATAGAAAAAGG - Intergenic
1049084271 8:140465627-140465649 TAATTGGCACAGAGAGAGAGAGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050176077 9:2870644-2870666 CATTTGGCAAAGAGATAGAAGGG - Intergenic
1050319717 9:4439106-4439128 CATGCAGCACAGAGAGAGAAAGG - Intergenic
1052114462 9:24633114-24633136 CAATTTTCACAGAAATAGAAAGG - Intergenic
1052123163 9:24742677-24742699 AAGCTTGATCAGAGAGAGAAAGG - Intergenic
1052689085 9:31792327-31792349 CAGATTTCACAGAGAGAAAATGG - Intergenic
1053528344 9:38852423-38852445 CAGCTTGCACTGAGAGAGCATGG + Intergenic
1054200568 9:62076859-62076881 CAGCTTGCACTGAGAGAGCATGG + Intergenic
1054637787 9:67511501-67511523 CAGCTTGCACTGAGAGAGCATGG - Intergenic
1055471582 9:76617251-76617273 CATTTTCCTCAGAGACAGAAGGG - Intronic
1055798100 9:79998266-79998288 CAGCTTGTACACAGAGAAAATGG + Intergenic
1056677585 9:88688175-88688197 CAGTTTGCACAGAAAGAGAGAGG - Intergenic
1056936868 9:90921651-90921673 AAGTTTCCAGAGAGAAAGAAGGG - Intergenic
1058197371 9:101994793-101994815 GAGTATGCAGATAGAGAGAAAGG - Intergenic
1058281982 9:103127408-103127430 TAGTTTGCACAGGGAGAGGGGGG + Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059471715 9:114510021-114510043 CACTGGGCACAGAGAGATAAAGG - Intergenic
1060151496 9:121291789-121291811 CAGTGTCCACAGGGATAGAATGG - Intronic
1060164001 9:121393681-121393703 GAGTTTGGACTGAGAGAAAATGG + Intergenic
1060176719 9:121502587-121502609 CAGTTTGCAGAGAGAGAGAGAGG - Intergenic
1060188430 9:121577682-121577704 CATTTGTCACAGAGAGAGCATGG - Intronic
1060760234 9:126240890-126240912 GAGTTTCCACTGAGAGAGAGGGG - Intergenic
1061144795 9:128791361-128791383 GAATCTGCACAGAGGGAGAAGGG - Exonic
1061561350 9:131405935-131405957 CATTTTGCAGAGGAAGAGAATGG - Intronic
1061666337 9:132162737-132162759 CAGTTTGCAGAGAGATGGGAGGG - Intronic
1061832743 9:133305991-133306013 AACTTTTCACAGAGAGAGAGAGG + Intergenic
1061832754 9:133306076-133306098 AACTTTTCACAGAGAGAGAGAGG + Intergenic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1185582005 X:1216978-1217000 AAGTCTGCAGAGAGAGAGAAAGG + Intergenic
1186210755 X:7248151-7248173 CAGTTTGCAAAGACAGACAAAGG - Intronic
1186258873 X:7754416-7754438 AAGTTTGTACAGAGAGATAATGG + Intergenic
1186541689 X:10407757-10407779 CTGTTTATTCAGAGAGAGAACGG - Intergenic
1187936923 X:24345301-24345323 CAGTTTGCACAGAGAGCAAGAGG + Intergenic
1187940178 X:24373554-24373576 AAGTCTACTCAGAGAGAGAAGGG + Intergenic
1188212358 X:27441362-27441384 CAGTTTGTACAGAGAGAGAGAGG + Intergenic
1188692266 X:33144700-33144722 GAGTTTTCACAGAGAGCAAAAGG + Intronic
1188802592 X:34550141-34550163 CAGTTTGCACAGAGACAGAGAGG - Intergenic
1189153422 X:38730453-38730475 CAGTTTACACAGAGAGAGGCAGG - Intergenic
1189401114 X:40669572-40669594 CAGATTTCACAGAGAAAGGAGGG - Intronic
1190429822 X:50368315-50368337 GGGTTTGCAGAGAGAGAGAGAGG + Exonic
1190491148 X:50983659-50983681 CAGTTTGCACATGGAAAGGAGGG - Intergenic
1190495405 X:51024001-51024023 CAGATTCCACAGAGAGACAGAGG + Intergenic
1191189918 X:57655787-57655809 TGGTTTGCACAGAGAGAGGGAGG - Intergenic
1192864662 X:75117905-75117927 CAGTTCACACAGAGAGAGAAAGG - Intronic
1193269767 X:79515500-79515522 CGGTTTTCACAGAGAGAGGGAGG - Intergenic
1193363809 X:80606897-80606919 CAGTTTGCAAAGAGAAAGAGAGG - Intergenic
1193481760 X:82035905-82035927 CAGTTTGCACAGAGAGAGACAGG - Intergenic
1193508099 X:82367688-82367710 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1193699868 X:84747536-84747558 CAGTTTGCACGGGGAGAGAAAGG - Intergenic
1193945036 X:87724313-87724335 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194051890 X:89079501-89079523 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1194059655 X:89181480-89181502 TGGTTTGCACAGGGAGAGAGAGG + Intergenic
1194066326 X:89266724-89266746 CAGTTTGTACAGGGAGAGGGAGG + Intergenic
1194131168 X:90084094-90084116 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194214241 X:91109032-91109054 GAGTTTGCACAGAGATGGAGAGG - Intergenic
1194331730 X:92591320-92591342 TGGTTTGCACAAAGAGAGAGAGG - Intronic
1194912860 X:99668395-99668417 CATTTTACAGAGAGAGAGAGAGG - Intergenic
1195048818 X:101078914-101078936 CAGTTAGCACAGGGAGAGCTGGG - Exonic
1195235596 X:102894396-102894418 CAGTTCGCAGATAGAGAGTAAGG - Intergenic
1195386152 X:104315039-104315061 CTGTATTCACACAGAGAGAAGGG - Intergenic
1196520247 X:116663562-116663584 CAGTTTGCACAGGAAGAGGGAGG + Intergenic
1196542740 X:116928642-116928664 TAGTTTGCACAGAAAGAAAGAGG + Intergenic
1196973623 X:121135976-121135998 CAGTTTGCACAGAGTTAAAGAGG + Intergenic
1197038715 X:121908545-121908567 CAGTTTGTACAGGGAGAGGGGGG - Intergenic
1197062351 X:122196142-122196164 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197064521 X:122221974-122221996 CAGTTTGCAGAGGGAGAGAGAGG - Intergenic
1197243238 X:124142433-124142455 CAGTTTGCACAGAGAGAAAGAGG + Intronic
1197509268 X:127350698-127350720 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197515962 X:127429307-127429329 CATTTTGCAAATAGAGAAAAGGG + Intergenic
1197934193 X:131723899-131723921 GAGTTTGCACACAGAGATAGAGG - Intergenic
1198333180 X:135641206-135641228 CAATGTCCACAAAGAGAGAATGG - Intergenic
1200125257 X:153810445-153810467 CAGTCAGCACAGAGAGGGCAGGG + Intronic
1200438850 Y:3187775-3187797 CAGTTTGCACAGAGAAAGAGAGG + Intergenic
1200516363 Y:4148710-4148732 TCATTTGCACAGAGAGAGAGTGG + Intergenic
1200640436 Y:5710379-5710401 TGGTTTGCACAAAGAGAGAGAGG - Intronic
1200720496 Y:6600843-6600865 CAGTTTGTACAGGGAGAGGGAGG + Intergenic
1200734431 Y:6779045-6779067 CAGTTTGCACAGACAGAAAGAGG + Intergenic
1200877991 Y:8179915-8179937 CACTTCCCAGAGAGAGAGAATGG + Intergenic
1201321013 Y:12698730-12698752 CAGTTTACACAGGGAGAGCGAGG + Intergenic
1202237226 Y:22725349-22725371 CACTTTCCAGAGAGGGAGAATGG - Intergenic
1202585555 Y:26421933-26421955 CAGTTTGAACAGAAACAAAATGG + Intergenic