ID: 966730211

View in Genome Browser
Species Human (GRCh38)
Location 3:183144654-183144676
Sequence GCCCAGCTCGTAGGCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966730211 Original CRISPR GCCCAGCTCGTAGGCCAAGA GGG Intronic
900184642 1:1327360-1327382 GCTCAGCTCGTGGGCCACCATGG - Exonic
901642285 1:10698854-10698876 GCCCAATTCATGGGCCAAGAAGG - Intronic
903786251 1:25863189-25863211 GTCCAGTGCGTAGGCCAGGACGG + Exonic
906203548 1:43975081-43975103 GGCCAGCGCGCAGGCCCAGAAGG - Exonic
919650893 1:200148007-200148029 GCCCAGTTCGAAGGCCACGTTGG + Intronic
919844169 1:201630519-201630541 TCCCAGCTCCCAGGCCAAGAAGG - Intronic
924706949 1:246509643-246509665 GCACAATTCGCAGGCCAAGAGGG - Intergenic
1074274409 10:111987798-111987820 GCCCAGAGGGCAGGCCAAGATGG + Intergenic
1074726728 10:116318484-116318506 GCCCAGCACGGGGGCCAGGAAGG - Intergenic
1076062152 10:127421164-127421186 TCCCAGCACTTAGGCCAAGGTGG - Intronic
1078259363 11:9690328-9690350 TCCCAGCACGCAGGCCAAGGTGG + Intronic
1079336938 11:19578196-19578218 GCCCAGCTCGCAGGCAGAGCCGG - Intronic
1082225911 11:49706416-49706438 GCCCTGCTCTGAGCCCAAGAAGG - Intergenic
1083630373 11:64092106-64092128 GCCAAGCTTGGAGGCCAGGAAGG - Intronic
1085546238 11:77320806-77320828 GGCCAGCTCCTGTGCCAAGAGGG + Intergenic
1086623190 11:88913323-88913345 GCCCTGCTCTGAGCCCAAGAAGG + Intronic
1088814341 11:113410995-113411017 CCCTGGCTCGTATGCCAAGACGG + Intronic
1090547838 11:127784780-127784802 GCCCAGCACAGAGTCCAAGAAGG - Intergenic
1092086602 12:5768039-5768061 GCCCAGATAGTAGGTCAGGAAGG - Intronic
1092202458 12:6594510-6594532 GCCCATCTCATCAGCCAAGATGG + Exonic
1102438945 12:112946804-112946826 GCCCTGCTCCCAGGCGAAGATGG - Exonic
1102440786 12:112962725-112962747 GCCCTGCTCCCAGGCAAAGATGG - Exonic
1102515186 12:113441596-113441618 CCCCAGCTGAGAGGCCAAGAAGG - Intergenic
1105805509 13:23949784-23949806 GCCCAGATCCTATGCCAACAAGG + Intergenic
1111561113 13:89948181-89948203 GAGCAGCTTGTAGGCCAAAAAGG + Intergenic
1118671111 14:68128441-68128463 TCCCAGCACTTAGGCCAAGGTGG + Intronic
1129852308 15:78800459-78800481 CCACAGCTCGTAGGACAGGAAGG + Exonic
1132145556 15:99427179-99427201 GCCCAGCTGGCAGGTGAAGAGGG + Intergenic
1132882851 16:2170109-2170131 GCCCAGCTGGGAGGCTCAGAGGG - Intronic
1134541884 16:15073867-15073889 TCCCAGCACTTAGGCCAAGGTGG - Intronic
1141633762 16:85303142-85303164 GCCCAGCCCGGAGGCCTAGTGGG + Intergenic
1144087051 17:11819575-11819597 GCCCAGCTAATTGGCCAAGCAGG + Intronic
1147618073 17:41842688-41842710 TCCCAGCACTTTGGCCAAGATGG + Intronic
1148081738 17:44970653-44970675 CCCCAGCTCACAGGCCAAGATGG - Intergenic
1148645267 17:49216589-49216611 GCCCACCTGGTAGGCCACGCTGG - Exonic
1148688772 17:49514851-49514873 CCCCAGCTCGGGGGCCAAAAGGG - Exonic
1150979587 17:70126376-70126398 ACCCAGCTCCTACTCCAAGATGG + Intronic
1151537890 17:74748975-74748997 GCCCGGCTCGCCGGCCGAGAAGG + Exonic
1152339633 17:79716871-79716893 CCCCAGCTCATAGGCACAGAAGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1155928795 18:31685037-31685059 GCCCAGCTCCTCGGCCCCGAGGG - Intronic
1158271966 18:55726170-55726192 GCAGAGTTCGTATGCCAAGATGG + Intergenic
1158930524 18:62320922-62320944 CCCCAGCACGGAGGCCAAGGTGG - Intergenic
1162032575 19:7923819-7923841 GCCCAGCTAGTAATCCAAGTCGG + Intergenic
1167267200 19:48489323-48489345 TCCCAGCTGGGAGGCCAAGGCGG + Intronic
1167990339 19:53355459-53355481 GCCCAGATGGTGGGCCAACATGG + Intergenic
927652848 2:24922734-24922756 GCCCAGCTCCTAAGCTGAGAGGG + Intergenic
927934990 2:27071418-27071440 GCCCAGCATGTTGGCGAAGATGG + Exonic
929758188 2:44785334-44785356 GCCCATCTCGGGGGCCAAGAAGG - Intergenic
932571739 2:72941877-72941899 GGCCAGCTGGGAGGCCCAGAGGG - Intergenic
934109235 2:88726284-88726306 GTCCAACTCGTGGCCCAAGATGG + Intronic
935707741 2:105871171-105871193 GCCCAGATCTGAGGCCACGATGG + Intronic
936032901 2:109086519-109086541 GCCCAGCTCGGTTGCCATGAGGG - Intergenic
943340640 2:186676548-186676570 GCCCAGTATGTAGGCCAAGCTGG - Intronic
948115572 2:235492967-235492989 GCCCAGCCAGTAAGCCAACACGG + Intergenic
1169073819 20:2749775-2749797 GCCCAGCCCCTAGGCCCAGAGGG - Intronic
1174594198 20:51670378-51670400 GCCCATTCCGTTGGCCAAGAGGG + Intronic
1181321009 22:22006130-22006152 GCCTAGCTGGTTTGCCAAGAGGG - Intergenic
1183995123 22:41627306-41627328 TCCCAGCTCTTAGGCCAGGGCGG + Intronic
949559424 3:5188098-5188120 GCCCAGCACGTAGCCCCAGTTGG - Exonic
949981681 3:9506016-9506038 GCCCAGCACGAAGGCGAGGAAGG + Exonic
953609000 3:44432010-44432032 TCCCAGCTGGGAGGCTAAGATGG - Intergenic
960964731 3:123096828-123096850 GCCCAGCTGGCAGGGCACGAGGG - Intronic
961806138 3:129490700-129490722 GCCCAGCACAGTGGCCAAGAGGG - Intronic
966332310 3:178827735-178827757 GCCCAGTTTGTAGGCACAGAAGG - Intronic
966730211 3:183144654-183144676 GCCCAGCTCGTAGGCCAAGAGGG + Intronic
967976678 3:195039326-195039348 GCCCAGCTCACAGGGCAGGAAGG - Intergenic
969072318 4:4549384-4549406 GCCCAGCCAGCAGGCAAAGATGG + Intergenic
969439360 4:7208212-7208234 CCCCAGCTCAGAAGCCAAGATGG - Intronic
985706241 5:1403006-1403028 GCCCAGCGCGTTGGCCCAGTCGG + Exonic
1000043911 5:157505755-157505777 GCCCATCTCGTGGGCCATGGTGG + Exonic
1002575884 5:180173387-180173409 GCCCAGGGTGTAGGCCATGAAGG + Intronic
1002721318 5:181262746-181262768 CCCCAGCACCAAGGCCAAGAGGG - Intergenic
1005909533 6:30296211-30296233 GCCCTGCTAGTGGGCAAAGAGGG + Intergenic
1005915416 6:30346536-30346558 GCCCAGCTCGGGAGCCAAGCAGG + Exonic
1006683637 6:35814711-35814733 GCCCAACACGAAGGCCAGGAAGG - Exonic
1008405763 6:51117103-51117125 GGCCTGCTTGCAGGCCAAGAGGG - Intergenic
1010584553 6:77642178-77642200 GCCTAGATCGTAGGCCAAAGGGG - Intergenic
1013772791 6:113646183-113646205 GCCCAGAGAGTAGGCCAAGGGGG - Intergenic
1024486566 7:49926576-49926598 GCCCACCCCGTGGGCAAAGAGGG - Intronic
1029440453 7:100584290-100584312 GCCCAGGTTCTAGGCCAAGTGGG - Intronic
1030313635 7:108092546-108092568 GCCAAGCGCATAGGCCAGGAAGG - Intronic
1031401504 7:121329791-121329813 GCTCAGCTCGTAGCCAAAGAGGG - Exonic
1035556989 8:574688-574710 GCCCAGCTGTAAGGCCAGGAGGG - Intergenic
1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG + Intergenic
1040105131 8:43537400-43537422 GCACAGCTCGCAGCCCAGGAGGG + Intergenic
1044655647 8:94545693-94545715 GCCCAGGTTGTAGGCAAACAAGG + Intronic
1044669848 8:94668108-94668130 ACCCAGATGGTAGGCCAACAGGG + Exonic
1049176679 8:141197092-141197114 GCCCAGCACACAGGCCAGGATGG - Intergenic
1061326585 9:129868220-129868242 GGGCAGCTCGCAGGCCGAGACGG + Exonic
1061899482 9:133665717-133665739 GCCCAGCTCGCAGGCCCAATGGG - Intronic
1186632523 X:11365271-11365293 ACCCAGATCGTAGGCCATGCTGG + Intronic
1187924839 X:24240075-24240097 TCCCAGCACTTAGGCCAAGGCGG - Intergenic
1189580864 X:42404807-42404829 GCCCATCTCGAAGCCCATGAAGG - Intergenic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1200119818 X:153784926-153784948 GGCCAGCTCGAAGGCCTGGAAGG - Exonic
1201767832 Y:17589198-17589220 GCCTAGCAGGTAGGCCATGAGGG + Intergenic
1201833721 Y:18316787-18316809 GCCTAGCAGGTAGGCCATGAGGG - Intergenic
1202181357 Y:22142565-22142587 TCCCAGCTGCTTGGCCAAGAAGG - Intergenic
1202210003 Y:22443835-22443857 TCCCAGCTGCTTGGCCAAGAAGG + Intergenic