ID: 966730421

View in Genome Browser
Species Human (GRCh38)
Location 3:183146437-183146459
Sequence CCATTAGGGCAGAAGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966730415_966730421 2 Left 966730415 3:183146412-183146434 CCTAAATACACTTCATACAATAC 0: 1
1: 0
2: 2
3: 11
4: 201
Right 966730421 3:183146437-183146459 CCATTAGGGCAGAAGTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966730421 Original CRISPR CCATTAGGGCAGAAGTCACA GGG Intronic
902085477 1:13856900-13856922 CAATTATGGCAGAAGGCAAAAGG - Intergenic
902091943 1:13910576-13910598 CAATTGGGGCAGAAGGCAAATGG - Intergenic
906958385 1:50396975-50396997 CCATTAGGGCAGAGTCCTCATGG + Intergenic
907843209 1:58176646-58176668 CAATGAGGGCAGAACTCTCATGG + Intronic
909496567 1:76285649-76285671 TCATGAGGGCAGAAGTGACTAGG + Intronic
912073298 1:105840419-105840441 CCATTATGGCAGAAGGCGAAGGG - Intergenic
912705327 1:111907370-111907392 CTATTATGGCAGAAATGACATGG + Intronic
914934388 1:151965400-151965422 CAATTATGGCAGAAGGCAAAAGG - Intergenic
915124339 1:153652956-153652978 TCACTTGGGCACAAGTCACAGGG - Intergenic
915885547 1:159717368-159717390 CAATTATGGCAGAAGGCAAAGGG - Intergenic
916352402 1:163866002-163866024 CCATTGGGGGAAAAGGCACATGG + Intergenic
916637999 1:166694800-166694822 CCATGAAGGCAGAAGTCAGATGG - Intergenic
917235751 1:172889834-172889856 CAATCATGGCAGAAGGCACAAGG + Intergenic
920070738 1:203301291-203301313 CCAATAGGTCTGAGGTCACATGG + Intergenic
922048038 1:221965960-221965982 CCATCTGGGCACAAGTCACAGGG - Intergenic
922097759 1:222457103-222457125 CAATTATGGCAGAAGGCAAATGG - Intergenic
922111381 1:222560016-222560038 CCATGAGAGCTGAAGTCACAGGG + Intronic
923089138 1:230725837-230725859 CCAGTAGGACAGTAGTCACTGGG + Intergenic
923170399 1:231411297-231411319 CAATTATGGCAGAAGGCAAAAGG - Intronic
923467254 1:234260437-234260459 GAATTAAGGCAGAAGTCACCTGG + Intronic
923884060 1:238135660-238135682 CAATTATGGCAGAAGGCAAAAGG - Intergenic
924767417 1:247046811-247046833 CTAGTATGTCAGAAGTCACATGG + Intronic
1063327724 10:5121781-5121803 CCATTAGACTAGAAGGCACAGGG - Intronic
1064193304 10:13225929-13225951 CCATCAAGGCAGGGGTCACAAGG - Intronic
1068051804 10:51959630-51959652 GAATTAGGGCAGGAGTCATAGGG + Intronic
1068327734 10:55516314-55516336 CCATCATGGCAGAAGGCAAAAGG - Intronic
1070315130 10:75303053-75303075 CCATTATGTGAGAAGTCAGAAGG + Intergenic
1071299116 10:84243317-84243339 TCATTTGGGCAAAAGACACAAGG - Intergenic
1074079715 10:110157859-110157881 TCATTAGGGCATAAGCCTCATGG - Intergenic
1075579930 10:123609721-123609743 CCATCACAGCTGAAGTCACAGGG - Intergenic
1075971659 10:126659494-126659516 CCAATAGGGCCGAAGACAAATGG - Intronic
1076471205 10:130719552-130719574 CCATCATGGCAGAAGGCAGAAGG - Intergenic
1076794719 10:132793012-132793034 GCGTCAGGGCCGAAGTCACATGG - Intergenic
1079744301 11:24105997-24106019 CAATCATGGCAGAAGTCAAAGGG - Intergenic
1079750666 11:24192162-24192184 CAATTACGGCAGAAGGCAAAGGG + Intergenic
1079751473 11:24204161-24204183 CCATTCGGGCATAAGTGAGATGG + Intergenic
1082244317 11:49904394-49904416 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1085134953 11:74078287-74078309 CCAAAAGAGCAGAAGTCACCAGG - Exonic
1086623274 11:88913924-88913946 CCACTAGGGCTGAAGGAACAAGG - Intronic
1086823043 11:91459494-91459516 CAATTATGGCAGAAGGCAAAAGG + Intergenic
1087562466 11:99807955-99807977 CCCTTAGGGAATAAGTTACAGGG - Intronic
1088375215 11:109133435-109133457 CCATTAAGGCAGAACCCTCACGG - Intergenic
1088406920 11:109491706-109491728 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1088413378 11:109562059-109562081 CCATTATTGCAGGAGTAACATGG + Intergenic
1088795589 11:113264580-113264602 CACCTTGGGCAGAAGTCACACGG + Intronic
1090046829 11:123343085-123343107 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1090975200 11:131674047-131674069 CCATGAGGTCAGAAGTATCAAGG - Intronic
1091577042 12:1747347-1747369 CCATTGGGTCAAAAATCACAAGG + Intronic
1093489264 12:19686126-19686148 CAATTATGGCAGAAGGCAAAGGG - Intronic
1093546977 12:20360050-20360072 CAATCATGGCAGAAGGCACAGGG + Intergenic
1094297144 12:28919900-28919922 CAATTATGGCAGAAGCCAAAGGG + Intergenic
1095770107 12:45944934-45944956 CCATTAGTGCAGAAGTCCTTGGG - Intronic
1096808681 12:54156064-54156086 CCATTAGGGAAGAAATGAGAAGG + Intergenic
1097478361 12:60087663-60087685 CAATCATGGCAGAAGACACAGGG - Intergenic
1098644257 12:72879475-72879497 CAATTACGGCAGAAGTCAAAGGG + Intergenic
1098655229 12:73019756-73019778 CAATTATGGCAGAAGGCAAAAGG - Intergenic
1098796011 12:74888846-74888868 CAATCATGGCAGAAGGCACAAGG + Intergenic
1099907664 12:88791262-88791284 CCATCATGGCAGAAGGCACTGGG + Intergenic
1100443694 12:94641457-94641479 CGTGTAAGGCAGAAGTCACACGG + Intronic
1100661752 12:96707352-96707374 GCATCAGGTCAGAAGTTACATGG + Intronic
1101624159 12:106422323-106422345 CAATTATGGCAGAAGGCAAAGGG - Intronic
1103799872 12:123531320-123531342 CCACCAGGTCTGAAGTCACATGG - Intronic
1104213990 12:126717874-126717896 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1104214412 12:126722113-126722135 CTATTGGGGCAGAAGTCACAGGG + Intergenic
1104361114 12:128133813-128133835 TCAGTAGGTCAGAAGTCCCAGGG - Intergenic
1109655886 13:65389093-65389115 CAATTATGGCAGAAGGCAAAAGG - Intergenic
1110118004 13:71844008-71844030 CCATTAAGACAGAAGTCTCTAGG + Intronic
1110173297 13:72527888-72527910 CGATTATGGCAGAAGACACAGGG + Intergenic
1110397552 13:75049280-75049302 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1110907710 13:80913722-80913744 CCATTGAGACAAAAGTCACATGG + Intergenic
1111189445 13:84789355-84789377 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1111233282 13:85372812-85372834 CAATTATGGCAGAAGGCAGAGGG - Intergenic
1111240417 13:85466225-85466247 CCATCATGGCAGAAGACAAAGGG + Intergenic
1112229634 13:97575617-97575639 CAATTATGGCAGAAGACAAAGGG + Intergenic
1112870263 13:103962519-103962541 TCATTAGGGCAGAAATGACTAGG - Intergenic
1113167127 13:107454358-107454380 CAATTATGGCAGAAGACAAAGGG + Intronic
1114417590 14:22554750-22554772 CAGTTAGGGCAGAGGTCAGAGGG + Intergenic
1114998554 14:28391619-28391641 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1115806342 14:37056104-37056126 CAATCATGGCAGAAGGCACAGGG - Intronic
1116107013 14:40521918-40521940 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1117084442 14:52184990-52185012 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1117304223 14:54458336-54458358 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1119508674 14:75194225-75194247 TCATTAGGGCAGAGCTCTCATGG - Intergenic
1119931185 14:78548959-78548981 TCGTTGGGGCAGATGTCACAGGG - Intronic
1120664580 14:87290988-87291010 CAATTATGGCAGAAGACAAAGGG - Intergenic
1121588134 14:95078047-95078069 CCATCATGGCAGAAGTCGAAGGG + Intergenic
1125226234 15:37399433-37399455 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1127015569 15:54682888-54682910 CAATTATGGCAGAAGGCAGAGGG + Intergenic
1127053246 15:55106463-55106485 CAATTATGGCAGAAGGCAAAAGG - Intergenic
1127196477 15:56591417-56591439 CGATTATGGCAGAAGGCAAAGGG + Intergenic
1128312021 15:66636756-66636778 CCAACAGGGCAGAAATGACATGG + Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1131705091 15:94984996-94985018 CCTTTAGAGATGAAGTCACACGG - Intergenic
1131949227 15:97662785-97662807 CAATCATGGCAGAAGTCAAAAGG + Intergenic
1131969091 15:97874486-97874508 CCATCACGTCAGCAGTCACAGGG - Intergenic
1132952851 16:2574261-2574283 CAATTAGGGAAGAAGACAAAAGG - Intronic
1132961500 16:2625907-2625929 CAATTAGGGAAGAAGACAAAAGG + Intergenic
1133537960 16:6720321-6720343 CAATTAGGGCAGAAGGCAAAAGG - Intronic
1134605093 16:15564046-15564068 TCATGTGTGCAGAAGTCACAGGG - Intronic
1135503060 16:23013811-23013833 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1137014074 16:35356357-35356379 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1138533571 16:57647923-57647945 CCAGGAGGGCTGAAGTGACACGG + Intronic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1144351795 17:14403650-14403672 CCATCATGGCAGAAGGCAAAGGG - Intergenic
1146191110 17:30767216-30767238 CCATAAGGGCCTCAGTCACAGGG + Intergenic
1146951337 17:36908675-36908697 CCAATAGGGCAGAGGACACTTGG - Intergenic
1147240263 17:39086226-39086248 CCATCGGGGCAGAAGGCTCAGGG - Intronic
1149029646 17:52068320-52068342 CAATTATGGCAGAAGGCAAAGGG - Intronic
1149398082 17:56265287-56265309 CCATCATGGCAGAAGGCAAAGGG + Intronic
1149466680 17:56885558-56885580 CAATTATGCCAGAAGTCAAAGGG + Intergenic
1150781757 17:68128863-68128885 CCATTAAAGAAGAAGTGACATGG + Intergenic
1151825549 17:76522014-76522036 CCCTTAGGGCTGAAGACACTGGG - Intergenic
1152359659 17:79825750-79825772 CCAGAAGGGCGGAAGTCCCAGGG - Intergenic
1153000348 18:449746-449768 CCATGAGGGCAGAAGTGACCTGG - Intronic
1156789321 18:40952665-40952687 CAATTATGGCAGAAGGCAAATGG - Intergenic
1156875520 18:42005948-42005970 CCAGTAGGCCAGAAGTCAGAAGG - Intronic
1157008978 18:43623601-43623623 CCAATAGGACAGAAAGCACATGG + Intergenic
1158954512 18:62524951-62524973 CCCTCAGAGCAGAAGCCACAAGG - Intronic
1159358498 18:67368812-67368834 CAATTATGGCAGAAGACAAAGGG - Intergenic
1159367761 18:67491736-67491758 ACAGTAGGGGAGAAGTGACATGG - Intergenic
1159451403 18:68606868-68606890 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1159966659 18:74601603-74601625 CCATCATGGCAGAAGGCAAACGG + Intronic
1160152535 18:76406082-76406104 CCTTCAGGGCAGATGGCACACGG + Intronic
1165550624 19:36581735-36581757 CAATTATGGCAGAAGGCAAAGGG - Intronic
1166825740 19:45607783-45607805 CCCTTAGGGCAGAAGGGACAGGG - Intronic
1168720388 19:58551533-58551555 ACATCAGGCCAAAAGTCACATGG + Intergenic
925705183 2:6677802-6677824 CCAATAGTGCAGAGGTCTCAGGG - Intergenic
926579750 2:14622314-14622336 CAATTATGGCAGAAGGCAAAAGG + Intergenic
928610495 2:32987333-32987355 CCTATAGGCCAGAAGTCCCAAGG - Intronic
929754365 2:44751854-44751876 GCCTTATGGCAGAAGGCACAGGG + Intronic
931124041 2:59253776-59253798 CCATAAGTGCAGAAGTGAAATGG + Intergenic
931579074 2:63753561-63753583 CAATTATGGCAGAAGGCAAAGGG + Intronic
931647412 2:64437159-64437181 GCATTATGGCAAAAGTCAAACGG + Intergenic
931861637 2:66360925-66360947 CCATTATTGCAGAAGTTACGTGG + Intergenic
934758886 2:96842596-96842618 TTATAAGGGCAGATGTCACAAGG + Intronic
935133188 2:100276827-100276849 CCCTCAGGGCAGAAGGCAAACGG - Exonic
935151758 2:100443263-100443285 CCATCATGGCAGAAGGCAAAGGG - Intergenic
935683692 2:105664139-105664161 ACAGAAGGGCAAAAGTCACATGG - Intergenic
936386022 2:112030086-112030108 CCATCATGGCAGAAGGCAAAAGG + Intergenic
936653261 2:114454657-114454679 TCATTCGGGCTGAATTCACAGGG + Intronic
936787974 2:116118433-116118455 CAATCAGGGCAGAAGGCAAAGGG + Intergenic
936980636 2:118262149-118262171 ACTTTAAGGCAGAAGGCACATGG - Intergenic
938921102 2:135995759-135995781 CCTTTAGGTCAAAAATCACATGG - Intergenic
939651082 2:144762868-144762890 CCATGAGGGCAGAACCCTCAGGG - Intergenic
939848515 2:147276771-147276793 CAATAATGGCAGAAGTCAAAGGG + Intergenic
939895968 2:147791689-147791711 CAATCATGGCAGAAGGCACAGGG - Intergenic
940561196 2:155299568-155299590 CAATTAGGGCAGAGGAGACATGG - Intergenic
941244947 2:163085121-163085143 CCATTATTTCAGATGTCACAAGG + Intergenic
943602880 2:189942317-189942339 CCATCATGGCAGAAGGCAAAGGG - Intronic
945189922 2:207177300-207177322 CAATAAGGGCAAAAGTAACAAGG + Intergenic
946173164 2:217907280-217907302 CCCTTAGGGCAGACATCCCAGGG + Intronic
946657092 2:221960269-221960291 CAATTATGGCAGAAGGCAAAGGG + Intergenic
947178957 2:227395296-227395318 CAATTATGGCAGAAGGCAAAGGG + Intergenic
948035039 2:234851647-234851669 CAATTATGGCAGAAGGCAAAGGG - Intergenic
948176245 2:235945844-235945866 CCATCATGGCAGAAGGCAGAGGG + Intronic
1169682989 20:8238065-8238087 CCATGAGTGCATAACTCACATGG - Intronic
1169852775 20:10070635-10070657 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1169919976 20:10724849-10724871 CTATTAGAGCAGAAGTTCCAAGG - Intergenic
1170057261 20:12220177-12220199 CGATTAGGACAGAAATCAGAAGG + Intergenic
1170751797 20:19154957-19154979 CCATCATGGCAGAAGGCAAAAGG + Intergenic
1171243076 20:23587000-23587022 GCATTAGTGCAAATGTCACATGG - Intergenic
1175522792 20:59612882-59612904 CAATTATGGCAGAAGGCAAAGGG + Intronic
1175684016 20:61013825-61013847 CAATTATGGCAGAAGACAAAGGG + Intergenic
1177237444 21:18410808-18410830 TCTTTAGGTCAGAAGTTACATGG - Intronic
1177411782 21:20738950-20738972 CCATCAGGGCAGAAGGCAAAAGG - Intergenic
1177959415 21:27643931-27643953 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1178402807 21:32301442-32301464 CGATTATGGCAGAAGGCAAAGGG - Intronic
1178799225 21:35776963-35776985 CCATCATGGCAGAAGTGCCAAGG - Intronic
1178862010 21:36297494-36297516 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1178945216 21:36941296-36941318 CCATCATGGCAGAAGGCAAAGGG - Intronic
1178952715 21:36998380-36998402 CCATGAGGGCAGAACTCTCATGG + Intergenic
1179085953 21:38217993-38218015 CCATTAGGACAGAACTCTGAAGG - Intronic
1180866162 22:19121152-19121174 CCATGAAGGCAGAAGTGCCAGGG - Intronic
949326400 3:2869966-2869988 GCATTTGGGTAGAAGCCACAGGG - Intronic
950557210 3:13702979-13703001 CCATTGGGGCAAAAATCACGTGG + Intergenic
950913349 3:16617406-16617428 CAATTATGGCAGAAGGCAAAGGG - Intronic
951086176 3:18515368-18515390 CCACTGGGGCAGAAGACAGAGGG + Intergenic
953073282 3:39544964-39544986 CAATTATGGCAGAAGGCAAAAGG - Intergenic
955589813 3:60522967-60522989 CAATCATGGCAGAAGTCAAAAGG + Intronic
957585917 3:82131762-82131784 CAATTATGGCAGAAGGCAAAGGG - Intergenic
957890198 3:86346804-86346826 TAATTAGGAAAGAAGTCACAGGG + Intergenic
958834588 3:99129970-99129992 CCATAATGGCAGAAGGCAAAAGG + Intergenic
959829353 3:110841961-110841983 CCATTTAAGCAGAAGTCAGATGG + Intergenic
960158030 3:114317844-114317866 CCATTGGGGCAGTAGTCCAAGGG + Intergenic
960549091 3:118953591-118953613 CCATTCTTGCAGAAGTAACATGG + Intronic
964299233 3:155269811-155269833 CAATTATGGCAGAAGGCAAAGGG - Intergenic
964506756 3:157408007-157408029 CGATGAGGGCAAAAGTAACACGG - Intronic
965301413 3:167010449-167010471 ACATTATGGCAGAAGGCAAAAGG + Intergenic
965997292 3:174899555-174899577 ACATTATGGCAGAAGGCAAAGGG - Intronic
966730421 3:183146437-183146459 CCATTAGGGCAGAAGTCACAGGG + Intronic
967229269 3:187322122-187322144 CCTGTAAAGCAGAAGTCACATGG + Intergenic
968110860 3:196045455-196045477 CCATCATGGCAGAAGGCAGAGGG + Intronic
968295286 3:197571629-197571651 CAATTATGGCAGAAGGCAAAAGG - Intronic
969198313 4:5581021-5581043 CAATTATGGCAGAAGGCAGAGGG - Intronic
970088200 4:12371516-12371538 CAATTATGGCAGAAGGCAAAAGG - Intergenic
970813051 4:20118325-20118347 CAATCAGGGCAGAAGGCAAAGGG + Intergenic
971747635 4:30604646-30604668 CTATTAGGGCAGAAGTTAATAGG - Intergenic
974461970 4:62199718-62199740 CCATTTGGGCACAAATGACAGGG + Intergenic
975248649 4:72150421-72150443 CCATTAGGGAAGATGAAACAGGG - Intergenic
975826533 4:78325740-78325762 CCATAATAGCAGTAGTCACAAGG + Intronic
977514006 4:97997355-97997377 CAATTATGGCAGAAGGCAAAGGG + Intronic
978018062 4:103772999-103773021 CAATCAGGGCAGAAGGCAAAGGG - Intergenic
978492577 4:109324389-109324411 CAATTATGGCAGAAGGCAAAGGG + Intergenic
978592132 4:110335526-110335548 CAATTATGGCAGAAGGCAAAGGG + Intergenic
979916884 4:126446261-126446283 CCATCATGGCAGAAGGCAAAGGG - Intergenic
981447744 4:144859794-144859816 CAATTACGGCAGAAGGCAAAGGG - Intergenic
981549319 4:145927435-145927457 CCAATAGGGTAGAAGTTAGAAGG + Intronic
982629339 4:157812307-157812329 CAATCATGGCAGAAGTCAAAAGG + Intergenic
982886864 4:160792314-160792336 CAATTATGGCAGAAGGCAAAGGG - Intergenic
984516607 4:180749253-180749275 CTATTAGGCAAGCAGTCACAGGG - Intergenic
987244079 5:16030431-16030453 CAATTACGGCAGAAGGCAAAAGG + Intergenic
988057971 5:26125124-26125146 CAATTATGGCAGAAGGCAAAGGG + Intergenic
988228175 5:28441848-28441870 CAATTATGGCAGAAGGCAAAGGG + Intergenic
990000319 5:50884669-50884691 CAATTATGGCAGAAGGCAAAAGG - Intergenic
990298448 5:54426669-54426691 AAATAAGGCCAGAAGTCACATGG + Intergenic
992875552 5:81050927-81050949 CCATTAGGGCAGAAGAAAGCTGG + Intronic
993267216 5:85741199-85741221 CAATTATGGCAGAAGGCAAAAGG + Intergenic
993455869 5:88126318-88126340 CAATTATGGCAGAAGGCAAAGGG - Intergenic
994506665 5:100651220-100651242 CAATCATGGCAGAAGTCAAAGGG + Intergenic
995255807 5:110045141-110045163 CAATTATGGCAGAAGACAGAAGG - Intergenic
995559260 5:113363425-113363447 CAATTATGGCAGAAGGCAAAGGG + Intronic
995704817 5:114977312-114977334 TCATGAGGGCAGAAGTATCATGG + Intergenic
996672999 5:126141122-126141144 CCATTATGGGGGAAGTTACAGGG - Intergenic
997747545 5:136312205-136312227 CTCTTAAGGCAGAAGTCACGGGG + Intronic
998698415 5:144668128-144668150 CCACTAGGTCAGAACTCACATGG - Intergenic
999251149 5:150183185-150183207 ACATTAGGGGAGCAGTCACAGGG + Intronic
1001198005 5:169691099-169691121 CCATCATGGCAGAAGGCAAAGGG + Intronic
1003761205 6:9180802-9180824 CAATTATGGCAGAAGGCAAAAGG + Intergenic
1003798154 6:9629582-9629604 CTATCATGGCAGAAGTCAAAGGG - Intronic
1004101920 6:12621522-12621544 CAATCATGGCAGAAGTCAAAGGG + Intergenic
1005146193 6:22692801-22692823 GGATAAGGGCAGAAGCCACATGG - Intergenic
1005669976 6:28095588-28095610 CAATTATGGCAGAAGGCAGAGGG - Intergenic
1007089178 6:39171530-39171552 GCAATAAGGCAGAAGGCACATGG - Intergenic
1007360956 6:41355280-41355302 CAATCAGGGCAGAAGACAAAGGG - Intergenic
1007629221 6:43263444-43263466 CCAGTAAGCCAGCAGTCACAGGG + Intronic
1008261106 6:49367341-49367363 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1008420572 6:51294463-51294485 TCATGAGGGCAGAGGTCTCATGG + Intergenic
1009370336 6:62893089-62893111 CTATTATGGCAGAAGGCAAAGGG + Intergenic
1010604899 6:77876291-77876313 TCATTAGGGCAGAGCTCTCAAGG - Intronic
1011354465 6:86459735-86459757 CAATTATGGCAGAAGCCAAAGGG - Intergenic
1011544644 6:88469909-88469931 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1012038206 6:94170102-94170124 CAATTATGGCAGAAGGCAGAGGG + Intergenic
1013689667 6:112626670-112626692 AAAATAGGGCAGAAGCCACATGG - Intergenic
1013880216 6:114889708-114889730 CCAATGGGGCAGCATTCACATGG - Intergenic
1014405957 6:121051103-121051125 CCCTTAAGGCAGAAGGCACTGGG - Intergenic
1014506828 6:122269605-122269627 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1015035703 6:128651606-128651628 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1015383146 6:132592716-132592738 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1015511216 6:134039912-134039934 CAATCATGGCAGAAGTCAAAGGG - Intronic
1016567185 6:145469112-145469134 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1016831741 6:148440939-148440961 CCATGAGAGCAGAAATTACAGGG - Intronic
1018473905 6:164121880-164121902 CCATCACGGCAGAAGGCAAAAGG + Intergenic
1018507229 6:164484397-164484419 CAATTACGGCAGAAGGCAAAGGG + Intergenic
1018692388 6:166357999-166358021 CCATCATGGCAGAAGGCAAAAGG + Intergenic
1019497053 7:1345608-1345630 CCACCAGGGCCGAAGCCACAAGG - Intergenic
1019602221 7:1890416-1890438 CCACTTGGGCAGAGATCACATGG - Intronic
1023545810 7:41316814-41316836 ACATTGGGTCAGCAGTCACATGG + Intergenic
1023574579 7:41612726-41612748 CAATTAAGGGAGAAGTTACAAGG - Intergenic
1025603424 7:63021599-63021621 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1026115280 7:67490662-67490684 CAATCATGGCAGAAGTCAAAGGG - Intergenic
1027352449 7:77326031-77326053 CCAAGAGGGCAGAAATCATATGG + Intronic
1031322964 7:120356183-120356205 CCATTAGAGCATTAGTCATATGG - Intronic
1032330653 7:130975885-130975907 CAATTGTGGCAGAAGTCAAAGGG - Intergenic
1033567003 7:142588443-142588465 CCCTTGGGGGAGAAGGCACAGGG - Intergenic
1034415064 7:150959894-150959916 CCATAAGGGCGGCAGGCACATGG - Intronic
1034749168 7:153552705-153552727 CAATCACGGCAGAAGGCACAGGG + Intergenic
1035201636 7:157271291-157271313 CAAATACGGCAGAAGTCACTGGG + Intergenic
1036191617 8:6676118-6676140 GCATTAGGGCAGATGGCACTTGG + Intergenic
1037029984 8:14092716-14092738 CCATCATGGCAGAAGGCAAAAGG - Intronic
1037861954 8:22411743-22411765 CCACAGGGGCAGAAGTCACAGGG + Intronic
1038704016 8:29877267-29877289 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1040713760 8:50222179-50222201 CCATTATTCCAGAGGTCACAAGG - Intronic
1040798040 8:51308561-51308583 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1041458826 8:58089496-58089518 CTAATAGGGAAGAAGTGACAAGG - Intronic
1041664187 8:60426488-60426510 CCCTTAGGGCGGGGGTCACATGG - Intergenic
1041730455 8:61057028-61057050 CCATTCAGGCAGAAATCAGAGGG + Intergenic
1042775461 8:72425829-72425851 TCATGAGGGCAGAGGTCTCATGG + Intergenic
1043214699 8:77570821-77570843 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1043598164 8:81908076-81908098 CCTTTAGGGGAGATGTCAAAGGG + Intergenic
1044933369 8:97271170-97271192 CCTTTAGGTCAGACTTCACAAGG - Intergenic
1045115949 8:98979855-98979877 CCATGAGGGCAGAACTCATATGG + Intergenic
1045154777 8:99455401-99455423 CAATTATGGCAGAAGACAAAGGG + Intronic
1045341111 8:101255272-101255294 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1045505661 8:102776761-102776783 CCACTAGGGCAAAAGCCACTAGG + Intergenic
1048051673 8:130823039-130823061 GGATTTGGGAAGAAGTCACAAGG - Intronic
1048180388 8:132189138-132189160 CCATCAAGACAGAAGGCACATGG - Intronic
1049099204 8:140567311-140567333 CCACGAGGGCAGGAGGCACATGG + Intronic
1050079377 9:1899881-1899903 AAATTAAGGCAGAAGTCAAAAGG + Intergenic
1050616441 9:7406149-7406171 CAATCAGGGCAGAAGGCAAAGGG - Intergenic
1050660172 9:7875887-7875909 CAATTATGGCAGAAGGCAAAGGG - Intronic
1050881205 9:10702506-10702528 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1051546058 9:18276658-18276680 CAATCAGGGCAGAAGGCAAAGGG + Intergenic
1052607005 9:30717180-30717202 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1052994170 9:34541091-34541113 CCTTGAGGGCAGAAATCAAAAGG + Intergenic
1053265008 9:36706139-36706161 CAATTATGGCAGAAGGCAAAAGG + Intergenic
1053472169 9:38354681-38354703 CAATCATGGCAGAAGGCACAGGG + Intergenic
1055013006 9:71587553-71587575 CCATTAGAGAAGAAGGCACAGGG + Intergenic
1055619296 9:78107186-78107208 CAATCAGGGCAGAAGGCAAAGGG - Intergenic
1056007999 9:82294409-82294431 CAATCAGGGCAGAAGGCAAAAGG + Intergenic
1056434968 9:86566823-86566845 CAATTACGGCAGAAGACAAAGGG + Intergenic
1057333913 9:94141523-94141545 CCAGGAGGGCAGATGTCACCGGG - Intergenic
1057424161 9:94935238-94935260 CAATTATGGCAGAAGGCAAAGGG - Intronic
1057745017 9:97744322-97744344 CAATCATGGCAGAAGTCAAAGGG - Intergenic
1058780633 9:108331036-108331058 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1060768327 9:126311648-126311670 CCATCATGGCAGAAGGCAAAAGG + Intergenic
1060846695 9:126842924-126842946 CCAGGAGGGGAAAAGTCACAGGG - Intergenic
1061232349 9:129322092-129322114 CCATGAGGGCAGGAACCACATGG + Intergenic
1062034528 9:134377039-134377061 CCCCTAGGCCAGCAGTCACAGGG - Intronic
1185749264 X:2597548-2597570 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1188263208 X:28041278-28041300 CAATTATGGCAGAAGACAAAGGG + Intergenic
1189138037 X:38570125-38570147 GAATTAGGTCAGAAGACACATGG - Intronic
1189353020 X:40291201-40291223 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1189896293 X:45659701-45659723 CAATTATGGCAGAAGGCAAAAGG - Intergenic
1189957020 X:46286448-46286470 CCATCATGGCAGAAGGCAAAGGG - Intergenic
1189957546 X:46291212-46291234 CAATTATGGCAGAAGGCAGAGGG + Intergenic
1190122839 X:47676720-47676742 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1190804098 X:53818691-53818713 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1193175705 X:78389692-78389714 CCATCATGGCAGAAGGCAAAAGG + Intergenic
1193192066 X:78582497-78582519 CAATTATGGCAGAAGGCAAAGGG - Intergenic
1194092606 X:89597812-89597834 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1194633142 X:96311478-96311500 CAATTATGGCAGAAGGCAAAAGG + Intergenic
1196160918 X:112481599-112481621 CAATCATGGCAGAAGTCAAAGGG - Intergenic
1198120725 X:133590005-133590027 CCATGAGGGCAGAGCTCTCATGG - Intronic
1200445253 Y:3253915-3253937 CAATTATGGCAGAAGGCAAAGGG + Intergenic
1201300142 Y:12498174-12498196 GCATTGAGGCAGATGTCACAAGG - Intergenic
1201608159 Y:15810661-15810683 CAATCATGGCAGAAGTCAGAAGG - Intergenic