ID: 966732867

View in Genome Browser
Species Human (GRCh38)
Location 3:183164745-183164767
Sequence CCTCCTTATCACTAGATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966732861_966732867 17 Left 966732861 3:183164705-183164727 CCCAGTGGGGAATACACATTTAA 0: 1
1: 0
2: 0
3: 14
4: 141
Right 966732867 3:183164745-183164767 CCTCCTTATCACTAGATTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 100
966732862_966732867 16 Left 966732862 3:183164706-183164728 CCAGTGGGGAATACACATTTAAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 966732867 3:183164745-183164767 CCTCCTTATCACTAGATTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966732867 Original CRISPR CCTCCTTATCACTAGATTGA GGG Intergenic
900072272 1:780198-780220 CTTCCTTATCATTAGTTTGAAGG - Intergenic
903826693 1:26150776-26150798 CCTCCTTAGAACTGGATAGAGGG + Intergenic
907422002 1:54353915-54353937 CCTCCTCATCTGTAGAATGAAGG - Intronic
909146783 1:71944410-71944432 ACACCTTATCCCTAAATTGAGGG + Intronic
915625596 1:157112187-157112209 CCTCCTTACCCCTAGAAAGAAGG - Intergenic
917669720 1:177261965-177261987 CCTCCATGTCACCAAATTGAAGG - Intronic
919543649 1:198883673-198883695 GCTCCCTATAACTATATTGAAGG + Intergenic
921725291 1:218516627-218516649 CCTCCTTATCGCAGGACTGATGG - Intergenic
922112334 1:222572966-222572988 CCTTCTTTTCACTATCTTGATGG - Intronic
922267210 1:223994156-223994178 CTTCCTTATCATTAGTTTGAAGG - Intergenic
923783602 1:237047279-237047301 CCTCCTTTTCACTGGCTGGAAGG - Intronic
1066726497 10:38401443-38401465 CTTCCTTATCATTAGTTTGAAGG + Intergenic
1073077446 10:100833100-100833122 CCTCCTCTTCACATGATTGAGGG - Intergenic
1073233626 10:101994344-101994366 CCTCCTTTTCACAAGATTAGGGG - Intronic
1076463674 10:130663920-130663942 CTTCCTTTTCACAAGAATGATGG - Intergenic
1080218697 11:29875521-29875543 CCTCCTTAAGACTAAATTGTTGG - Intergenic
1082898379 11:58217819-58217841 CTTGGCTATCACTAGATTGATGG + Intergenic
1083555201 11:63620588-63620610 CCTCCTTATCACAAGAGGAATGG - Intergenic
1087396449 11:97606816-97606838 TCTACTTAACACTGGATTGAAGG - Intergenic
1087897364 11:103601492-103601514 CTCACTTATCACTAGATTCATGG + Intergenic
1088671204 11:112142898-112142920 CCTCCTTATAAAAATATTGATGG + Intronic
1091472656 12:742800-742822 CCTCCTTACCAGTAAATAGAAGG - Intergenic
1096844156 12:54396224-54396246 CCTCCTTTTCAGTAGAATGAGGG + Exonic
1098067364 12:66632833-66632855 ACACCTTATCACTACATTAATGG - Intronic
1100717649 12:97322672-97322694 CCTCCTCATCACTAGGTTCATGG + Intergenic
1114340689 14:21739939-21739961 TCTCCTTCTCACTATATTCAGGG - Intergenic
1116112033 14:40597253-40597275 CCTCCTTAGGACTACATTAAAGG + Intergenic
1118564959 14:67129354-67129376 CCTACTTATCACTATGTTTATGG - Intronic
1120275240 14:82364903-82364925 CCCACTTTTCACTAGAGTGAAGG - Intergenic
1121931726 14:97978395-97978417 TTTCCCTATCACTAGTTTGAGGG + Intergenic
1122032146 14:98920020-98920042 CCTTCTTGTCACTGGATTGATGG + Intergenic
1125016676 15:34945038-34945060 ACTCCTTTTCACCATATTGAAGG + Intronic
1127683654 15:61321021-61321043 CCTCCTGATCACTGTATTGAAGG - Intergenic
1128220921 15:65967949-65967971 CCTCCTTAACTCTAAAGTGAGGG - Intronic
1128357483 15:66938262-66938284 ACTCCTTATCAGTACATTGTGGG - Intergenic
1129999514 15:80034712-80034734 CCTCCTCATCACCCGACTGATGG - Intergenic
1130104864 15:80921657-80921679 CTTCCTTATCTGTAGAATGAAGG + Intronic
1132930485 16:2456609-2456631 CCTCCTCATCACTGGATTCCTGG - Exonic
1133958919 16:10474746-10474768 TCTCCTTATCACTGGATTTCAGG - Intronic
1135840969 16:25875870-25875892 CCTGCTTCCCACCAGATTGATGG + Intronic
1138107103 16:54293457-54293479 CCTGCTAATGACTAGGTTGAGGG + Intergenic
1141300659 16:82812588-82812610 CCTCCGTGTCACTAGATGCAGGG - Intronic
1142267161 16:89069932-89069954 AATCCTTATCCCTAGAGTGATGG + Intergenic
1144440150 17:15273889-15273911 ACTCCTTTTCACAATATTGAGGG - Intergenic
1144612861 17:16739404-16739426 CCTCCTTTTCACTTTCTTGATGG + Intronic
1144899924 17:18576183-18576205 CCTCCTTTTCACTTTCTTGATGG - Intergenic
1145132520 17:20369482-20369504 CCTCCTTTTCACTTTCTTGATGG + Intergenic
1147753961 17:42755899-42755921 CCTCCTCATCTCCAGAATGATGG - Intergenic
1152978200 18:245208-245230 CCTTCTTAGCATTAGATTTATGG + Intronic
1159020956 18:63142673-63142695 CTTCCTGATCGGTAGATTGATGG - Intronic
1164469774 19:28520212-28520234 CCTCCTTCTCATTAGACTAAAGG - Intergenic
928255124 2:29715446-29715468 CCTCCTTATCTGTAAAATGAGGG - Intronic
931642597 2:64395051-64395073 CCTCCTGATCTCTACATTTAAGG - Intergenic
941000409 2:160196903-160196925 TCTCTTTATCACTAGATTTGGGG - Intronic
947122305 2:226829997-226830019 CTTTATTATTACTAGATTGAGGG + Intergenic
947691881 2:232145906-232145928 CTTCCTTATCAATAGATGGGGGG - Intronic
1169026538 20:2376278-2376300 CCTCCTCTTCACTGGATTTAGGG + Intergenic
1172682958 20:36731179-36731201 CCTCCTTATCTCTGGTTTGGTGG - Intronic
1181683106 22:24509568-24509590 CCTCCTTGTCACTAGGAGGAGGG + Intronic
950019517 3:9777243-9777265 ATTCCTTATCACTAGTTTGGAGG - Intronic
950048227 3:9964381-9964403 TCTCCTTATCTATAAATTGAGGG - Intronic
950829772 3:15861350-15861372 CCTCCTTATCAGTTCAGTGAGGG + Intergenic
955632382 3:60988398-60988420 CATCCTGTCCACTAGATTGATGG - Intronic
956601300 3:71025479-71025501 CCTCTTTATAACAAGATGGATGG + Intronic
958088587 3:88846327-88846349 ACTCATTATCAAAAGATTGATGG + Intergenic
960650252 3:119940216-119940238 TCTCCTTATCGCTAAAATGAGGG - Intronic
964111111 3:153088637-153088659 TTTTCTTATCACCAGATTGAAGG + Intergenic
966059873 3:175741758-175741780 CTCACTTATCACTAGGTTGATGG + Intronic
966730487 3:183146934-183146956 TCTCCTTACCACCTGATTGAGGG + Intronic
966732867 3:183164745-183164767 CCTCCTTATCACTAGATTGAGGG + Intergenic
970149288 4:13071986-13072008 CTTCCTTATCACTCGAATGAGGG - Intergenic
974134513 4:57798347-57798369 GCTTCTTATCACTAAATTGTAGG + Intergenic
974179290 4:58363173-58363195 CCTGCCAATCACTTGATTGATGG - Intergenic
975248643 4:72150360-72150382 ACTCATTATCACTAAATTGCAGG + Intergenic
975733078 4:77356454-77356476 CCACCAGATCACTGGATTGAGGG - Intronic
977479735 4:97560543-97560565 CCTCTTTAACACTGGATTGAAGG + Intronic
979157407 4:117413902-117413924 CCTCCTTATTGCTGGATGGATGG - Intergenic
979387858 4:120091100-120091122 CCTTCTTTTCTCTAGTTTGAAGG + Intergenic
981908502 4:149951487-149951509 TCTATTTATCACTAGCTTGAGGG - Intergenic
993681048 5:90878570-90878592 CCTTCTTATCACTTCTTTGAAGG + Intronic
996496133 5:124158839-124158861 CCTCCTCATCTCTAGATTATTGG + Intergenic
996957538 5:129202107-129202129 CCTCCTTAGCACTCCATTTATGG + Intergenic
997480461 5:134180564-134180586 CCTCCCTATCCCTGGGTTGAGGG - Intronic
997888837 5:137657433-137657455 GCTCCTTATCTATAGAATGAGGG - Intronic
998186502 5:139983570-139983592 TCTCTTTATCACGAGATTGAGGG - Intronic
1003499864 6:6695221-6695243 CTTCCGTATCAGTAGCTTGAGGG + Intergenic
1010529278 6:76946788-76946810 CCATCTTATCAATAGAATGAAGG + Intergenic
1011048777 6:83118925-83118947 CCTCCTTAGCACTACATGAAGGG - Exonic
1014302210 6:119695800-119695822 TCTCCTTAACACTAGAGAGAAGG + Intergenic
1014974848 6:127867358-127867380 TCTACTTCTCACTAGATTGCTGG - Intronic
1016686480 6:146887970-146887992 CCTCCTTCTCCCTAGAGAGAAGG + Intergenic
1021070243 7:16229644-16229666 CATTTTTATCACTAGTTTGAAGG - Intronic
1023673718 7:42607311-42607333 TCTCCTCATCACAGGATTGAGGG - Intergenic
1023762775 7:43482287-43482309 TCTCCTTATCCCTAGGCTGAGGG - Intronic
1024068605 7:45767529-45767551 CTTCCTTATCATTAGTTTGAAGG + Intergenic
1025098031 7:56112568-56112590 TTTCCTTATCATTAGTTTGAAGG + Intergenic
1025991192 7:66498204-66498226 TTTCCTTATCATTAGTTTGAAGG - Intergenic
1027213446 7:76168062-76168084 TTTCCTTATCATTAGTTTGAAGG - Intergenic
1028153945 7:87408005-87408027 TTTCCTTATAACTTGATTGAAGG - Intronic
1028898022 7:96063881-96063903 CCTCCTAATCCTTATATTGAAGG + Intronic
1036634344 8:10538648-10538670 CCTCCTTTTCTCTGCATTGAAGG - Exonic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038286754 8:26212187-26212209 CCTCCTTATCTGTAAAATGAGGG + Intergenic
1039712422 8:40069238-40069260 CCTCCTTATTAGTAAATTGAAGG - Intergenic
1042953230 8:74222098-74222120 CCTCCTTATCGCCAGCTGGAGGG - Intergenic
1044423337 8:92024054-92024076 CCTCGTATTCACTAGAATGAGGG - Intronic
1053552717 9:39101132-39101154 CCTCCTTTCCAGTAGTTTGATGG + Intronic
1053816832 9:41921296-41921318 CCTCCTTTCCAGTAGTTTGATGG + Intronic
1054107091 9:61064978-61065000 CCTCCTTTCCAGTAGTTTGATGG + Intergenic
1054613766 9:67266147-67266169 CCTCCTTTCCAGTAGTTTGATGG - Intergenic
1056493260 9:87129155-87129177 GCTCCTTGTCTCTAGAATGAAGG + Intergenic
1187230590 X:17418532-17418554 CCTCCTTGGCATTGGATTGAAGG - Intronic
1187813098 X:23202054-23202076 CATCATCATCACTAGAATGAGGG - Intergenic