ID: 966735640

View in Genome Browser
Species Human (GRCh38)
Location 3:183184840-183184862
Sequence ATTTGCCCATTTAATATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966735640 Original CRISPR ATTTGCCCATTTAATATCTA TGG (reversed) Intronic
901617168 1:10550647-10550669 ATTTGCCCATTTAATTTTCATGG + Intronic
903627118 1:24739078-24739100 AATTTTCCATTTAATATCTTTGG - Intergenic
904794657 1:33050413-33050435 ATTTTCCCATGTAATATTTTTGG + Intronic
907279380 1:53336197-53336219 AATTTTCCATTTAATATCTTTGG - Intergenic
908062663 1:60368667-60368689 TTTTTCCCATTTTATATGTAAGG + Intergenic
908284499 1:62580155-62580177 ATTTGACCTATTAACATCTAAGG - Intronic
908424895 1:63997216-63997238 ATTTGCCCATTTATAATGGAGGG + Intronic
909140589 1:71859555-71859577 ATTTACCTATTTATTGTCTATGG - Intronic
909350771 1:74650749-74650771 ATTTTTCCATTTAATATTTTTGG + Intronic
910898131 1:92090423-92090445 ATTTGCCATTTTTATATCTTTGG + Intronic
911723534 1:101217492-101217514 ATTTTCCCTTTTATTATTTAAGG + Intergenic
912666329 1:111583222-111583244 ATATGCCCAATTATTCTCTAGGG + Intronic
915228993 1:154431934-154431956 AATTTCCCATTTAATATTTTTGG + Intronic
915437389 1:155918851-155918873 CTGTGCCCATTTTACATCTAAGG + Intronic
915701226 1:157798519-157798541 ATTTATTCATTTAATATTTAGGG - Intronic
915863198 1:159469749-159469771 AGTTCACCATTAAATATCTATGG + Intergenic
917069940 1:171139595-171139617 TTTTGCCCATTTGCTATCAAAGG - Intronic
917675188 1:177312056-177312078 ATGTGCCCATTAAAAATGTATGG + Intergenic
918572964 1:186020713-186020735 ATTCACCCATTTAACTTCTATGG - Intronic
918851898 1:189702556-189702578 ATTTTCCTAATAAATATCTATGG - Intergenic
920572360 1:207027277-207027299 ATTTGCCCAGTTGCTCTCTAAGG + Intronic
921391500 1:214619434-214619456 ATATGAACATTTAATATTTAGGG - Intronic
921493021 1:215802430-215802452 ATTTGCCCATTTAAAAAATAAGG - Intronic
922778342 1:228228157-228228179 ACTTGCCCTTTTATAATCTAGGG - Intronic
923698695 1:236280573-236280595 ATTTGCCCCTTTTATTTTTATGG + Intronic
1063497269 10:6521504-6521526 ATTTGCCCATTTAATCCTCATGG - Intronic
1063864970 10:10353936-10353958 ACTTGCTCATTTAATATATATGG - Intergenic
1064343890 10:14513050-14513072 ATTTGGCTATTTATTATCTTTGG - Intergenic
1064551929 10:16510441-16510463 ATTTGCCCCTTTGAAGTCTATGG - Intronic
1064858891 10:19803225-19803247 TTTAGCCCATTTAAGATCTTAGG + Intergenic
1065275285 10:24079462-24079484 ATTATCCCATTTATTTTCTAAGG - Intronic
1065641936 10:27791913-27791935 ATTTTCCCATTCAGTATCAATGG - Intergenic
1066038378 10:31518611-31518633 ATTTGCACATTGAAAAACTAAGG + Intronic
1066094279 10:32057297-32057319 ATTTGTTCATTTCATATCCAAGG + Intergenic
1067315762 10:45160584-45160606 AATTCCCCATTTAATATTTTTGG + Intergenic
1068004692 10:51379114-51379136 ATGTCCCCATTTAATAAATAAGG - Intronic
1068557606 10:58476640-58476662 ATTTGTCTATATATTATCTATGG + Intergenic
1068566967 10:58586927-58586949 GTTTGCCCATTTGTTCTCTATGG + Intronic
1069234582 10:66054738-66054760 ATTTGTCCATTTATTTTCTTTGG + Intronic
1071205256 10:83268019-83268041 AATTCCCCATTTAAAATGTATGG - Intergenic
1071887096 10:89963221-89963243 ATTTTACAATTTAATATCTGAGG + Intergenic
1072291291 10:93967793-93967815 AATTGCTCATTTCAGATCTAGGG - Intergenic
1073530114 10:104223038-104223060 ATTTGCTTATATATTATCTATGG - Intronic
1073555705 10:104448682-104448704 ATTTGCCCTTTTAAAATAAAAGG - Intronic
1073850204 10:107606980-107607002 ATTTTCCAATTTAACATTTATGG - Intergenic
1074014878 10:109524344-109524366 ATTTGCAAATTATATATCTAAGG + Intergenic
1074260627 10:111849628-111849650 AATTGCCTATTTAATCTCTTTGG + Intergenic
1075825817 10:125356356-125356378 ATTTGTCCATTTTATAGCTCAGG - Intergenic
1080334336 11:31178993-31179015 CTTTGCCCATTTAAAAACTTGGG - Intronic
1086117244 11:83266015-83266037 TTTTGTCCATTTAATACATAGGG - Intronic
1088369759 11:109076370-109076392 ATTTGCCCACTTGATTTCTCAGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090887524 11:130892360-130892382 ATTTGCCCATTTTATAATGAAGG - Intronic
1090912300 11:131131922-131131944 ATTGGCCCATTTGATATTTTTGG - Intergenic
1091235067 11:134016203-134016225 AGTTGCCCATTTGACACCTATGG + Intergenic
1092037314 12:5348020-5348042 TTTTGCCCATTAAATATGCATGG + Intergenic
1093044818 12:14430974-14430996 ATTTGCCAATCTCTTATCTAAGG + Intronic
1095235341 12:39788548-39788570 AATTGCCCGTTTAATATTTTTGG + Intronic
1095355624 12:41270094-41270116 GTTTGCCCATTTAACAGCTATGG + Intronic
1095600196 12:44004487-44004509 ATTTCCCCTTTTAATTTCAAGGG + Intronic
1096059338 12:48683148-48683170 CCTTTCCCATTTAATAGCTATGG - Intergenic
1096501615 12:52067332-52067354 ATTTGCCCATTTCCTATCATAGG - Intergenic
1096988739 12:55780897-55780919 AATTTCCCATTTAATATTTTAGG + Intronic
1098964407 12:76771372-76771394 ATTTGCCAAATTATTTTCTAGGG + Intronic
1099281982 12:80661679-80661701 ATTTACCCATATAAGCTCTAGGG - Intronic
1099910371 12:88825047-88825069 CTTTGCCCATTAAATTACTATGG - Intergenic
1100508068 12:95240273-95240295 ACTTTCCTAGTTAATATCTATGG + Intronic
1101655685 12:106718022-106718044 ATGTGCACTTTTAAAATCTAAGG - Intronic
1103333529 12:120171541-120171563 ATGTACCCATTTAGTAGCTATGG - Intronic
1106076813 13:26467411-26467433 ATTTGCCAATTTTATGTCAATGG - Intergenic
1106179317 13:27357648-27357670 ATATACCTATTTAATATCTGGGG + Intergenic
1106983642 13:35320079-35320101 TTTAGCCCATTTAACATTTAAGG + Intronic
1107901033 13:45013923-45013945 ATATGCCCAATTCCTATCTATGG - Intronic
1108115423 13:47122116-47122138 ATGTGCTAATTTAATATCTTTGG - Intergenic
1111032445 13:82621337-82621359 ATGTGTCCATATAATATTTAGGG + Intergenic
1111789509 13:92836712-92836734 ATATGCCAACTTAATATTTATGG + Intronic
1112016275 13:95334002-95334024 GTTTCCCCATTTAAAATGTAGGG - Intergenic
1112826244 13:103395702-103395724 ATTTGTCCACTTAATATATTTGG - Intergenic
1112959913 13:105111323-105111345 TATTGTCCTTTTAATATCTATGG + Intergenic
1113216940 13:108052759-108052781 AGATGTCCATTTAATATCAAGGG + Intergenic
1114232656 14:20798281-20798303 ATCTGCCCTTTTAAAATCCAGGG - Intergenic
1115389510 14:32838780-32838802 AATTTCCCATTTAATATTTTGGG - Intergenic
1116361372 14:44002577-44002599 ATTTGCCTCTTTAATTTTTATGG + Intergenic
1118228226 14:63923117-63923139 AGTTGCTCAATAAATATCTACGG - Intronic
1118698664 14:68411103-68411125 ATCTAGCCATTCAATATCTAAGG - Intronic
1119488320 14:75007382-75007404 ATTTGCCCATTTTGTATAAAAGG + Intronic
1121399037 14:93655717-93655739 ACTTACTTATTTAATATCTACGG - Intronic
1121679145 14:95778235-95778257 GTTTGCCAATTTAAGATCTTGGG - Intergenic
1122522522 14:102355133-102355155 ATTTACGCATATATTATCTATGG + Intronic
1124024424 15:25951851-25951873 ATTTGCAAATTGTATATCTAAGG - Intergenic
1126171517 15:45699278-45699300 CATTGCCCACTTCATATCTAAGG + Intergenic
1126302989 15:47220995-47221017 ATTAGCCCATTAAGTAGCTATGG - Intronic
1127050091 15:55073278-55073300 ATTTGTCCATTTAATTTTCATGG - Intergenic
1127313448 15:57772514-57772536 ATTTACCCATTTACTGTCAATGG + Intronic
1127750126 15:62029648-62029670 ATTTGTCCAATTAAAATATAAGG + Intronic
1128585174 15:68842910-68842932 ATTTGACAATTTAAAATTTATGG - Intronic
1128675947 15:69608485-69608507 ATTTACCCATCTGATATCTAAGG - Intergenic
1128960259 15:71995643-71995665 ATTTACATATTTATTATCTAGGG + Intronic
1130303176 15:82695660-82695682 ATTTACCCATTTATTATAAAGGG - Intronic
1130511270 15:84591516-84591538 ATTTCCCCATTTAAAATGTGGGG - Intergenic
1130787701 15:87118518-87118540 ATGGGCCCATTTATTATTTATGG + Intergenic
1131726561 15:95232501-95232523 ATCTTCCTTTTTAATATCTAGGG - Intergenic
1133144261 16:3772011-3772033 AATTTCCCATTTAATATTTTTGG + Intronic
1134815693 16:17203888-17203910 ATTTGCTCATTCAAAAACTATGG - Intronic
1137718472 16:50613189-50613211 AGATGCCCATTTAACATCCAAGG + Intronic
1137991966 16:53166783-53166805 CTTTGCACATTTACTATGTAAGG + Intronic
1138367912 16:56498082-56498104 ATTTTGTCATTTAATTTCTAAGG - Intronic
1139019916 16:62736052-62736074 ATTGGCACATTTAATGTTTATGG - Intergenic
1140227524 16:73090533-73090555 ATTTGCTCAATAAATGTCTATGG + Intergenic
1142974065 17:3632842-3632864 ATTTGCCCATTTAAAATACAAGG - Intronic
1143354843 17:6319137-6319159 ATTTGTTCATGTACTATCTATGG + Intergenic
1144114435 17:12073529-12073551 ATTTGCCCATTACATGCCTATGG - Intronic
1144121527 17:12158684-12158706 ATTTGCCCATTTTAAAAATAGGG + Intergenic
1144181149 17:12753645-12753667 ATTTGCTCACATGATATCTATGG - Intronic
1144184472 17:12783842-12783864 ATTTTCCCACTTAATAACTTAGG - Intergenic
1146419296 17:32667768-32667790 ACATGCCCATTTTATATATATGG + Intronic
1146640141 17:34534342-34534364 ATTCACCCACTTAATATGTATGG + Intergenic
1148730383 17:49831624-49831646 ATTTTCCCATTTCTTATCTGGGG + Exonic
1149730369 17:58939699-58939721 CTTTGCCTATTTTATGTCTAAGG - Intronic
1152835492 17:82527633-82527655 ATTTGCCAAATGAATATCTTCGG - Intronic
1153092804 18:1367859-1367881 ATTTTCCTATTAAATCTCTATGG + Intergenic
1154229394 18:12540805-12540827 AATTTTCCATTTAATATCTTTGG - Intronic
1154476770 18:14767837-14767859 AATTCCCCATTTAATATTTTTGG + Intronic
1155290259 18:24333466-24333488 ATTTACACATTTAACATTTATGG - Intronic
1155582012 18:27319552-27319574 ATTTGCCCATTTCAAAACTTGGG + Intergenic
1155746050 18:29357379-29357401 TTTTGCTAATATAATATCTAAGG + Intergenic
1156803252 18:41144509-41144531 AATTGTCCATTTAATATTTTTGG - Intergenic
1157245016 18:46046092-46046114 ATTTTCCCATTGAATAGCTTTGG - Intronic
1157817981 18:50744292-50744314 TTTTGTCAATTTAGTATCTAGGG - Intergenic
1158270435 18:55707719-55707741 ATTTCCCCATTTAATTGCTTTGG + Intergenic
1159494593 18:69185748-69185770 ATATTCCCATTTAAAATATAAGG + Intergenic
1159878775 18:73838224-73838246 ATATGCACATTAAATAACTAGGG - Intergenic
1159888235 18:73930753-73930775 ATTTGCTCATTTAATATGTATGG - Intergenic
1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG + Intergenic
1162260843 19:9532598-9532620 AGTTTCCCATTTAATATTTTTGG + Intronic
1167727960 19:51231454-51231476 ATTGTCCCATTTAAAATATATGG - Intronic
926846317 2:17144534-17144556 ATTTTTCCATTTAATATTTTGGG + Intergenic
927014445 2:18943399-18943421 ATTTACTCATGTAAAATCTATGG - Intergenic
928137364 2:28697936-28697958 ACTTTCCCACTTAGTATCTATGG + Intergenic
928480422 2:31677277-31677299 ATTTTCCCATTGTATATCTTTGG - Intergenic
928911759 2:36429073-36429095 TTTTGCCCATTCAATCCCTACGG - Intronic
929135738 2:38622128-38622150 ATATTTGCATTTAATATCTACGG + Intergenic
930339938 2:50099402-50099424 ATTTGCCCTTTTAAAGTATATGG + Intronic
933128692 2:78644925-78644947 ATTTCTCCATTTAATATTTTTGG - Intergenic
933722011 2:85403240-85403262 ATTTGCCCATTTTATATAAGTGG - Intronic
935358813 2:102230252-102230274 CTTTTCCCATTTTCTATCTATGG + Intronic
935549155 2:104433316-104433338 ATCTGCCCATTTAAGCTCTGAGG - Intergenic
936120419 2:109737898-109737920 ATTTGCCCATTTAAAAACATTGG + Intergenic
936942158 2:117895272-117895294 CTTTGTCCATTTAATGTCCATGG + Intergenic
937961355 2:127462371-127462393 ATTTGCCCATTTAAAACATTGGG - Intronic
938620367 2:133046118-133046140 ATTTTTCCATTTAATATTTTTGG + Intronic
938679253 2:133672679-133672701 ATTTGTTCATATATTATCTATGG - Intergenic
939757646 2:146134136-146134158 ATCTGACCTTTTAATATCTTGGG - Intergenic
941004651 2:160235593-160235615 TTTTGCCCACAGAATATCTAAGG - Intronic
941201322 2:162514102-162514124 CTGTGCCCATTTAAAATCTTGGG + Intronic
941486975 2:166094188-166094210 GTTTTCTCATTTAATATTTAAGG - Intronic
942563926 2:177248140-177248162 AGTTGCCCATTTAGCATCTCAGG - Intronic
942877633 2:180820631-180820653 ATTATCCCATTTCACATCTATGG - Intergenic
942891278 2:180991904-180991926 ATTTTTCCATTTAATATTTTTGG + Intronic
943521686 2:188959609-188959631 ATTTGCCCAATAAATAAGTAAGG + Intergenic
943844494 2:192626641-192626663 ACTTCCCTATTCAATATCTAAGG + Intergenic
943896462 2:193368597-193368619 ATATGAGTATTTAATATCTAAGG + Intergenic
944311869 2:198242595-198242617 ATTTGCCTTTTTAATGTCTTTGG + Intronic
944776865 2:202975723-202975745 ATTTGCCCATTTATTAAAAAAGG - Intronic
945159995 2:206879960-206879982 TTTTGCCCATTTAAAAAATAAGG + Intergenic
945630524 2:212269530-212269552 AATTGCACAAATAATATCTAAGG - Intronic
945700053 2:213158385-213158407 ATTTGCACATTTTATTTCAAAGG + Intergenic
946736521 2:222759362-222759384 ATTTTCCCATTTATTATCTGGGG + Intergenic
948256336 2:236571133-236571155 GTTTATCCATTTAAAATCTATGG - Intronic
1168736596 20:145140-145162 ATTTTCCCATTTAAAATCATGGG + Intronic
1177741726 21:25162350-25162372 ATTTCCCTATTTAATTACTATGG - Intergenic
1177858059 21:26421335-26421357 ATTTGCCTATTTATTATTCAAGG - Intergenic
1178580538 21:33834487-33834509 ATTTTCTCATTAAATATCTTAGG + Intronic
1178743938 21:35229397-35229419 ATTTACATATTTATTATCTATGG + Intronic
1180052938 21:45341078-45341100 GTTTGCCCATTTTATAACTTTGG - Intergenic
1180757869 22:18175624-18175646 ATCTGCCCATGTACTGTCTACGG - Intronic
1180778152 22:18502973-18502995 ATCTGCCCATGTACTGTCTACGG + Intergenic
1181197026 22:21194539-21194561 ATCTGCCCATGTACTGTCTACGG + Intergenic
1182052378 22:27323501-27323523 CTTTGCCCATGTGATTTCTAGGG + Intergenic
1183985392 22:41567169-41567191 ATTTTCCCATTTAGTTTCTCAGG + Intronic
1184278006 22:43421267-43421289 TAATGCCCATTTAATATTTATGG - Intronic
949104675 3:189460-189482 ATTTTATCATTGAATATCTATGG + Intergenic
949281357 3:2351668-2351690 AATTTCCCATTTAATATTTTTGG + Intronic
949793327 3:7817678-7817700 ATTTCCCCATTTTACATATAAGG + Intergenic
951714817 3:25629507-25629529 ATTTTCCAATTTTTTATCTAGGG - Intronic
951785807 3:26417991-26418013 ATGTGGAGATTTAATATCTAAGG - Intergenic
952077487 3:29714669-29714691 TTTTTCCCATTTAACATGTAAGG + Intronic
952450883 3:33431775-33431797 ATTTTCCCAGTAAATAACTAAGG + Intronic
953300466 3:41769964-41769986 ATTTTCCTATTTAATATTGAGGG + Intronic
953807926 3:46087630-46087652 ATATGCCCATTTAATAGATGCGG + Intergenic
954011996 3:47649040-47649062 AATTGGACATTTAATTTCTAAGG - Intronic
955113171 3:55969897-55969919 ATTTGCCCATTTAAATGCTCAGG - Intronic
955310221 3:57879478-57879500 ATTTGTCCATTTAATTACTGAGG - Intronic
955615471 3:60802471-60802493 AAATGCCCATTTAATATTTTGGG - Intronic
955994114 3:64660466-64660488 AATTTTCCATTTAATATTTAAGG - Intronic
956322434 3:68012197-68012219 ATTTGCACATTTTACATCTTGGG - Intronic
956854019 3:73258096-73258118 AATTGCCCATTTTATATGGAGGG + Intergenic
957895631 3:86418123-86418145 ATATGCCCAATGAATATTTATGG + Intergenic
958000777 3:87746217-87746239 AGTTGCTCATTTAATTCCTAGGG + Intergenic
961842631 3:129729428-129729450 ATTTGACCATGTATTATATAGGG + Intronic
962911933 3:139860296-139860318 ATTTGCCCAATAACTAACTATGG + Intergenic
963145820 3:141992809-141992831 ATTTGGCCATCTAATTTCTCAGG + Intronic
963367856 3:144362044-144362066 ATTTTCCCATTTAAATTCTAAGG - Intergenic
964011429 3:151897022-151897044 TTTTCCCTATTTAATATCTGAGG - Intergenic
964104397 3:153023417-153023439 ATTTCCCCATTTTATACATAAGG + Intergenic
965121263 3:164560741-164560763 ATTTGCTTATATATTATCTATGG - Intergenic
965989966 3:174804895-174804917 ATTAGACAATTTAAAATCTAAGG - Intronic
966735640 3:183184840-183184862 ATTTGCCCATTTAATATCTATGG - Intronic
967587584 3:191234153-191234175 ATTCTCCCATTTAATATTTTAGG + Intronic
969886097 4:10216958-10216980 ATTTGCCCATTTTAGAGGTAGGG - Intergenic
971269272 4:25124240-25124262 ATTTACCAATTTAATATGTCTGG + Intronic
972198581 4:36684340-36684362 ATTTGCATATTTCATAGCTAAGG + Intergenic
972350414 4:38231418-38231440 ATTAGCCCACTTAATAAGTAAGG - Intergenic
972590110 4:40477772-40477794 ATTTGCTCATTTTTTATTTAGGG - Intronic
972764408 4:42138851-42138873 TTTTTCACATTTAGTATCTATGG + Intronic
973035769 4:45404218-45404240 ATTTGCCCATTTTAAAAATAAGG - Intergenic
973739211 4:53902852-53902874 ATTTTTCCATTTAATATTTTTGG - Intronic
974529297 4:63086384-63086406 ATTTTATCATGTAATATCTATGG - Intergenic
974986420 4:69032509-69032531 ATGTGCACATTTAATATTTATGG + Intronic
975869577 4:78764969-78764991 AATTGTCCATTTAATATTTTTGG + Intergenic
977324757 4:95561251-95561273 ATTGGCCCATTTAAAAACTTCGG + Intergenic
977366704 4:96078461-96078483 ATTTGCCTATTTAATATTTAGGG - Intergenic
978367897 4:108001822-108001844 AATTTCCCATTTAATATTTTTGG + Intronic
978523655 4:109642332-109642354 ATTTGCCCTTTCCATATCCATGG - Intronic
978675745 4:111313642-111313664 TTTTGCCCATTTAAAAAATAGGG + Intergenic
978853695 4:113368861-113368883 TTTTAGGCATTTAATATCTATGG + Intronic
978970927 4:114805630-114805652 TTTCCCCCATGTAATATCTAAGG - Intergenic
980007769 4:127560541-127560563 TTTTTCTCATTTAATTTCTAAGG - Intergenic
980490591 4:133522085-133522107 ATTTGCCCAGTTCATATATTTGG + Intergenic
982514042 4:156321541-156321563 ATTTGCCAATTTAAAAACTCAGG - Intergenic
982889700 4:160832240-160832262 ATAGGCCCCTTTAATATGTATGG + Intergenic
983165216 4:164467850-164467872 AATTCCCCATTTAATATTTTTGG + Intergenic
984030875 4:174602583-174602605 TTTTGACCATCTAATTTCTAAGG - Intergenic
987249928 5:16089231-16089253 ATCTCCCCTTTTAATATCAATGG + Intronic
987790475 5:22560195-22560217 ATTTTCCCAATTAATATTTTTGG - Intronic
988291270 5:29290704-29290726 CTTTGCCCAAATAATATTTAGGG - Intergenic
989162343 5:38403692-38403714 AATTTCCCATTTAATATTTTTGG + Intronic
989491821 5:42064881-42064903 AATTTCCCATTTAATATTTTTGG - Intergenic
990206687 5:53437368-53437390 CTTTGCCAATATAATATATAAGG + Intergenic
992607123 5:78469720-78469742 ATTCACCCATTTAAAATATACGG + Intronic
993299130 5:86184727-86184749 ATTTGCCCATTTAATTTTTAAGG + Intergenic
993521086 5:88901477-88901499 ATTTTCCCTATTAATATATAAGG + Intronic
994058181 5:95443865-95443887 GTATGCCCATGTAATATCTCTGG - Intronic
995277707 5:110295666-110295688 AATTTTCCATTTAATATCTTAGG - Intronic
995955051 5:117767499-117767521 ATTTTCCCAGTTAATTTTTAAGG - Intergenic
998641742 5:144019630-144019652 AATTGTTCATTTAATATCTATGG + Intergenic
998928985 5:147159412-147159434 ATTTTCCCATTTAATAAACAGGG - Intergenic
999236354 5:150099485-150099507 ATTTATCCATTTAACAGCTAAGG - Intronic
1000920100 5:167128109-167128131 TTTTGCTCATTTAACATATAAGG - Intergenic
1001499563 5:172219331-172219353 ATTTTTCCATTTAATATTTTTGG - Intronic
1003675772 6:8203130-8203152 ATTTGGGCATTTTATCTCTAAGG - Intergenic
1004065515 6:12240159-12240181 CTTTGACCATTCAATACCTAAGG + Intergenic
1004435358 6:15587433-15587455 GTTTGACTATTTAATATTTAAGG - Intronic
1005923396 6:30419376-30419398 AGTTTCCCATTTAATATATGAGG - Intergenic
1007338794 6:41175610-41175632 TTTTTCCCATTTAATATATCGGG + Intergenic
1008554310 6:52659945-52659967 ATTTTTCCATTTAATATTTTTGG - Intergenic
1009812846 6:68691130-68691152 ATTTGTCCATTTCAGTTCTAGGG + Intronic
1010842351 6:80661509-80661531 ATTGCAACATTTAATATCTAGGG + Intergenic
1011241109 6:85272313-85272335 ATTTGCCCAGATAAAATCAATGG + Intergenic
1011949697 6:92950400-92950422 ATTTAACCGTTTAATATTTAAGG - Intergenic
1013861030 6:114635576-114635598 ATTTTCCCATTTCATATTTTTGG - Intergenic
1015028113 6:128561644-128561666 ACATGCCGATTTAATTTCTATGG + Intergenic
1015637604 6:135293898-135293920 GTTTGGCTATTTAATATTTAGGG - Intronic
1015878899 6:137851302-137851324 ATTTATCCATGTATTATCTATGG + Intergenic
1016473516 6:144400971-144400993 CTTTGCCCACTTTATATCTGGGG + Intronic
1017298336 6:152826532-152826554 ATTTGCATTTTTAATATTTATGG + Intergenic
1017616620 6:156253167-156253189 ATTAGCCCCTTTCATATGTATGG + Intergenic
1018470448 6:164091808-164091830 AATTTTCCATTTAATATCTTTGG - Intergenic
1024235447 7:47394119-47394141 ATTTGAACTTTAAATATCTAAGG - Intronic
1024296218 7:47844384-47844406 ATTTGCTGAATGAATATCTAGGG - Intronic
1024516262 7:50261284-50261306 CTTTGGCCATTTAATACTTATGG - Intergenic
1024570715 7:50721209-50721231 AATTGTCCATTTAATATTTTTGG - Intronic
1026094866 7:67338524-67338546 ATTTTCCCTATTAATATATAAGG - Intergenic
1027973098 7:85112325-85112347 ATTTGCCTATCTTATAACTAGGG - Intronic
1028073003 7:86475704-86475726 TTATGCCCATTTTACATCTAAGG - Intergenic
1028627379 7:92892681-92892703 CTTTGCTCATTTAAAAACTATGG + Intergenic
1030606820 7:111646516-111646538 CTTTTTCCATTTAATATATATGG - Intergenic
1031278021 7:119756635-119756657 ATTTGCCCTTTTCAGGTCTAGGG + Intergenic
1031395402 7:121267869-121267891 AGCTGTCCATTTAATATGTAAGG + Intronic
1032878195 7:136060263-136060285 ATTTGTGCATTTAGAATCTATGG + Intergenic
1036093163 8:5691437-5691459 GTTTGCATATTTAATATGTAAGG - Intergenic
1036172628 8:6503992-6504014 ATTTTTCCATTTAATATTTTTGG - Intronic
1036699810 8:11005271-11005293 AATTTCCCATTTAATATTTTTGG + Intronic
1037190972 8:16124870-16124892 ATTTGCCAATTTAATCTCACTGG - Intronic
1041589307 8:59558577-59558599 TTTTGCCCATTTCATAGTTAAGG - Intergenic
1043099691 8:76026649-76026671 ATTTGCCCATTTCACAACTGAGG - Intergenic
1043265713 8:78265747-78265769 ATTTACCCAACTTATATCTAAGG + Intergenic
1043764624 8:84114807-84114829 ATATCCCCATTTTATAACTAAGG + Intergenic
1043849325 8:85198163-85198185 ATATGCCCTGTTATTATCTAAGG + Intronic
1044106478 8:88213805-88213827 ATTTTCCAATTTGATATTTATGG - Intronic
1044852565 8:96443255-96443277 ATTTGTCCAATAAATATATATGG - Intergenic
1046275921 8:111959452-111959474 ATTTGCCCTTTCAAAATCTTGGG + Intergenic
1046453422 8:114423987-114424009 ATTTTTCCTTTTAATATCTGTGG + Intergenic
1046887676 8:119385759-119385781 ATTTACCCATTTAATCTATCTGG + Intergenic
1047271197 8:123360808-123360830 ATTTTCCCAATAAATATTTAAGG - Intronic
1047415961 8:124664541-124664563 ATATGCCTATTTAAAACCTAAGG - Intronic
1047643388 8:126844555-126844577 TTATTCCCATTTAATATCCAGGG - Intergenic
1048010708 8:130453416-130453438 ATTTGCCAACTTTAAATCTAAGG + Intergenic
1048641035 8:136361944-136361966 ATTTGCCCATAGAATATTTTAGG + Intergenic
1048923568 8:139251621-139251643 ATATGCCCATTTTATAGCTGAGG - Intergenic
1050920232 9:11191449-11191471 ATTTTCCCATTTAATAGGTGAGG + Intergenic
1051205702 9:14686568-14686590 ATTTGACGATCTAATAACTATGG - Intronic
1052430557 9:28360992-28361014 ATTTTTCCATTTAATATTTTTGG - Intronic
1053469215 9:38333863-38333885 ATTAGACCATTAAATATCAATGG - Intergenic
1054858739 9:69928330-69928352 ATATTCCCATCTAATGTCTAGGG + Intergenic
1055159794 9:73112256-73112278 ATTTTTCCATTTAATATTTTTGG - Intergenic
1057475432 9:95397060-95397082 TTTTGCCCATTTAATAAATCAGG - Intergenic
1057559873 9:96118765-96118787 ATTTGCCCTTTAAATATGAATGG + Intergenic
1058830797 9:108814618-108814640 ATTTTCCCATTTGCTATGTATGG + Intergenic
1059616388 9:115956038-115956060 CTTTTCCCATTTAATATTTTAGG - Intergenic
1061687902 9:132298427-132298449 ATTTACCCAGTAAATATTTATGG + Intronic
1185907221 X:3946603-3946625 ATTTGCCCATTAAATTGCTGAGG - Intergenic
1188553839 X:31389346-31389368 ATTTTCTCATTTAATACCAATGG + Intronic
1190097474 X:47493218-47493240 ATTTACCTATTTATTATCAAGGG + Intergenic
1190577171 X:51851819-51851841 AATTTCCCATTTAATATTTTTGG + Intronic
1190859961 X:54335307-54335329 ATTTAACCATATAATATATAGGG - Intronic
1191889566 X:65926333-65926355 ATTTGCATATTTAAAAGCTAGGG - Intergenic
1191975875 X:66870294-66870316 ATGTGCCCATCTAAAATTTAGGG - Intergenic
1192187362 X:68958872-68958894 CTTTGCCCATTTAAAACCTGTGG - Intergenic
1192198900 X:69051076-69051098 ATATGCTCATTTAATACCTACGG + Intergenic
1194128342 X:90047932-90047954 ATTTGCCTATTGAAGGTCTAGGG - Intergenic
1194693850 X:97020833-97020855 ATTTTTCCATTTAATATCTTTGG + Intronic
1195354065 X:104021836-104021858 AAGTGCCCATTTAATTTCCAGGG - Intergenic
1202044426 Y:20724104-20724126 TTATGCTCATTTAATATCTGAGG - Intergenic