ID: 966736407

View in Genome Browser
Species Human (GRCh38)
Location 3:183190388-183190410
Sequence GACTGAAGACCGTTAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966736407_966736412 22 Left 966736407 3:183190388-183190410 CCTGCTACTAACGGTCTTCAGTC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG 0: 1
1: 0
2: 2
3: 44
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966736407 Original CRISPR GACTGAAGACCGTTAGTAGC AGG (reversed) Intronic
903578235 1:24352411-24352433 GACTGAAGACAGCTAGAAGGTGG + Intronic
907343206 1:53752297-53752319 GACTGGAGACCGTGGGTGGCAGG - Intergenic
907670521 1:56471003-56471025 GACTGAATACATTTAGTAGTTGG - Intergenic
1099622628 12:85024303-85024325 GACTGAAGACAGTCTCTAGCTGG + Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1132285776 15:100661251-100661273 GACTGAAGAACATTAACAGCAGG - Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1143660514 17:8321896-8321918 GACTGAAGATGGCCAGTAGCTGG + Exonic
937521624 2:122719960-122719982 GACTGACGTCTATTAGTAGCAGG - Intergenic
939674127 2:145050663-145050685 GCCTGAAGACCTTTAGTGTCTGG + Intergenic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1178073192 21:28992176-28992198 AACTGAAGAGCGTTGGGAGCCGG + Intronic
953471556 3:43170997-43171019 GACTGAAGAGTGTTGGTGGCTGG - Intergenic
955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG + Intronic
958450767 3:94269642-94269664 GACTGAATACCATCACTAGCAGG + Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
1000644477 5:163744327-163744349 GACTGGAGACTGATAGAAGCGGG - Intergenic
1015003131 6:128244729-128244751 GACTGAAAACCTCTAGTAGGAGG + Intronic
1019398491 7:836567-836589 GTCTGAAGGCAGTTTGTAGCTGG + Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026687049 7:72520142-72520164 TACTAAACCCCGTTAGTAGCTGG + Intergenic
1033565488 7:142574696-142574718 GTCAGAAGACCGTTAGTGGGAGG + Intergenic
1045414305 8:101951390-101951412 GAGTGAAGACAGTGAGGAGCTGG + Intronic
1056129561 9:83570574-83570596 GACTGGAGACCGAAAGTAGCAGG + Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1060125608 9:121041668-121041690 GACTGATGACCCTTAGTTGTGGG + Intronic
1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG + Intronic
1195910837 X:109887132-109887154 GATTGAAGACTGTGAGTTGCTGG + Intergenic
1199932335 X:152536204-152536226 GACTGAAGACAGCTAGTACGGGG + Intergenic