ID: 966736412

View in Genome Browser
Species Human (GRCh38)
Location 3:183190433-183190455
Sequence GCAAATGTGTTATTGAAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 387}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966736410_966736412 -7 Left 966736410 3:183190417-183190439 CCCAGAAGCAGATTATGCAAATG 0: 1
1: 0
2: 1
3: 12
4: 246
Right 966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG 0: 1
1: 0
2: 2
3: 44
4: 387
966736404_966736412 27 Left 966736404 3:183190383-183190405 CCCCTCCTGCTACTAACGGTCTT 0: 1
1: 0
2: 1
3: 4
4: 68
Right 966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG 0: 1
1: 0
2: 2
3: 44
4: 387
966736405_966736412 26 Left 966736405 3:183190384-183190406 CCCTCCTGCTACTAACGGTCTTC 0: 1
1: 0
2: 0
3: 3
4: 75
Right 966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG 0: 1
1: 0
2: 2
3: 44
4: 387
966736406_966736412 25 Left 966736406 3:183190385-183190407 CCTCCTGCTACTAACGGTCTTCA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG 0: 1
1: 0
2: 2
3: 44
4: 387
966736407_966736412 22 Left 966736407 3:183190388-183190410 CCTGCTACTAACGGTCTTCAGTC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG 0: 1
1: 0
2: 2
3: 44
4: 387
966736409_966736412 -6 Left 966736409 3:183190416-183190438 CCCCAGAAGCAGATTATGCAAAT 0: 1
1: 0
2: 1
3: 24
4: 230
Right 966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG 0: 1
1: 0
2: 2
3: 44
4: 387
966736411_966736412 -8 Left 966736411 3:183190418-183190440 CCAGAAGCAGATTATGCAAATGT 0: 1
1: 0
2: 0
3: 19
4: 295
Right 966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG 0: 1
1: 0
2: 2
3: 44
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966736412 Original CRISPR GCAAATGTGTTATTGAAAAA CGG Intronic
904074307 1:27828768-27828790 GCAATTGATTTATTTAAAAAAGG + Intergenic
904126531 1:28244124-28244146 GCAAATGTGTTAGTTAGAAAAGG + Intronic
905072079 1:35235229-35235251 GCAGATATGTTATTGGAAAAGGG - Intergenic
909066607 1:70942442-70942464 GCAAATGAGGAATTGAAAATTGG - Intronic
909409955 1:75338509-75338531 ACAAATAAGTTATTGTAAAATGG + Intronic
909830780 1:80186983-80187005 GCAAATCTATGATTTAAAAAAGG + Intergenic
910027700 1:82678105-82678127 GAAAATGTGTGTTTGGAAAAAGG + Intergenic
911003009 1:93186799-93186821 GACAATGTGTTATTTTAAAAGGG - Intronic
911559096 1:99382184-99382206 GCAAATGCATAATTAAAAAATGG - Intergenic
912280684 1:108309283-108309305 GCATATGTGTTTTTGAGACAGGG - Intergenic
912287542 1:108385074-108385096 GCATATGTGTTTTTGAGACAGGG + Intronic
913329240 1:117653546-117653568 GCCAGTGTCTTCTTGAAAAATGG + Intergenic
913631808 1:120717326-120717348 GCAAAAGTGTGAAAGAAAAATGG + Intergenic
914286911 1:146235581-146235603 GCAAAAGTGTGAAAGAAAAATGG - Intergenic
914547943 1:148686324-148686346 GCAAAAGTGTGAAAGAAAAATGG - Intergenic
914618566 1:149384021-149384043 GCAAAAGTGTGAAAGAAAAATGG + Intergenic
915117849 1:153611640-153611662 ACAAATGAGTAAATGAAAAAGGG - Intronic
916146560 1:161745402-161745424 GTAAATGTGTTGTTGGAAAAGGG - Intergenic
916275096 1:162985343-162985365 GCAAATTTGAAATTGGAAAAGGG + Intergenic
918748509 1:188239553-188239575 GCAAATGAGCAATTCAAAAAAGG + Intergenic
918758889 1:188375121-188375143 GCAAATGTATTAATTAAAAATGG - Intergenic
920224487 1:204428244-204428266 GCCATTGTCTTATTGAAGAATGG - Intronic
921434525 1:215102513-215102535 GTTAATCTGTTATTGAAGAAAGG + Intronic
921512204 1:216045958-216045980 GAAAATGTGTTTTTGAAATTGGG - Intronic
923587738 1:235290053-235290075 GCCAATCTGATAGTGAAAAATGG - Intronic
924505377 1:244678549-244678571 CCAAAGGTTTTATTAAAAAATGG - Intronic
1063855010 10:10240344-10240366 GCAGAAGTGTTCTTGAGAAATGG - Intergenic
1065374805 10:25027934-25027956 GCAAAAGAGTTATTGCAAGATGG + Intronic
1065501854 10:26391133-26391155 AAAAATGTTTTTTTGAAAAAGGG - Intergenic
1066160706 10:32724540-32724562 GCAGATGTTTCATTTAAAAATGG + Intronic
1066280361 10:33911396-33911418 GCAAATGCATTAATTAAAAAAGG - Intergenic
1067410810 10:46063001-46063023 GGAAATCTGATTTTGAAAAAAGG - Intergenic
1067632579 10:47974968-47974990 GCAAATGTGCTATTAGATAAGGG + Intergenic
1067979278 10:51065460-51065482 GCAAATATGTTGTTCAAATAGGG + Intronic
1068399157 10:56506566-56506588 ACAAATGTGGCATAGAAAAATGG - Intergenic
1069167692 10:65183873-65183895 GAAAATGTGATATTGGCAAAAGG + Intergenic
1071364757 10:84887721-84887743 GCAAATCTGATATTGAATAAAGG - Intergenic
1074281356 10:112054600-112054622 GCAAATGTGGAAATGAAAAAAGG - Intergenic
1075088924 10:119431969-119431991 GCAAATGTGTTACTGCAGCAGGG - Intronic
1076462992 10:130659092-130659114 GCAAAAATGCTATTGAAAGATGG + Intergenic
1077823321 11:5774952-5774974 GTAAATGTCATATTGTAAAACGG - Intronic
1078704891 11:13733938-13733960 GCACATCTGTTACTGGAAAAGGG + Intergenic
1078776136 11:14395052-14395074 GGATATTTTTTATTGAAAAAAGG - Intergenic
1079119278 11:17669362-17669384 GAAAATGTGGTATTGACTAAAGG + Intergenic
1079180761 11:18191439-18191461 GCTAATGTGTTATGGAAATGGGG + Intronic
1079553306 11:21728553-21728575 GCAAAGCTGTTATTCAGAAATGG - Intergenic
1079676706 11:23236696-23236718 GAATATGTGTTATTGACAAGAGG - Intergenic
1080598511 11:33799199-33799221 AAAAGTGTGTTATTGAAATAAGG + Intergenic
1081045046 11:38263369-38263391 GCAAATCTGTTCTTCAGAAATGG - Intergenic
1082220897 11:49635031-49635053 GTAAGTTTATTATTGAAAAAAGG - Intergenic
1084074272 11:66760890-66760912 GAAAATTTGTCATTAAAAAATGG - Intronic
1084458184 11:69280937-69280959 AGAAATGTGTGATTGAAAATGGG - Intergenic
1085381267 11:76121227-76121249 GCAACTGTGTTCATAAAAAATGG - Intronic
1085764916 11:79274306-79274328 GCAAATCTGAGAGTGAAAAACGG - Intronic
1086237681 11:84651695-84651717 GGAAATGTGTTAATGGGAAAAGG + Intronic
1086736302 11:90309165-90309187 TTAAATGTTTTATTGAAGAACGG - Intergenic
1086751639 11:90502391-90502413 GGAAAGGTTTTATTAAAAAAAGG + Intergenic
1087687610 11:101282389-101282411 GCAAAAGTGTTTTAGAAAATTGG + Intergenic
1088199796 11:107320053-107320075 ACAAATGTATTATAGAAATAAGG - Intergenic
1089275664 11:117334305-117334327 GCCAATGAGTTAAAGAAAAAAGG - Intronic
1089488444 11:118865324-118865346 GCACATGTGTTTTTTTAAAAAGG - Intergenic
1089548363 11:119249216-119249238 GCAAATGTGTTATAGCCATATGG + Intronic
1089991704 11:122867534-122867556 GCACATGTGATATGGAAGAAAGG + Exonic
1090862221 11:130664181-130664203 TCATAGGTGTTATTAAAAAAAGG + Intergenic
1091164267 11:133457702-133457724 GCAAAACTGTTATTCAAAAATGG + Intronic
1092952969 12:13525287-13525309 GGAAATGTGTTAGTGGAAAATGG + Intergenic
1093221497 12:16425815-16425837 GAAAATGGGGTATTGAGAAAGGG - Intronic
1093781124 12:23138734-23138756 GCAAATGCTTAATTGAAACAGGG + Intergenic
1094011433 12:25814382-25814404 TCAATTGTGTCACTGAAAAAGGG + Intergenic
1094304284 12:29000394-29000416 TCATATGTATTATTGAAAAGTGG + Intergenic
1094704726 12:32903495-32903517 GCAAATTTGTGAAAGAAAAAAGG - Intergenic
1095345448 12:41143816-41143838 GAAAATAAGTTACTGAAAAAGGG + Intergenic
1097644466 12:62220062-62220084 GCAATTGTTTTATTTAATAAAGG + Intronic
1099731712 12:86512245-86512267 CCAAATCTGTTATTTAATAATGG - Intronic
1099770673 12:87049979-87050001 GCAAATATGTTTATGAAAAGGGG - Intergenic
1100626520 12:96339063-96339085 GCAAAAGGGTCATTCAAAAATGG - Intronic
1100763523 12:97836054-97836076 TCAAATGTGTTGTTGAAATCAGG + Intergenic
1100934152 12:99644233-99644255 GGAAACATGTTATTGAAAACTGG - Intronic
1101053673 12:100889932-100889954 GCAAACATGTTGGTGAAAAATGG - Intronic
1101297921 12:103444805-103444827 GGAAATATGATATTGATAAAAGG - Intronic
1101325070 12:103708380-103708402 ACAAATGAGTTATTGAACATGGG + Intronic
1102902266 12:116647518-116647540 GCAAATGTCTTATTTAAATATGG - Intergenic
1102912620 12:116729252-116729274 ACAAATGTGTAATTGGAAAAGGG + Intronic
1104313116 12:127672064-127672086 GCTAATGTGTTATTGAAAATTGG + Intergenic
1104541288 12:129667799-129667821 GCAAATGTGTTGTTGGTATATGG + Intronic
1105644307 13:22300873-22300895 GTAAATTTCTTAATGAAAAAAGG - Intergenic
1105873090 13:24527451-24527473 ACAAACGTGTTTTTGAAAAGTGG + Intergenic
1106502459 13:30342068-30342090 GCAAATCTGTTTCTGATAAATGG - Intergenic
1106750032 13:32753656-32753678 GAAAAGCAGTTATTGAAAAATGG - Intronic
1107193143 13:37614146-37614168 ATAAAGGTGTTATTAAAAAATGG - Intergenic
1107666386 13:42694704-42694726 TCAAATGGGATATTTAAAAATGG + Intergenic
1108025743 13:46175452-46175474 GCAAATGTGGTATAAAGAAAGGG - Intronic
1109012357 13:56968595-56968617 AGAAATGTATTATTGAAAACTGG + Intergenic
1109762427 13:66847271-66847293 GCAAATGTCTTACTTTAAAATGG - Intronic
1109827186 13:67737237-67737259 TCAAATGTCTTTTTAAAAAATGG - Intergenic
1109852469 13:68084658-68084680 TCAACAGTGTTTTTGAAAAAGGG + Intergenic
1109928755 13:69184437-69184459 GCAGATATTTTATTGAAAAATGG - Intergenic
1110446389 13:75587225-75587247 GAAAATGATTTATTAAAAAATGG + Intronic
1111088943 13:83416184-83416206 AAGAATATGTTATTGAAAAATGG - Intergenic
1111808914 13:93073168-93073190 GCAAATCTTTTATTTAAACAAGG + Intergenic
1112255532 13:97827158-97827180 GTACATGTGTTACTGAAAAGGGG - Intergenic
1114518694 14:23319584-23319606 GGAAATGTGATTTTTAAAAATGG - Intronic
1114838075 14:26227858-26227880 GCAACAGTATTATTTAAAAATGG + Intergenic
1115950594 14:38716948-38716970 TCAAATGTGTCTGTGAAAAATGG - Intergenic
1116589459 14:46752354-46752376 GAAACTATTTTATTGAAAAATGG - Intergenic
1116634070 14:47371897-47371919 GTAAATGTTTTCTTCAAAAAAGG - Intronic
1117139340 14:52771306-52771328 GCGCATGTGTTTTTAAAAAAAGG - Exonic
1117557687 14:56902734-56902756 GCACATTTGTTCTTTAAAAAAGG - Intergenic
1117704386 14:58448460-58448482 GCAAATGTGTTATATAAAGATGG - Exonic
1119939652 14:78626760-78626782 GCTCCTCTGTTATTGAAAAAAGG + Intronic
1120195355 14:81476389-81476411 GCATATTTGTTATTTTAAAAGGG - Exonic
1120996968 14:90424371-90424393 GCACATGTGTTACTGGAAAGGGG + Intergenic
1121476034 14:94203940-94203962 GCAAATGAATGTTTGAAAAAGGG - Intronic
1122381084 14:101307704-101307726 TCAGCTGTGTTAATGAAAAAGGG + Intergenic
1123859660 15:24451121-24451143 GCAAATGTCTCAATCAAAAATGG - Intergenic
1125300478 15:38249755-38249777 ACAAATGCGTTGTTGAAAAAAGG + Intergenic
1126909059 15:53399264-53399286 GAAACTGTGTTATTGTAATAAGG + Intergenic
1127139842 15:55963645-55963667 GCATATGTTTTATTTTAAAAAGG + Intronic
1127440181 15:58999113-58999135 ACAAATATGTAGTTGAAAAAGGG - Intronic
1128413300 15:67420718-67420740 GCATATGTGTTCTTCAAACACGG + Intronic
1129415821 15:75378654-75378676 GCAAATGTGTAGCTGGAAAAAGG - Intronic
1129929794 15:79401118-79401140 GAAAATCTATTATTGAAGAAAGG - Intronic
1130617445 15:85425120-85425142 CCACATGTGTTTTGGAAAAATGG + Intronic
1130916604 15:88310051-88310073 GCAAACGTGTTCTTGAAAATTGG - Intergenic
1132174310 15:99697850-99697872 GAAAGTGTGATATTGACAAAAGG + Intronic
1132597011 16:757083-757105 GTAAAGCTGTTATTTAAAAATGG - Intronic
1133391722 16:5415711-5415733 GTAAATGTGTTTATGTAAAAAGG + Intergenic
1133735384 16:8611089-8611111 GCAAATGATTTATTGAGGAAGGG - Intergenic
1134294512 16:12933680-12933702 GCAAATCTGCTGTTGAAAATGGG + Intronic
1135642505 16:24133343-24133365 GCACATGTGTTATTTACACATGG - Intronic
1137307563 16:47218873-47218895 GCAAATGGGTATCTGAAAAATGG - Exonic
1138243773 16:55450564-55450586 GAAAATTTGTTATTGTAAGATGG + Intronic
1138848161 16:60592558-60592580 GCAAAGGTTTTATAAAAAAAAGG + Intergenic
1139084671 16:63570228-63570250 GCAACAGTGCTATTGAAAAGAGG - Intergenic
1140161340 16:72497759-72497781 GAAAATGTGATCTTGAAAGAAGG - Intergenic
1140394038 16:74611998-74612020 GCAAATGTGGTTCTGAAAGATGG - Intergenic
1141069412 16:80939681-80939703 TCAATTTTGTTCTTGAAAAAGGG + Intergenic
1142907984 17:3060343-3060365 ACAGATGTGTAATTGCAAAAGGG + Intergenic
1142926580 17:3243923-3243945 ACAGATGTGTAATTGCAAAAGGG - Intergenic
1143060324 17:4195261-4195283 AAAAATGTGTCATTGAAAAAGGG - Intronic
1146115076 17:30128826-30128848 ACAAATTTGTTATAGATAAAAGG + Intronic
1146560815 17:33868438-33868460 GCAAAAGTTTTAATGCAAAATGG + Intronic
1147020173 17:37525483-37525505 GCCAATGCCTGATTGAAAAAGGG - Intronic
1147349626 17:39830696-39830718 GCAAATATTTTATTGAAGATTGG - Intronic
1147908447 17:43839108-43839130 GGATATGTGTGATTTAAAAAAGG + Intergenic
1149269722 17:54965170-54965192 GGAAATGTGTTTTTTATAAATGG - Intronic
1150566633 17:66347355-66347377 ACATATATGTAATTGAAAAAAGG + Intronic
1151139468 17:71977614-71977636 GTAAATGAGATAATGAAAAAGGG - Intergenic
1154234755 18:12594140-12594162 GGAAATGTGTTATGGGCAAAAGG + Intronic
1155126446 18:22881275-22881297 GCAAATGTTCTAAAGAAAAATGG - Intronic
1155525493 18:26712447-26712469 GCAAATATGTTACTCAGAAAGGG + Intergenic
1155669284 18:28349532-28349554 GCATATGTGCTAATGGAAAAGGG + Intergenic
1155673215 18:28397092-28397114 GAAAATGTGTTTTTGATGAAAGG - Intergenic
1155768795 18:29671852-29671874 GCAGCTGTCTTATGGAAAAATGG + Intergenic
1156899194 18:42280839-42280861 GCAAATTTGTTTTACAAAAATGG + Intergenic
1157135210 18:45047517-45047539 GCAACTGTGTTAATGAGAAGGGG + Intronic
1158456499 18:57612740-57612762 GCAAATCTTTCATTGAAAAGTGG - Intronic
1158984931 18:62804408-62804430 CCAAATTAGTTTTTGAAAAAGGG - Intronic
1159058370 18:63489859-63489881 ACAAATTTGTTAAGGAAAAAGGG + Intronic
1159747684 18:72258754-72258776 CCAAATGTGTGATCTAAAAAGGG + Intergenic
1159999381 18:75002152-75002174 GCTTATGTGTTTTTAAAAAATGG + Intronic
1160494486 18:79364361-79364383 GACAATGTGTTATTGTCAAAAGG + Intronic
1162097168 19:8317100-8317122 GCTAAGGTGTTCTTGAATAATGG - Intronic
1163905200 19:20146342-20146364 GTAAATGAGTTATTAACAAATGG + Intergenic
1165603726 19:37080626-37080648 TCTATTGTGTTATTTAAAAAGGG + Intronic
925717441 2:6797339-6797361 GCAAATGTGTTATCAAAACAGGG + Intergenic
925767743 2:7253272-7253294 GCAAATGCTTTAGTGTAAAAAGG - Intergenic
926420263 2:12688996-12689018 TCAAATGGGTTATTGAATAAAGG - Intergenic
928275361 2:29895805-29895827 GCCGATGTGTTTTTGAAAAGAGG + Intronic
928373165 2:30755762-30755784 TCAGATGTGGTATTGTAAAATGG + Intronic
928780176 2:34808787-34808809 TCAAATGTGCAATTGAAAATTGG - Intergenic
929310734 2:40421394-40421416 GGAAATTTGTCATGGAAAAATGG + Intronic
929413825 2:41727163-41727185 GCCAATGTGTTATTGAAGTCAGG - Intergenic
930598425 2:53415520-53415542 GAAAATGTGTTATATAACAATGG - Intergenic
930665937 2:54098397-54098419 GGAAATGAGTTATAGAAAAAAGG - Intronic
932519119 2:72390464-72390486 GCAAATTTTTTATTGAATACTGG + Intronic
932882400 2:75515992-75516014 GCAAATGTGTTGCTGAAATAAGG + Intronic
933227671 2:79769287-79769309 GCATATTTGATCTTGAAAAATGG + Intronic
935206877 2:100903840-100903862 GGAAATGTGTGAATGAAGAAAGG + Intronic
935499668 2:103822942-103822964 GCAACTGTGTAATTTGAAAAGGG - Intergenic
935705479 2:105853020-105853042 GAAAATATGTTATTTAAAAATGG + Intronic
936601424 2:113899788-113899810 GCAAATATTTTACTGATAAAGGG + Intronic
936796962 2:116217921-116217943 GGAAATGTGTTTTTGAGAACTGG - Intergenic
938104927 2:128523480-128523502 GTAACTGTGTTGTTGACAAAGGG - Intergenic
938687308 2:133751626-133751648 GCACATGTGGTATTGAAATATGG - Intergenic
939075785 2:137601154-137601176 GTAAATTTATTATTGAAGAATGG + Intronic
939638220 2:144608654-144608676 TGAAATGTGTTTTTTAAAAAGGG + Intergenic
939816468 2:146903199-146903221 TCAAAATTGTTTTTGAAAAAAGG + Intergenic
940852052 2:158697332-158697354 GACAATGTGATATTGATAAAAGG + Intergenic
942384655 2:175429379-175429401 GAAAATTTGTTTTTGACAAATGG + Intergenic
942864273 2:180653462-180653484 GCTAATGTCTTATTGAAAGAAGG - Intergenic
943454113 2:188081471-188081493 GCAATTGTGGTATTAAGAAAAGG + Intergenic
945661905 2:212696755-212696777 GCAATTGTGTTTTTAAAAGAGGG + Intergenic
946533229 2:220596477-220596499 GACAATGTGGTATTGACAAATGG + Intergenic
946544137 2:220717852-220717874 TAAAATGTGTTATTTCAAAATGG + Intergenic
947041377 2:225924773-225924795 GCAAATGAGTGAGTGAAGAAAGG - Intergenic
947139675 2:227009395-227009417 GCAAATCTACTATTGAAAATTGG + Intronic
947293559 2:228604697-228604719 GCAAAAGTGACAGTGAAAAAGGG + Intergenic
947980784 2:234407785-234407807 ATAAATTTATTATTGAAAAAAGG + Intergenic
948022526 2:234747783-234747805 GAAAATGTGGTATTTAAACAAGG + Intergenic
948231624 2:236353068-236353090 GCCAATTTGCTAATGAAAAATGG + Intronic
948356634 2:237383286-237383308 GCAACTGTGTTATTGTATTAAGG - Intronic
948614659 2:239190763-239190785 ACTAATGTGCTATTGAGAAAAGG + Intronic
1169707509 20:8522271-8522293 GAAAATGATTTATTGAAGAAGGG - Intronic
1169812433 20:9621816-9621838 GCTAATGACTTATTGAAAAATGG + Intronic
1170063749 20:12288280-12288302 GCACTAGTGTTATTGAAAAGGGG - Intergenic
1170256945 20:14355663-14355685 GCAAATTTGAAATGGAAAAAAGG + Intronic
1170258810 20:14378862-14378884 GCAAATGTGTACTCTAAAAATGG - Intronic
1173015324 20:39220304-39220326 GCAATTGTTTTATGGAAAGAAGG + Intergenic
1173048076 20:39531843-39531865 GAAAGTGTGATATTTAAAAAGGG + Intergenic
1174118396 20:48243728-48243750 GGCATTGCGTTATTGAAAAATGG + Intergenic
1175661846 20:60820304-60820326 GGAAATGTGTGACTGAGAAAGGG + Intergenic
1177307885 21:19344058-19344080 TCAAACATGTTATTGAGAAATGG + Intergenic
1177619689 21:23571447-23571469 TAAAATTTGATATTGAAAAATGG - Intergenic
1178266799 21:31150696-31150718 CCAAAAGTGTGATTCAAAAAGGG + Intronic
1178444873 21:32630385-32630407 GGTAATGTGATATTGAAAAAGGG + Intronic
1179052999 21:37905176-37905198 GTAAATGAGTAATAGAAAAATGG - Intronic
1179281846 21:39940507-39940529 GCAAATGTGTCCTTGAGAAAGGG + Intergenic
1179357660 21:40675910-40675932 GTATATGTGTTCTTGTAAAATGG - Intronic
1180923437 22:19535231-19535253 GCAGATGTGTCTTTGATAAACGG - Intergenic
1181103812 22:20559820-20559842 GCAAAAGGCTTATTGGAAAAAGG - Intronic
1182521434 22:30886826-30886848 GCAGATGTGTTATAGGAAAGGGG + Intronic
1182700201 22:32230685-32230707 GCAACTCTTTTATTGACAAATGG + Intronic
1184024162 22:41841673-41841695 TCAAATTTGTAATTAAAAAAAGG + Intronic
1184461214 22:44639302-44639324 GGAAGTGTGTAATTTAAAAAAGG - Intergenic
949171901 3:1009963-1009985 AAAAATCTGTTATTGAAAAATGG - Intergenic
949264088 3:2136985-2137007 ACAAATGTCTTATTTAAGAACGG - Intronic
949559820 3:5190636-5190658 ACAGATGTGTTATTGGAAAGAGG + Intronic
949849221 3:8405145-8405167 GCAAATGTATTCTTATAAAAGGG + Intergenic
950461866 3:13128093-13128115 ATAATTGTGTTATTGAAAATAGG + Intergenic
952226782 3:31385511-31385533 GCAAATATGTACTTGGAAAAGGG - Intergenic
952341871 3:32454078-32454100 GGAAATGTATTTTTAAAAAATGG + Intronic
953490585 3:43347146-43347168 GCAAATGTGGTTTTGAAACATGG - Intronic
955187249 3:56726281-56726303 GCCAATGTGCTATTGAGAATTGG + Intergenic
956429796 3:69174832-69174854 GCAAATATATTATTAAAAAATGG + Intronic
956619318 3:71204983-71205005 GAAAATGTGGTATTGGAAGACGG - Intronic
958096854 3:88957071-88957093 TCAAATGTATTATAGATAAAGGG - Intergenic
959088407 3:101876278-101876300 GCAACTGTGGAAGTGAAAAAGGG + Intergenic
959253366 3:103976934-103976956 GGAAATGTTTTACTGATAAATGG - Intergenic
959545607 3:107592638-107592660 GCTCATGTTTTATTGATAAAAGG + Intronic
959692705 3:109216959-109216981 GCAGATGTGTTTTTGCACAATGG - Intergenic
960332546 3:116379845-116379867 GCAAATGTAGGATTGAAAGATGG + Intronic
960485538 3:118248460-118248482 GCAAATTTGTCATAGAGAAAAGG - Intergenic
962114449 3:132487619-132487641 GCAAGTGTTTTATAGAAAATTGG + Intronic
963287994 3:143455285-143455307 AAAAATGTGATATTGACAAAGGG - Intronic
963289363 3:143471995-143472017 GCAAATTTGTAATTGATTAAAGG - Intronic
963364762 3:144320952-144320974 GTACATGTGCTAATGAAAAAGGG - Intergenic
963381376 3:144534631-144534653 GCTAATGTGTGAGTGAAAGAAGG + Intergenic
963384280 3:144570717-144570739 GAAAAAGTTTTATTTAAAAATGG + Intergenic
964891809 3:161545506-161545528 CTAAATGTGTTAGGGAAAAAAGG - Intergenic
966087336 3:176084513-176084535 GCAAAAGTGTATTTGAAGAATGG - Intergenic
966556485 3:181267345-181267367 GCAAATGTGTTATTAGAACCTGG + Intergenic
966736412 3:183190433-183190455 GCAAATGTGTTATTGAAAAACGG + Intronic
967443070 3:189531344-189531366 GCAAATATGAAATTTAAAAAAGG - Intergenic
970486537 4:16530314-16530336 GCAAATGTCCTATTTGAAAAGGG - Intronic
970544107 4:17109151-17109173 CAAAATGTGTTGTTGAAAAATGG - Intergenic
970959174 4:21852985-21853007 GCAAAAGTGTTCTTCAACAAGGG - Intronic
971759205 4:30743315-30743337 TGAAATGTCTTATTGAAGAAAGG + Intronic
972052864 4:34762378-34762400 AAAAATGTGTTATTGGAATACGG - Intergenic
972318062 4:37946207-37946229 GTAATTTTGTTATAGAAAAATGG - Intronic
972848325 4:43017290-43017312 ACAATTGTATTATTGAAAAATGG - Intronic
973798710 4:54454761-54454783 TCAAATGTATTTTTGAAAGAAGG - Intergenic
975073828 4:70179215-70179237 ATAAATCTGTTATTTAAAAAAGG + Intergenic
975153163 4:71042993-71043015 CCATATTTGTTATTAAAAAATGG + Intergenic
975688655 4:76944340-76944362 ACTAATGTTTTAATGAAAAAAGG + Intergenic
975766058 4:77668823-77668845 AAAAATATGTTATTGAAAATGGG - Intergenic
976380351 4:84391637-84391659 GAAAATGTCTTAATCAAAAAGGG + Intergenic
976491071 4:85670962-85670984 CCAAGTGTGTGTTTGAAAAAAGG + Intronic
976857300 4:89619787-89619809 GCTAATGTCTTATTAAAAAGGGG + Intergenic
976941579 4:90708007-90708029 CCAAATCTGTCAATGAAAAATGG + Intronic
977665341 4:99640610-99640632 TCAAATGTGATTGTGAAAAATGG - Exonic
978315214 4:107427985-107428007 GCATATGTTTTATTCCAAAAGGG - Intergenic
978507035 4:109469658-109469680 GTAAATGTGTAAATGCAAAAAGG + Intronic
978888084 4:113789972-113789994 GCAATGGAGATATTGAAAAATGG - Intergenic
978913489 4:114095128-114095150 GTAAATGTGACATGGAAAAAAGG - Intergenic
979014010 4:115408827-115408849 GTCAAAGTGTTATTGAAAAGAGG + Intergenic
979614013 4:122721097-122721119 GCAAAAATATTATTCAAAAAAGG + Intergenic
981095213 4:140772254-140772276 GGGAATGTGTTGTTGAAAAAAGG + Intergenic
981319843 4:143379043-143379065 GAAAATGTGTTATGAAAAAAAGG + Intronic
981396574 4:144256567-144256589 TCAAGTGTGGTATTGACAAAAGG - Intergenic
981856089 4:149294668-149294690 GCAAGTGTTTTTTTGAATAAGGG - Intergenic
981886424 4:149678561-149678583 ACTAATGTGTTTTTAAAAAATGG + Intergenic
981908943 4:149955401-149955423 GCTAATGTGTTCTTGAAAAAAGG - Intergenic
982304731 4:153918787-153918809 GCAACTGTATTTTTGAAAAGGGG - Intergenic
982556909 4:156878467-156878489 CCATATGTGTTTTTGAACAAAGG - Intronic
982962342 4:161856287-161856309 GCAAATGTGTTTGTATAAAAGGG + Intronic
983624928 4:169792824-169792846 GCAAATGTTTCAAGGAAAAAAGG - Intergenic
983633527 4:169874898-169874920 TCAACTTTGTTATTGAAATATGG + Intergenic
983633998 4:169879475-169879497 GCAAATGTTTCAAGGAAAAAAGG + Intergenic
985827984 5:2206884-2206906 TGAAATGTGTTCTTGAACAATGG - Intergenic
986387931 5:7255417-7255439 CCAAATTTGTTATTTAATAATGG + Intergenic
986436092 5:7732705-7732727 CCTCATGTGTTTTTGAAAAAGGG + Intronic
986602747 5:9489668-9489690 ACAAAAGTGTTTTTGAAAAAGGG + Intronic
986981460 5:13452791-13452813 TCAAATGTCTTAATGAAATAAGG + Intergenic
987101952 5:14598860-14598882 ACAAATGTTTTTTAGAAAAATGG - Intronic
987865988 5:23539671-23539693 GCTAATGTATTATTAAGAAAAGG + Intergenic
988098597 5:26649440-26649462 TTAAATGTGCTATTTAAAAATGG + Intergenic
988342861 5:29997698-29997720 GCAAATGTTTTATATTAAAAAGG + Intergenic
988406942 5:30836042-30836064 GTAAATGTGTTATAAAAAAGAGG + Intergenic
988759882 5:34303142-34303164 ACAAATGTGGCATTGAAAAAAGG - Intergenic
989758502 5:44985165-44985187 GGAAACATGTTATTGAAAACTGG - Intergenic
990321581 5:54634711-54634733 GCAAATATGATGTTGAAATAGGG + Intergenic
990801061 5:59603766-59603788 GCAAGTGTGATATTGATCAAAGG + Intronic
992169623 5:74088971-74088993 GAAAATGGTGTATTGAAAAAGGG - Intergenic
992624355 5:78623746-78623768 ACATATGTGTTAATAAAAAATGG - Intronic
992949726 5:81846927-81846949 GCACATGTCTTCTTGGAAAATGG + Intergenic
993817167 5:92563969-92563991 GAAAATGTGCTATTAAAAATAGG + Intergenic
994129079 5:96204052-96204074 GACATTGTGTTATTGAAAAGGGG + Intergenic
995166288 5:109046162-109046184 GCAAATGGATAATTGAATAATGG - Intronic
995862216 5:116652783-116652805 GCAAATGTTTCCTTGGAAAAGGG - Intergenic
996172091 5:120306314-120306336 GCAGATGTGTTTTTAAAAAGGGG - Intergenic
996328180 5:122299798-122299820 GCCAATTTCTTATTTAAAAAGGG + Intergenic
996428563 5:123343546-123343568 GAAAATGGGTTATTGACACAAGG - Intergenic
997501645 5:134379686-134379708 ACAAATATGTACTTGAAAAAAGG - Intronic
997766024 5:136504132-136504154 GCAAAAGTGTTCTTGAATCAAGG + Intergenic
999418346 5:151419233-151419255 GCAAAGGTGTTATCGAAATATGG - Intergenic
1000441023 5:161263315-161263337 GCAAATGCATTATTTAAAACAGG + Intergenic
1000462431 5:161539114-161539136 GCAAATGTGTTGTTTTAAGATGG + Intronic
1001180263 5:169513705-169513727 GATATTGTGGTATTGAAAAAGGG + Intergenic
1002437911 5:179243755-179243777 GGAAATATGTCTTTGAAAAAAGG + Intronic
1003203138 6:3981466-3981488 GGAAATTTGTTTTTGAAGAATGG + Intergenic
1003808231 6:9750854-9750876 GCAGATGAGTAATTAAAAAAAGG + Intronic
1003809577 6:9765017-9765039 GGAAAGGTGATATTGCAAAAGGG - Intronic
1004491550 6:16121734-16121756 GAAAATGTTTTCTTGAAAAATGG - Intergenic
1004510922 6:16284123-16284145 TCAAATGTGTTATTCATACATGG - Intronic
1005271709 6:24172221-24172243 GCAAACATGTTACTAAAAAAAGG - Exonic
1006740280 6:36303035-36303057 GCAAATGAATTAGTAAAAAATGG - Intronic
1007071312 6:39040365-39040387 GCAATTGGGTCCTTGAAAAATGG + Intergenic
1007131268 6:39476353-39476375 GCAAATGTGCTCCTGAAGAATGG + Intronic
1010096131 6:72048669-72048691 GTAAAAATGTTAATGAAAAACGG + Intronic
1010118432 6:72342950-72342972 GCAAATGAGGTATTAACAAATGG + Intronic
1010876994 6:81118544-81118566 GCAAATATTATATTGAGAAAAGG - Intergenic
1011621052 6:89242932-89242954 GCAGATGTGGTGGTGAAAAAAGG + Intergenic
1011833270 6:91400008-91400030 GACAATGTGGTATTGAAAAAGGG - Intergenic
1011982334 6:93396583-93396605 GCATATGCGTTTTTGAAAAGTGG - Intronic
1013034529 6:106367623-106367645 GCAAAACTATTAATGAAAAAGGG - Intergenic
1013489198 6:110628848-110628870 GCAATGGTGTAATTAAAAAATGG - Intronic
1013750889 6:113404883-113404905 GAAAATGCGTTATTGGGAAAGGG + Intergenic
1014142331 6:117958313-117958335 GTCCATTTGTTATTGAAAAAAGG + Intronic
1014206249 6:118658829-118658851 GAAAATGTGCTTTAGAAAAACGG + Intronic
1014999728 6:128200312-128200334 GCAAATGAGTCATTTAAAAGGGG + Intronic
1015067512 6:129049098-129049120 GCTATACTGTTATTGAAAAAGGG + Intronic
1015464544 6:133534055-133534077 GCAAAGATGTAATTGAAGAAAGG + Intergenic
1015484254 6:133750160-133750182 ACAACTGTGATATTGAAGAAAGG + Intergenic
1015721191 6:136244120-136244142 GTTAATGTATTATTGAAGAAAGG + Intronic
1015937605 6:138418767-138418789 TCAAAGGTGACATTGAAAAACGG + Exonic
1016161719 6:140889813-140889835 AAAAATGTGTTTTTCAAAAAAGG - Intergenic
1018335428 6:162782708-162782730 GAAAATTTGTTATGGAAAAATGG + Intronic
1021399530 7:20193916-20193938 GCAAATGTTTTCTTTAAACATGG - Intronic
1022708690 7:32831694-32831716 TTAAATATGTTATTTAAAAAGGG + Intergenic
1022914365 7:34932975-34932997 TTAAAGGTGTTATTTAAAAAGGG - Intronic
1024278564 7:47699176-47699198 GCCAATGTGTAATTGTTAAATGG + Intronic
1025143515 7:56484675-56484697 CCAAATGGGTTGGTGAAAAATGG - Intergenic
1025710281 7:63901554-63901576 CCAAATGGGTTGGTGAAAAATGG - Intergenic
1026559600 7:71437368-71437390 GCAAATGTTTTAAAGAAATATGG - Intronic
1026866050 7:73824709-73824731 AAAAATTTGTTTTTGAAAAAGGG + Intronic
1027751415 7:82151722-82151744 CCAGATGTGTTATGGAACAAAGG + Intronic
1028920947 7:96309496-96309518 GCAAATGGATTATTAGAAAAAGG + Intronic
1028978554 7:96941244-96941266 GCACAGGTGTTATTCAAAGAAGG - Intergenic
1029190679 7:98769894-98769916 GCAAGTGTTTTATTAAGAAAAGG - Intergenic
1029466650 7:100729698-100729720 GCAAATTTTTTATAGAAACAGGG - Intergenic
1030580512 7:111349195-111349217 GCCAATATTTTAGTGAAAAATGG - Intronic
1031020881 7:116626228-116626250 CCAAATTTGTAATTGAAAAAAGG - Intergenic
1031789292 7:126079926-126079948 GCTATTTTGTTTTTGAAAAAGGG - Intergenic
1031822444 7:126520968-126520990 GAAAATGTTTTGTTGAAGAAAGG + Intronic
1032302237 7:130698125-130698147 GAAAATGTGTTAATGATATATGG + Intergenic
1032336753 7:131032057-131032079 GCAAATGTGGGTTTGAAAATTGG + Intergenic
1032372141 7:131367061-131367083 ACAAATGGGTAACTGAAAAATGG - Intronic
1032936676 7:136740271-136740293 GCAGATGATTTATTGAAAGATGG - Intergenic
1032992277 7:137406667-137406689 GCAAATATGTGCTTGATAAATGG + Intronic
1033451946 7:141469996-141470018 GGAAATGTCTTATAGGAAAAAGG + Intronic
1034500995 7:151450959-151450981 TCAAATGTGTTCTTGCAAAAAGG - Intergenic
1034550273 7:151815968-151815990 GCAAATGTGTTATTCAGGTAAGG + Intronic
1035857180 8:2988146-2988168 ACTAAAGTGTTAATGAAAAATGG - Intronic
1037005748 8:13777474-13777496 GCAAATACGTTATTGACAGATGG + Intergenic
1037020849 8:13968445-13968467 GCAAATGTGCAATTTAACAAGGG + Intergenic
1037126557 8:15358569-15358591 TAAAATGTTTTATTTAAAAATGG - Intergenic
1038064825 8:23952712-23952734 ACAAATTTGTTACAGAAAAAGGG + Intergenic
1038250032 8:25894837-25894859 GCAAATGTAGTATGGATAAAAGG + Intronic
1038536181 8:28354237-28354259 GCAGATGTGCTGTTTAAAAACGG - Intronic
1038809194 8:30822599-30822621 GCAAGTGTGTGGTAGAAAAAAGG - Intergenic
1039680154 8:39726024-39726046 ACATAGTTGTTATTGAAAAAAGG - Intronic
1041436011 8:57842467-57842489 AAAAATGTGTTATTTTAAAAAGG - Intergenic
1041501714 8:58545868-58545890 GGAAATGTGTTCTGGAACAAAGG + Intergenic
1042058549 8:64792065-64792087 AGGAATGTGTTATTGGAAAATGG + Intronic
1043637678 8:82406774-82406796 CCAAATAAGTTTTTGAAAAAGGG - Intergenic
1043696714 8:83228868-83228890 GGAAATGTGTTATTAGAATAAGG - Intergenic
1043709541 8:83397953-83397975 GTAAATGTGATAATGAAACACGG - Intergenic
1045171170 8:99670400-99670422 ATAAATGTGTCATTGAGAAATGG + Intronic
1045230654 8:100303460-100303482 GCAAATGTTATTTGGAAAAAGGG - Intronic
1046179420 8:110624278-110624300 GCAAATGTGCTGATGAAGAAAGG - Intergenic
1046235116 8:111414080-111414102 GCAAAAGTGGTGTTAAAAAAAGG - Intergenic
1047946380 8:129884993-129885015 TCAAATGTTTTATGGGAAAATGG - Intronic
1048089874 8:131228056-131228078 GAAAATGTGATTTTAAAAAATGG - Intergenic
1048169059 8:132087676-132087698 GTAAATGTGTAATTGATAATGGG + Exonic
1048221637 8:132547383-132547405 GCAAATATTTTGATGAAAAAAGG + Intergenic
1049227233 8:141461221-141461243 ACAAATATGTAACTGAAAAATGG + Intergenic
1051778644 9:20663781-20663803 GAAAATGTGTTTTAGAGAAATGG - Intronic
1052397935 9:27963758-27963780 GCAAAGGTTTTAATGAATAATGG + Intronic
1052664882 9:31483398-31483420 GAAAGTGTGTTATTCAAATATGG - Intergenic
1053161610 9:35817392-35817414 GCAAATGACAGATTGAAAAAGGG - Exonic
1053197166 9:36128214-36128236 GCAAATGTGGGCTTGATAAAGGG - Intergenic
1055674527 9:78642284-78642306 GCAAATGTATTATTGGTCAAAGG + Intergenic
1056052465 9:82783714-82783736 AGAAATGTGTTATTGGAAACTGG - Intergenic
1056281059 9:85041537-85041559 GCAAATGTGTCACTGACAAGAGG + Intergenic
1056370699 9:85951377-85951399 CCAAATATGTAGTTGAAAAATGG + Intronic
1056517468 9:87368789-87368811 GAAAATATGTTTTTTAAAAAGGG - Intergenic
1056689501 9:88794666-88794688 GGACATGTTTTATTGAATAATGG - Intergenic
1056797592 9:89669423-89669445 CCAAATGAGTTATGGAACAATGG + Intergenic
1057114505 9:92507806-92507828 GCACACGTGTTATGGAGAAAGGG - Intronic
1057328184 9:94086117-94086139 ACAAATATCTAATTGAAAAATGG - Intronic
1057438379 9:95063259-95063281 GGAAATGTGTTACTTAAAAAGGG - Intronic
1058158562 9:101542730-101542752 ACAATTGTTTTATTTAAAAAGGG + Intronic
1059377457 9:113895871-113895893 GCCAAAATGTTATTGAAGAAAGG - Intronic
1060051149 9:120379317-120379339 GGAAATGTGTTATGGCAAAAGGG - Intergenic
1060482372 9:124024169-124024191 GCAAATGTGGTCTGGGAAAAAGG - Intronic
1060673411 9:125490668-125490690 ACAGATATGTTGTTGAAAAAGGG - Intronic
1186218477 X:7325169-7325191 GTATATGTTGTATTGAAAAAAGG - Intronic
1188346540 X:29073437-29073459 CTAAATGTCTTAATGAAAAACGG - Intronic
1188576120 X:31652230-31652252 GAAAATGTGGTAATCAAAAAAGG - Intronic
1189320808 X:40086043-40086065 GCAAATGTGCTCTTGAAAACGGG + Intronic
1189370029 X:40420594-40420616 TTTAATGTGTTAATGAAAAATGG + Intergenic
1191834454 X:65449100-65449122 GAAAATGTGTTATGGACACATGG + Intronic
1193551183 X:82894537-82894559 GCAAGGGTGTTATTTGAAAAAGG + Intergenic
1193826606 X:86234013-86234035 GGAAATGCTTTATTGGAAAATGG + Intronic
1194491496 X:94555494-94555516 ACAAATGTGTTTTTAACAAAAGG - Intergenic
1194911717 X:99653372-99653394 GCAGATGGCTTATTGCAAAATGG + Intergenic
1196764995 X:119235553-119235575 GCAAATCAGTAATTGCAAAAGGG + Intergenic
1196991401 X:121332821-121332843 GAAAATGAGTGACTGAAAAATGG - Intergenic
1197634747 X:128902517-128902539 GAAAATGTGTTCTTGTAAAAGGG - Intergenic
1197880906 X:131165292-131165314 GGAAATGTGTTATTAATCAAAGG + Intergenic
1197960322 X:131997647-131997669 TCAGATGTGTTATGTAAAAATGG + Intergenic
1198730909 X:139727430-139727452 GCAAATGAAATAATGAAAAAGGG + Exonic
1199833331 X:151564535-151564557 GAAAATGTGTTTTTTCAAAATGG + Intronic