ID: 966736962

View in Genome Browser
Species Human (GRCh38)
Location 3:183194522-183194544
Sequence TGCCCACTCAGTAAAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966736959_966736962 6 Left 966736959 3:183194493-183194515 CCGGAGGAGGTAACATCAGAGGG 0: 1
1: 0
2: 2
3: 19
4: 173
Right 966736962 3:183194522-183194544 TGCCCACTCAGTAAAGTAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 95
966736957_966736962 18 Left 966736957 3:183194481-183194503 CCAGAGGGGAAGCCGGAGGAGGT 0: 1
1: 0
2: 0
3: 13
4: 238
Right 966736962 3:183194522-183194544 TGCCCACTCAGTAAAGTAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966736962 Original CRISPR TGCCCACTCAGTAAAGTAGG AGG Intronic
900731776 1:4266702-4266724 TGCCCCCTTAGTATATTAGGAGG - Intergenic
903014658 1:20354076-20354098 CTCCCACTCAGTGAAGTAGGAGG - Exonic
905596808 1:39214641-39214663 GGGCTACTCTGTAAAGTAGGTGG + Intronic
905976768 1:42181195-42181217 TGGCCACTCACTAAACTGGGTGG + Intronic
908831170 1:68179989-68180011 TGCCCATTCAGTAGAGGTGGTGG + Intronic
916570409 1:166020944-166020966 TGAAGACTCAGTAAAGTAGTAGG + Intergenic
917019755 1:170573254-170573276 TGCCCACTCAGTATAATATTGGG - Intergenic
1063515848 10:6694508-6694530 TTCCCATTCAGTAAGCTAGGAGG + Intergenic
1065062239 10:21914787-21914809 TGCCCACTTTGTATACTAGGTGG - Intronic
1065166849 10:22988476-22988498 CTCCCATTCAGTAAAGTTGGTGG + Intronic
1065536855 10:26723249-26723271 AGTCCACTCAGTGAAGAAGGGGG + Intronic
1071717426 10:88111519-88111541 TGGCCAGTCAGTAAAGCATGAGG - Intergenic
1072154873 10:92715112-92715134 TGCCTGCTCAGTAGAGCAGGAGG + Intergenic
1077465788 11:2733082-2733104 TTCCCCCTCTGTAAAATAGGAGG + Intronic
1077903275 11:6507708-6507730 GGCCCACTGATTAAAGGAGGGGG + Intronic
1078366256 11:10708827-10708849 TGCCCAGTCACAAAAGTAGAAGG + Intergenic
1080318662 11:30980268-30980290 TGCCCACTGAGTGAAGCAGGAGG - Intronic
1085403798 11:76249904-76249926 TGCCAACTCAGTAGAGTGCGGGG - Intergenic
1088028422 11:105215808-105215830 TGCCTAGTCAGAAAAGTAAGTGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093994419 12:25625986-25626008 TTTCCATTCAGTAAAGGAGGAGG - Intronic
1098354575 12:69599736-69599758 TACCTACTGAGTAAAGTAGTTGG + Intronic
1101036549 12:100713203-100713225 GGCAGACTGAGTAAAGTAGGTGG - Intergenic
1101764119 12:107682715-107682737 TGCCTGCTCTGTAAAGCAGGAGG + Intergenic
1102701432 12:114842828-114842850 TGCTCACAAACTAAAGTAGGTGG - Intergenic
1105783452 13:23724371-23724393 AGCCGACTCAGTAAAGCAGATGG - Intergenic
1105957883 13:25301239-25301261 TCCCCACTCAGAAAAGGAGGCGG - Intergenic
1110123625 13:71913693-71913715 AGCCACCTCAGTAAAGTTGGAGG - Intergenic
1110242394 13:73283566-73283588 TCAGCATTCAGTAAAGTAGGGGG + Intergenic
1112564171 13:100538095-100538117 TCTCAACTCTGTAAAGTAGGTGG + Intronic
1113339052 13:109404437-109404459 TGCCTACTCTGTAGAGCAGGAGG - Intergenic
1114922121 14:27344643-27344665 TGCCAGCTCAGTAAAGTAGAGGG - Intergenic
1116320392 14:43454657-43454679 TGCCCAAACAGTAAAGACGGAGG - Intergenic
1118005910 14:61564037-61564059 TTCCTCCTCAGTAAAGTAGATGG + Intronic
1119040213 14:71267975-71267997 TGACTACCCTGTAAAGTAGGTGG - Intergenic
1128080888 15:64856222-64856244 TGCCCACTCAGGAAGGAAGTGGG - Intronic
1129784927 15:78303889-78303911 TGCCTGCTCCGTAAAGCAGGAGG - Intergenic
1130921377 15:88347886-88347908 TGGACACTCAGTAAAATAGGTGG + Intergenic
1137282854 16:46992774-46992796 TGCCTGCTCAGTAGAGCAGGAGG + Intergenic
1140885415 16:79238447-79238469 TGACCACACAGTAAAGAAAGTGG + Intergenic
1149169352 17:53791720-53791742 TGCCAACTCAGTAGGGTATGGGG - Intergenic
1150066277 17:62112014-62112036 TGCCCACTCAGTAAGTTGAGTGG + Intergenic
1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG + Intergenic
1165220302 19:34310845-34310867 TGCGCTCTCAGTTAGGTAGGAGG - Intronic
927873876 2:26641430-26641452 TGCCAACTCAGTAACTCAGGTGG - Intergenic
929600937 2:43204194-43204216 TGCCCCCTGAGTAAAGGAGCTGG + Intergenic
930585960 2:53267607-53267629 TGCCCAAACAGCAAAGTTGGTGG - Intergenic
930686139 2:54310502-54310524 AGCCCACTCAGTGGAGAAGGAGG - Intergenic
930877120 2:56231846-56231868 AGCTGTCTCAGTAAAGTAGGGGG - Intronic
931528125 2:63181000-63181022 TGCCCATTCAGTAGTGTAGGAGG + Intronic
937951504 2:127391347-127391369 CTCCCACACAGTAAAGAAGGGGG + Intergenic
941441627 2:165544968-165544990 GGACCAATCAGTGAAGTAGGAGG + Intronic
948575560 2:238947294-238947316 TGCCTACTCAGTGGAGCAGGAGG + Intergenic
1169084924 20:2820768-2820790 TGGCCACTCAGGAAAGGAGAGGG + Intergenic
1176020147 20:62958612-62958634 TGCCGGCTCAGGAAGGTAGGGGG - Intronic
1177251713 21:18600019-18600041 TGAAAACTTAGTAAAGTAGGAGG + Intergenic
953820822 3:46206091-46206113 ATGCCAATCAGTAAAGTAGGTGG + Intronic
961781514 3:129323440-129323462 TTCCCCATCTGTAAAGTAGGGGG - Intergenic
966736962 3:183194522-183194544 TGCCCACTCAGTAAAGTAGGAGG + Intronic
967043588 3:185716597-185716619 TGCCCCCGAAGAAAAGTAGGAGG - Exonic
967915926 3:194578181-194578203 TTCCCACCCCGTGAAGTAGGAGG + Intergenic
969613115 4:8237912-8237934 TGGCCTCTCGGTAAAGAAGGGGG + Intronic
971168617 4:24210197-24210219 TGCCAACTTTGTAAAGTAGGTGG - Intergenic
975023473 4:69520398-69520420 TGCCAACTCAGAAAAGGATGGGG - Intronic
982086679 4:151842730-151842752 TGCCCACTCAGAGAAGCAGATGG - Intergenic
984513985 4:180715686-180715708 TGGCCACCCACTCAAGTAGGAGG + Intergenic
986331717 5:6721224-6721246 TGCCAACTCAGGAGAGCAGGTGG + Intronic
988452883 5:31361195-31361217 TGCCCTCCCAGGAAAGTGGGAGG - Intergenic
988681507 5:33488715-33488737 AGCCCACTGAGTCGAGTAGGCGG - Intergenic
988702144 5:33686068-33686090 TCCCCACCCAGCAAAATAGGAGG - Intronic
990314496 5:54571279-54571301 TGTCCACTCTGTAAATTACGAGG + Intergenic
992725517 5:79603330-79603352 TGCCCACTGAGTAAACTGGAGGG - Intergenic
996711777 5:126550651-126550673 TGCCCAATCTGTAAATTGGGAGG - Intronic
999859819 5:155633461-155633483 TGCCCACTCCACAAAGTGGGAGG - Intergenic
1001445890 5:171782627-171782649 TGCCGAATGAGTAAAGCAGGTGG - Intergenic
1001514509 5:172346038-172346060 CACCCACCCAGTGAAGTAGGAGG + Intronic
1006229740 6:32574292-32574314 TGCCAACTAAGTCAAGAAGGTGG + Intronic
1006867729 6:37222555-37222577 TGCCTGCTCAGTGAAGTGGGAGG + Intronic
1012547197 6:100433296-100433318 TGGCCACTGAGTAAGGGAGGGGG - Intronic
1013749221 6:113383201-113383223 TGCACACTGAGTAACATAGGCGG - Intergenic
1015762355 6:136677941-136677963 TGACAACTCTTTAAAGTAGGGGG + Intronic
1021514013 7:21463212-21463234 TGACTTCTCAGTAAATTAGGAGG + Intronic
1024445335 7:49471116-49471138 TCTCCACTCAGTAAAATGGGTGG + Intergenic
1029856141 7:103518747-103518769 AGCATATTCAGTAAAGTAGGAGG - Intronic
1038135111 8:24777015-24777037 TGCACACCCAGAAAAGTAGCTGG + Intergenic
1043812228 8:84754721-84754743 TCCCCATTCAGTAAAAGAGGAGG - Intronic
1044084197 8:87923721-87923743 TACACACTGAGTAAAGAAGGAGG + Intergenic
1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG + Intergenic
1052111657 9:24592595-24592617 TGCCCACTCAGTTATGTTGTTGG - Intergenic
1052466036 9:28830503-28830525 TGGCCACTCAATAAAGTACAGGG + Intergenic
1055448921 9:76412825-76412847 TGCACAATCAGTGCAGTAGGGGG - Intergenic
1056703519 9:88931960-88931982 TGCTCCCTCAGAAAAGTTGGGGG - Intergenic
1061386365 9:130292411-130292433 TGCCCACTCATAAATGTGGGAGG - Intronic
1186942344 X:14523710-14523732 TGGCCAGTCAGTAGAGTAGTCGG + Intergenic
1190445004 X:50515199-50515221 TGCCCATTCTGTAGAGCAGGAGG + Intergenic
1190875269 X:54455754-54455776 TGGGCACGCAGTAAAGGAGGCGG + Exonic
1193892066 X:87060740-87060762 TGGGCACTCAGTAAAGCAAGTGG + Intergenic
1195554147 X:106202016-106202038 TGCCAACTCAATAAATTAGCAGG - Intronic
1196421386 X:115525601-115525623 TCCTCATTTAGTAAAGTAGGTGG - Intergenic
1200899597 Y:8416261-8416283 TCCCCACCCAGTAAAGCAGTGGG + Intergenic
1200905852 Y:8481292-8481314 TCCCCACTCAGTAAAGCAGTGGG - Intergenic
1201522376 Y:14889685-14889707 TTCCCACTCAGTATGGTATGTGG + Intergenic
1202256833 Y:22929890-22929912 TTCCCACTCAATAAAGCAGTGGG - Intergenic
1202409825 Y:24563643-24563665 TTCCCACTCAATAAAGCAGTGGG - Intergenic
1202460958 Y:25106434-25106456 TTCCCACTCAATAAAGCAGTGGG + Intergenic