ID: 966739992

View in Genome Browser
Species Human (GRCh38)
Location 3:183223697-183223719
Sequence CAAGTTCACTAGAAGACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966739990_966739992 -2 Left 966739990 3:183223676-183223698 CCATTTATTTCTTTTAGAAAGCA 0: 1
1: 0
2: 8
3: 91
4: 899
Right 966739992 3:183223697-183223719 CAAGTTCACTAGAAGACAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966739992 Original CRISPR CAAGTTCACTAGAAGACAGT GGG Intronic
903088469 1:20886017-20886039 CAATTTCAAGAGAAAACAGTAGG + Intronic
906005947 1:42470380-42470402 CAGCTGCAGTAGAAGACAGTAGG + Intronic
906154184 1:43604519-43604541 CATGTTCACTAGAGGTCGGTGGG - Intronic
907708002 1:56849359-56849381 AAAGCTCACTAGAAGTCAGTTGG - Intergenic
910293728 1:85623636-85623658 CAAGTCCATTAGATTACAGTAGG + Intergenic
911976160 1:104498054-104498076 CAGGTTCCCTAAAAGTCAGTTGG - Intergenic
912233827 1:107826583-107826605 GCAGTTCACTGGCAGACAGTTGG + Intronic
912259456 1:108095802-108095824 CCAGTTATCTAGTAGACAGTAGG + Intergenic
915891458 1:159777892-159777914 CAAGTGCAAAAGAAGTCAGTGGG - Intergenic
917651027 1:177077684-177077706 AAGGTTCATGAGAAGACAGTAGG + Intronic
920809277 1:209267195-209267217 GAAGTTCACTAGAAAATATTAGG - Intergenic
920881117 1:209881315-209881337 CATGTTCCCTGGAAGACAGTAGG + Intergenic
923160950 1:231314131-231314153 CAAGTGCCCTAGAATACACTGGG + Intergenic
1064560307 10:16589040-16589062 GGACTTCACTGGAAGACAGTGGG + Intergenic
1068633580 10:59323415-59323437 TAAGGTCACTGGAAGACACTCGG + Intronic
1070695960 10:78563282-78563304 CAAGTTCCCTGAAGGACAGTGGG - Intergenic
1074074146 10:110105506-110105528 CAAGTTCAGTAGGAGCCTGTTGG - Intronic
1075250890 10:120871524-120871546 CCAATTCAATATAAGACAGTTGG - Intronic
1078882110 11:15462350-15462372 AATAATCACTAGAAGACAGTGGG - Intergenic
1082225623 11:49703272-49703294 CCAGTTCACCACAAGGCAGTAGG - Intergenic
1086890636 11:92254198-92254220 CAATTTCAATAGATGACAGAAGG - Intergenic
1092159149 12:6306238-6306260 GAAGGTGACTAGAAGACAATCGG - Intergenic
1092438573 12:8475251-8475273 CAATTTCACTGAAAAACAGTAGG + Intronic
1093237745 12:16631866-16631888 CTACTTCAGTGGAAGACAGTAGG + Intergenic
1095269100 12:40195372-40195394 CAAGTACAATATAAGACAGGAGG + Intergenic
1096227217 12:49873891-49873913 CAAGTTCTCTGGAATATAGTAGG - Intronic
1101897285 12:108766202-108766224 CATGGTCCCTAGAACACAGTAGG - Intergenic
1102863229 12:116354395-116354417 CAAGATACCTAGAAGGCAGTAGG - Intergenic
1105346018 13:19573419-19573441 CAATTTGGCTAGAACACAGTGGG - Intergenic
1106329388 13:28725448-28725470 CAAGTTCAAGAGAAGAGGGTGGG - Intergenic
1106907969 13:34429101-34429123 CTGGCTCACTAGAAGACAGCTGG + Intergenic
1107478562 13:40764837-40764859 CGATTTGACTAGAACACAGTGGG - Intronic
1107669243 13:42726894-42726916 AAAGATCACTAGAAGATACTGGG - Intergenic
1112965544 13:105187609-105187631 CACCTTCATTATAAGACAGTTGG - Intergenic
1113374053 13:109747457-109747479 TAGGTTCACTAAAACACAGTAGG + Intergenic
1115108546 14:29791041-29791063 CCAGGTGACTAAAAGACAGTAGG + Intronic
1116910451 14:50457900-50457922 CCAGTGTACTAAAAGACAGTGGG - Intronic
1120549485 14:85851879-85851901 CTAGTTTAATAGAAGACAGCTGG + Intergenic
1122257884 14:100492408-100492430 CAAGCTCAGTGGATGACAGTGGG + Intronic
1124426094 15:29564422-29564444 CAAGTTAAGCAGAAGACAGATGG - Intronic
1130024386 15:80258951-80258973 GAAATTCACAAGAAGCCAGTTGG + Intergenic
1138119832 16:54391074-54391096 CAAGTTCAGTAGAAGGCCTTGGG + Intergenic
1143383535 17:6510948-6510970 CCATTTGACTAGGAGACAGTGGG + Intronic
1153282858 18:3430287-3430309 CTGGTTTAATAGAAGACAGTTGG - Intronic
1155296384 18:24388297-24388319 CAAGGTGCCTAGAACACAGTAGG + Intronic
1158100714 18:53827016-53827038 CTAGTTCACTACAAGCAAGTAGG + Intergenic
1158267588 18:55677310-55677332 CCAGTTCTATAGAAGACAGAGGG - Intergenic
1167146327 19:47682289-47682311 CATGATCACTAGGAGACACTTGG - Intronic
1168095623 19:54113216-54113238 CAAGTTCAAATGAAGCCAGTGGG + Intronic
926961966 2:18366934-18366956 AAAGTTGAGTAGAAGACAGAAGG - Intergenic
930807185 2:55502851-55502873 AAATTTGACTAGAAGCCAGTCGG - Intergenic
932473808 2:71986763-71986785 CAAGTTAACTAAAAGAAAGTTGG + Intergenic
936273076 2:111067427-111067449 CAAATACATTAGAAAACAGTAGG + Intronic
939177159 2:138761691-138761713 AAAGTTCACTAAAATAAAGTTGG + Intronic
940240852 2:151561803-151561825 CAAGTTAACTTGCAGAGAGTAGG - Intronic
941771687 2:169352080-169352102 CAGCTTCTCTAGAAGCCAGTGGG + Intronic
942210957 2:173669585-173669607 CAAATTCACTGGAAAACAGGTGG + Intergenic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
946035088 2:216735425-216735447 CCAGTTTAATAGAAGACAGCTGG - Intergenic
946072416 2:217045885-217045907 CAAGTTGCTTAGAAGAGAGTTGG - Intergenic
947821782 2:233076927-233076949 CAACTTCATTGGAAGACAGTTGG + Intronic
948652445 2:239456942-239456964 AAATTTCACATGAAGACAGTGGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1181918678 22:26301908-26301930 CAAGGTCATGAGAAGACAGGTGG + Intronic
949553964 3:5136192-5136214 CAAGTTCACTTGAACCCAGGAGG - Intronic
953768740 3:45763128-45763150 CCAGTTCTCTACAGGACAGTGGG + Intronic
955747963 3:62158655-62158677 CAGGTTCCCTAGAAGAAGGTAGG + Intronic
957858240 3:85907506-85907528 CAAGTTCAATAGACCACACTGGG - Intronic
964513251 3:157476783-157476805 CATGCCCATTAGAAGACAGTAGG + Intronic
965470611 3:169085701-169085723 CAAGTTGATTAGAACACTGTTGG - Intronic
966739992 3:183223697-183223719 CAAGTTCACTAGAAGACAGTGGG + Intronic
968241233 3:197088133-197088155 GGATTTAACTAGAAGACAGTGGG - Intronic
970373285 4:15430707-15430729 CAAGTTCACTGCAAGGCAGTGGG + Intronic
971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG + Intronic
971779330 4:31011117-31011139 CAAGGTAAATAGCAGACAGTAGG + Intronic
972919333 4:43918998-43919020 AAGCTTCACTAGAAGACAGATGG - Intergenic
973793538 4:54400306-54400328 CAATTTCACTTGAAGACTCTGGG + Intergenic
981066496 4:140491793-140491815 CAATTTCTCTGGAAGACACTTGG - Intronic
984239152 4:177196336-177196358 CCAGGACACTAGAAGAGAGTAGG + Intergenic
984319815 4:178179689-178179711 CATATTCACTAGAACAAAGTTGG + Intergenic
985865648 5:2512054-2512076 CCTGTTCACTGGAGGACAGTAGG - Intergenic
986791081 5:11161291-11161313 CAAATTCACTAAAGCACAGTTGG - Intronic
989772490 5:45161401-45161423 CAAGGTGACCAGAAGACAGTGGG - Intergenic
990964237 5:61427831-61427853 CATATACACTAGAATACAGTTGG - Intronic
991952638 5:71961442-71961464 CATGTTCCCTAGAAGATAATTGG - Intergenic
993525789 5:88964048-88964070 CAAGACAACTAGAACACAGTTGG + Intergenic
993978658 5:94514747-94514769 CAAGATCACTATTAGAAAGTAGG - Intronic
994065438 5:95535090-95535112 CCAGTACACTAGGTGACAGTAGG - Intronic
995123015 5:108555193-108555215 TAAGTTCACTAGCAAACAGTGGG - Intergenic
996705361 5:126492276-126492298 CAAATGCATTAGAAGACAATGGG - Intronic
998336927 5:141381489-141381511 CAATTACACTAGAATAGAGTAGG + Intronic
1003005650 6:2378582-2378604 CAAGTTCCCTAGCAGAGAGTAGG - Intergenic
1005870354 6:29970791-29970813 CAGGTTCACTAGAGGACACAGGG + Intergenic
1007600611 6:43078470-43078492 GGATTTCACTAGAAGACAGCAGG - Intronic
1008858251 6:56116996-56117018 CATCTTCACTAGAGGACAATAGG + Intronic
1012929765 6:105304631-105304653 CAAGGTACCCAGAAGACAGTAGG + Intronic
1014744839 6:125188636-125188658 AAAGTAGACTAGAAGAGAGTAGG - Intronic
1016382666 6:143500693-143500715 CAAGACCCCTAGAAGACAGGAGG + Intronic
1018474033 6:164122655-164122677 CAAGTTCAAATGAAGTCAGTGGG + Intergenic
1020937593 7:14486593-14486615 CAACTCCACTAGAAGAAAGAGGG + Intronic
1021068890 7:16212452-16212474 AAAGTACAGTGGAAGACAGTGGG - Intronic
1023255189 7:38306037-38306059 CAAGTTCACAAGAACAGAGAGGG + Intergenic
1023865896 7:44238302-44238324 CACGTTCACTTGCAGACAGGCGG + Intronic
1028279756 7:88907770-88907792 CAAGTTTGGTAGAAGACAATTGG - Intronic
1030133065 7:106219498-106219520 CCAGTTCCCAGGAAGACAGTAGG + Intergenic
1032749595 7:134825243-134825265 CAAGTTTATTAGAAAACAGATGG + Intronic
1033104045 7:138503098-138503120 GATGTTCACTAGAAATCAGTGGG - Intronic
1035562753 8:618568-618590 CAAGGTCTCTGAAAGACAGTGGG - Intronic
1037268322 8:17094518-17094540 CTAGCTTACTAGAAGACAGCTGG + Intronic
1038305204 8:26394624-26394646 CAAGCTTAATAGAAGACAGCTGG + Intronic
1047154910 8:122306063-122306085 CCAATTCAATAGCAGACAGTTGG + Intergenic
1047324380 8:123822128-123822150 TTGGTTCACTAGAAGACAGCTGG - Intergenic
1050161549 9:2724777-2724799 GAACATAACTAGAAGACAGTGGG + Intronic
1052436924 9:28441937-28441959 CATGTACAATAGAAAACAGTGGG - Intronic
1056133897 9:83611975-83611997 CCAGTTCACTAGAGGACATTTGG + Intergenic
1059255594 9:112927994-112928016 TAAATTCACTAGAAGAAACTGGG - Intergenic
1185871510 X:3668661-3668683 CAAGTTCTGTAGAAGAAAGCTGG + Intronic
1188734980 X:33702154-33702176 CCATTTCAATAGAAGACAGGAGG + Intergenic
1189077098 X:37927829-37927851 CAAGTACACGATAAGACAGAAGG - Intronic
1189708618 X:43785352-43785374 CAACTTCAATTGAAGAGAGTTGG + Intronic
1195535841 X:106008482-106008504 CAAGTTTCCAAGAAGCCAGTTGG - Intergenic
1196832483 X:119786982-119787004 CAAGTACACTTGGAGAGAGTGGG - Intronic