ID: 966745490

View in Genome Browser
Species Human (GRCh38)
Location 3:183271508-183271530
Sequence CTCTAACACCAGTAGCTACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966745490 Original CRISPR CTCTAACACCAGTAGCTACA TGG (reversed) Exonic
905004411 1:34698359-34698381 CTCTGACACCTGTATCTAGAAGG - Intergenic
912379514 1:109239797-109239819 CTCCTACACCAGTCCCTACACGG - Intergenic
917173958 1:172210478-172210500 TTCTAACACCAGGAGCTGTATGG + Intronic
917343926 1:174009017-174009039 CTCTAACATTAGCAGCTACTTGG - Intronic
917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG + Intronic
917456562 1:175191057-175191079 TTGTAATAGCAGTAGCTACAGGG - Intronic
918708008 1:187692468-187692490 ATCTATCAACAGTGGCTACAGGG + Intergenic
922079989 1:222286376-222286398 CTCTCCCAACAGTTGCTACAAGG + Intergenic
924165235 1:241274460-241274482 CTCTAACACAACTATGTACATGG + Intronic
1065015167 10:21456064-21456086 CTCTAACACCAGCCGATACCTGG - Intergenic
1067151631 10:43739891-43739913 CTGTATCGGCAGTAGCTACAAGG - Intergenic
1073429535 10:103477183-103477205 CTCTAACACCCCTACCCACAAGG + Intronic
1073546015 10:104349608-104349630 CCCTAACACCAGTGGAGACAGGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1090633563 11:128671690-128671712 CACTAACACTAATACCTACATGG + Intergenic
1091975918 12:4825062-4825084 CTCAAACACAAGTAGCTTGAAGG - Intronic
1095825792 12:46530329-46530351 CTATCACACCAGTGGCTGCAGGG + Intergenic
1098519265 12:71417310-71417332 CTCTAACAGCTGGAGCAACAGGG - Intronic
1102003179 12:109571372-109571394 CTGTAACCCCAGCAGCTACTTGG - Intronic
1102201125 12:111058677-111058699 CTGTAACACCACTATCTGCAAGG - Intronic
1104134015 12:125920302-125920324 CTCTAACACAATTGGCTGCAGGG - Intergenic
1107452436 13:40522033-40522055 CTCTTCCCCCAGTAGCCACATGG + Intergenic
1107925823 13:45260904-45260926 CTCGAACTCCAGGAACTACAGGG - Intronic
1115762173 14:36585394-36585416 TTCTAGAACCAGGAGCTACAGGG - Intergenic
1121397970 14:93643795-93643817 CACAAATACCAGTATCTACAAGG - Intronic
1126377964 15:48015129-48015151 TTCCAACTCCAGTAGCTATAAGG + Intergenic
1129889866 15:79064929-79064951 CTCTAACCCCAGGACCTAGAAGG - Intronic
1133587648 16:7211493-7211515 CTCTATCACTAGTAAATACAGGG + Intronic
1147924676 17:43939021-43939043 CTCTCACAGCAGAAACTACAGGG - Intergenic
1148721894 17:49759605-49759627 TTCTGGCACCAGTAGCCACACGG + Intronic
1151012016 17:70510511-70510533 GCCTAACACCAGAAGCCACATGG - Intergenic
1151298168 17:73201132-73201154 CTCCATCTCCAGTAGCTCCAAGG + Exonic
1158713063 18:59854321-59854343 CTCAAACACCAGAATCAACAGGG + Intergenic
1159284189 18:66327906-66327928 CTCCAACACCATTGGCTACCTGG - Intergenic
1163130759 19:15271441-15271463 TTCCAACATCAGAAGCTACAGGG - Intronic
1163529790 19:17842603-17842625 CTCCAACCCCTGCAGCTACAAGG - Exonic
1164024383 19:21337859-21337881 CTGTTATACCAGTAGCTAAAAGG - Intergenic
1168133903 19:54337934-54337956 ACCTGACACCAGTAGCTGCAGGG + Exonic
1168298807 19:55391413-55391435 CTCTTAGTCCAGTAGCTGCATGG + Intronic
927360442 2:22225994-22226016 ATCTTTCACCATTAGCTACAAGG + Intergenic
932407363 2:71522340-71522362 CCCTTACACCAGTGGCTTCAGGG - Intronic
933235504 2:79859779-79859801 CTCTGACTCCAGCAGCTAAATGG - Intronic
933514333 2:83281380-83281402 CTCTCACATCAGAAGCTTCACGG + Intergenic
934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG + Exonic
935898099 2:107759477-107759499 TTCTAACCCCATGAGCTACAAGG + Intergenic
938693332 2:133812881-133812903 CTCTACCACTAGCATCTACATGG + Intergenic
939403363 2:141724347-141724369 CTCTTTTACCAGCAGCTACATGG - Intronic
943040792 2:182802582-182802604 CTCAAACATCAGCAGCTCCAAGG - Intergenic
946010251 2:216558715-216558737 CTCCACCACCAGCAGCTACAAGG + Intronic
1170019020 20:11815061-11815083 TACTAAAACCAGTAGCTATATGG + Intergenic
953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG + Exonic
963269912 3:143276198-143276220 CTCTAACAGTAGTAACTAGATGG - Intronic
963284630 3:143421850-143421872 GTCTAATACCAGAATCTACAGGG + Intronic
964733190 3:159889441-159889463 CTCTAACAGAAGTGGCCACAGGG + Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
970746838 4:19308498-19308520 CTCTAATACCATTACCTACAAGG + Intergenic
972497913 4:39651177-39651199 CTTTAACACCAGTAAATACCTGG - Intergenic
980497254 4:133602477-133602499 CTCTAATATCAGTATTTACAAGG - Intergenic
980765224 4:137294105-137294127 CTCAGACACCAGTAGTTACTGGG + Intergenic
988138796 5:27209135-27209157 CTCTAACAGCATTAGATAAAAGG - Intergenic
991210168 5:64095232-64095254 CTCAAGCACCAATAGCTACTTGG - Intergenic
995420122 5:111955402-111955424 ATCTAACACCTATAGATACAAGG - Intronic
998214310 5:140225788-140225810 CTCTATCTCCAGTAGATTCACGG - Intronic
999011803 5:148050115-148050137 CACTAAAAAGAGTAGCTACATGG - Intronic
1007219178 6:40265056-40265078 CTCCAACACCAGCACCTTCAGGG + Intergenic
1009628122 6:66162775-66162797 CTCAAAATCCAATAGCTACAGGG - Intergenic
1013186958 6:107767762-107767784 CTCAGCCACCCGTAGCTACAAGG - Intronic
1013227186 6:108128480-108128502 AGCTAACACAAGAAGCTACAGGG + Intronic
1018613921 6:165667785-165667807 TTTTAACACCAGTATCTTCATGG - Intronic
1027532791 7:79355440-79355462 CCATAAAACTAGTAGCTACAAGG - Intronic
1036084010 8:5592808-5592830 CTCTAACACCCGATTCTACAAGG + Intergenic
1036111887 8:5912268-5912290 TTCTAGCAGCAGTAGATACATGG - Intergenic
1039129354 8:34245147-34245169 CTCTCACACCAGTACCTTCCAGG + Intergenic
1040620527 8:49086817-49086839 TTCTAACAGCAATAACTACATGG - Intergenic
1043889221 8:85637984-85638006 CTCTATCACCAGGAACTTCAAGG + Intergenic
1045056179 8:98370165-98370187 CCCTAACACCAGTAGCCCCCGGG + Intergenic
1046209232 8:111045392-111045414 CACTAACACCAGAATCTAAATGG + Intergenic
1049124325 8:140773288-140773310 TTCTAACTCCAGCACCTACATGG - Intronic
1051570029 9:18545354-18545376 CCATAACACCAGGAGCTATATGG + Intronic
1052224416 9:26067883-26067905 CTCTATCTCCACTTGCTACAGGG - Intergenic
1055604493 9:77954278-77954300 CTCTAACACCATTTGGCACATGG - Intronic
1055695736 9:78882319-78882341 CTCTGACCCCAGTAGCTTCCAGG + Intergenic
1056271917 9:84955155-84955177 TTTTAGCACCAGCAGCTACAGGG + Intronic
1056596914 9:88015221-88015243 CACTAACACCAGTAACACCAGGG + Intergenic
1191880801 X:65842261-65842283 CTCTAAAACCAGAAGCTATAAGG + Intergenic
1193524624 X:82573710-82573732 ATTTAACACCAGGAACTACAAGG + Intergenic
1197280916 X:124534904-124534926 CCCTAACAACTGTAGCTACTGGG + Intronic
1199546045 X:149008162-149008184 CTCTGACACCACTGGCTACATGG - Intergenic
1200280856 X:154775754-154775776 CTCTAATGCCAGCAGCTCCATGG - Intronic