ID: 966747863

View in Genome Browser
Species Human (GRCh38)
Location 3:183295578-183295600
Sequence GGGGGTCACCTGAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966747863_966747873 7 Left 966747863 3:183295578-183295600 CCTACCTCCCTCAGGTGACCCCC 0: 1
1: 0
2: 3
3: 32
4: 330
Right 966747873 3:183295608-183295630 ATCACTATGCAAGTCGCTGCAGG 0: 1
1: 0
2: 0
3: 1
4: 53
966747863_966747875 30 Left 966747863 3:183295578-183295600 CCTACCTCCCTCAGGTGACCCCC 0: 1
1: 0
2: 3
3: 32
4: 330
Right 966747875 3:183295631-183295653 TCCTGCCATGCTCCAGAATTGGG 0: 1
1: 0
2: 0
3: 8
4: 157
966747863_966747874 29 Left 966747863 3:183295578-183295600 CCTACCTCCCTCAGGTGACCCCC 0: 1
1: 0
2: 3
3: 32
4: 330
Right 966747874 3:183295630-183295652 GTCCTGCCATGCTCCAGAATTGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966747863 Original CRISPR GGGGGTCACCTGAGGGAGGT AGG (reversed) Intronic
900410702 1:2511261-2511283 GGTGGTCACTGGAGGGAGGTGGG - Intronic
900431445 1:2604968-2604990 GGGGGCCTCCTGGTGGAGGTGGG - Intronic
900605382 1:3521428-3521450 GGGGGTCTCCTGCGGCAGCTCGG - Intronic
901059025 1:6463139-6463161 GGGGGTGGCCTGAGGGATGAGGG + Exonic
901169652 1:7247267-7247289 GCGGGTCACCAGAGGAAGGTGGG + Intronic
901343318 1:8515387-8515409 GTGGCTCACCTGAGGCAGGCAGG + Intronic
902283406 1:15390603-15390625 TGGGGACACCTCAGGGAGGGAGG - Intronic
902370867 1:16006105-16006127 GGGGGTCACCCGAGTCAGATGGG - Exonic
902799098 1:18818419-18818441 GAGGGGGAGCTGAGGGAGGTGGG + Intergenic
903535882 1:24065993-24066015 GTTGGTCACCTGGGGAAGGTGGG + Exonic
903545549 1:24121420-24121442 GGGGGTCACCTGAGGTGCATAGG + Exonic
903868099 1:26412644-26412666 AGGGGTTACTTAAGGGAGGTTGG + Intronic
904044635 1:27602350-27602372 AGGGGCCAGCTGAGGGAGGAAGG - Intronic
904279659 1:29409841-29409863 GGTGGTCACCAGAGGGTGGCCGG + Intergenic
904314996 1:29654175-29654197 AGGGGTCACCAGATGGAGCTGGG + Intergenic
904344343 1:29858096-29858118 TGGGGTCACCTGAGTCAGATTGG + Intergenic
904837809 1:33350066-33350088 GGGGCTCAGCTTAGGGAGGCGGG + Intronic
905271575 1:36790940-36790962 GTGGGGGACCTGTGGGAGGTGGG + Intergenic
905915504 1:41681726-41681748 TGGTGGCACCTGAGGGAGGAGGG + Intronic
906240952 1:44242010-44242032 GGGGGTCAGCTCAGGAAGGAAGG + Intronic
906722116 1:48015831-48015853 GAGAGTCACCGGAGGGAGGCTGG - Intergenic
907290365 1:53409066-53409088 GGGAATCCCCTGAGGGAGCTAGG + Intergenic
907290411 1:53409193-53409215 GGGAATCCCCTGAGGGAGCTAGG + Intergenic
907290439 1:53409277-53409299 GGGAATCCCCTGAGGGAGCTAGG + Intergenic
907309557 1:53531401-53531423 GGGGCTCACCTGCGGGGAGTAGG + Intronic
907523141 1:55038200-55038222 GGGTGTGTTCTGAGGGAGGTGGG - Intergenic
911028160 1:93456976-93456998 GAGGATCACCTGAGCCAGGTAGG - Intronic
912561045 1:110551757-110551779 TGGGGACATCTGAGGCAGGTAGG + Intergenic
912606131 1:110991169-110991191 GGGGGTTAGGTGAGGGAAGTGGG - Intergenic
912799192 1:112710735-112710757 GGGGCTCACCTCAGGGAAGCAGG + Exonic
912977165 1:114341225-114341247 GGGGGTCACCTGAGGGATGGTGG + Intergenic
915557884 1:156670244-156670266 GGGTCCCACCTGGGGGAGGTGGG + Exonic
916568044 1:165998788-165998810 TGGGGTCTCCAGTGGGAGGTTGG + Intergenic
916760747 1:167815163-167815185 GGGGCTCACCTGAAGGTGTTTGG - Intronic
919626228 1:199912874-199912896 GGGGGTCCCAGAAGGGAGGTTGG + Intergenic
919840883 1:201608717-201608739 TGGGGTCAGCTGGGGGAGGAGGG + Intergenic
923073391 1:230587178-230587200 GGGGGTCAGCTGATGTAGATGGG - Intergenic
1064724481 10:18264524-18264546 GTGGGTACCCTGGGGGAGGTGGG - Intronic
1067053752 10:43039748-43039770 GGGGGACACCTGAGGCAGCTGGG - Intergenic
1069824429 10:71246411-71246433 GGAGCCCACCTGAGGGAGGTGGG + Intronic
1070696003 10:78563557-78563579 AGGGGTACCGTGAGGGAGGTGGG - Intergenic
1073217253 10:101843458-101843480 GGGGGTCGCGGGAGGGAGGGTGG - Intronic
1073459744 10:103659833-103659855 GTGGGCCTCCTGGGGGAGGTGGG - Intronic
1073634194 10:105180707-105180729 GGTGGTCAGGTCAGGGAGGTTGG - Intronic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1075263286 10:120980574-120980596 GGTGGGCACCTGAGGGTGGGGGG - Intergenic
1075629478 10:123992310-123992332 GTGGGGCAACTGAGGGAGGCCGG - Intergenic
1075743811 10:124712617-124712639 GGGAGTCACGGGAGAGAGGTGGG - Intronic
1075847511 10:125556583-125556605 GGGGGTAAACTGAGGAAGCTGGG + Intergenic
1076614950 10:131749085-131749107 AGGCGTCAGCTGAGGCAGGTGGG + Intergenic
1077420203 11:2446411-2446433 GGGGCTCACCTGAGGGCTGAAGG + Intronic
1078106892 11:8363459-8363481 AGTGGTTACCTGGGGGAGGTGGG - Intergenic
1079576895 11:22015482-22015504 GGGGTTTACCTGAGGGTGGAAGG - Intergenic
1080424210 11:32141382-32141404 GAGGATCACCTGAGGCAGGGAGG - Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1083444507 11:62698744-62698766 GGCTGTCACATGAGGGAGGGAGG - Intronic
1084792923 11:71486162-71486184 GAGGCTCACCTAAGGGAAGTGGG - Intronic
1086347035 11:85907590-85907612 GGGGGGCAGCTGAGGCAGGGAGG + Intronic
1089298039 11:117481471-117481493 GGGGGACACCAGAGGGAGAGAGG + Intronic
1090061685 11:123469151-123469173 GGAGGTGACGTGAGGGAGCTGGG + Intergenic
1090238881 11:125167565-125167587 GGGGGTTACCGGAGGGAGATGGG + Intronic
1090247545 11:125227194-125227216 TGGAGTCACCTGGGGGAGGGAGG + Intronic
1090247694 11:125228526-125228548 CGGAGTCACCTGGGGGAGGGAGG + Intronic
1090666707 11:128919154-128919176 GGGGGTCAACTAAGCGAGGGAGG + Exonic
1090805095 11:130197781-130197803 GGGAGCCAGCGGAGGGAGGTGGG + Intronic
1091419378 12:322636-322658 GGGACTCACTTGAGTGAGGTTGG - Intronic
1091672433 12:2462051-2462073 GGGGGTGAGCTTAGGGAGGAAGG - Intronic
1091899244 12:4131445-4131467 GAGGGTCACTTGAGACAGGTAGG - Intergenic
1092287202 12:7135582-7135604 TGGGTTGTCCTGAGGGAGGTGGG - Intronic
1092902416 12:13072153-13072175 GGGGGGAACCTGACGGAGGCAGG + Intronic
1094479385 12:30869664-30869686 AGGAGGCACCAGAGGGAGGTTGG - Intergenic
1096665019 12:53158676-53158698 GGGGGCCACCTGTGGAAGGGTGG + Exonic
1096810161 12:54164242-54164264 GGGGGGCACACGAGGGAGATGGG + Intergenic
1098006579 12:66003716-66003738 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1102419513 12:112792674-112792696 GGGGGTCACCTGAGACTGGAAGG + Intronic
1103602640 12:122063897-122063919 AGGGATCAGCTGGGGGAGGTAGG + Intergenic
1103711818 12:122918277-122918299 GGGGGGCACCCAAGGGAGGAAGG - Intergenic
1103908105 12:124337618-124337640 AGGGGGCACATGAGGGAGCTGGG + Intronic
1104841253 12:131827220-131827242 TGGGATCACCTGTAGGAGGTGGG - Intergenic
1104859958 12:131918653-131918675 GAGGGTCTCCTCAGGGAGGTCGG - Exonic
1104897002 12:132169338-132169360 GGGGGAGACCTCAGGGAGGGTGG + Intergenic
1105327667 13:19384617-19384639 GTGGGGCTCCTGGGGGAGGTGGG + Intergenic
1105864234 13:24445061-24445083 GTGGGGCTCCTGGGGGAGGTGGG - Intronic
1106469572 13:30042476-30042498 AGGGATCACCAGAGGGAGGTTGG - Intergenic
1107987176 13:45785641-45785663 GGAGGTGACCTGGAGGAGGTAGG + Intronic
1107989847 13:45810149-45810171 TGGTGTCTCCTGAGGGAGGATGG - Intronic
1108908192 13:55505929-55505951 ACTGGTCACCTGTGGGAGGTTGG + Intergenic
1112429356 13:99336935-99336957 AGGGGTCACAGGAGGGAGGTGGG - Intronic
1112478659 13:99754325-99754347 GAGGGTCACCTGAGTCAGGGAGG + Intronic
1112494172 13:99892918-99892940 GGGGGTCGCCTGGTGGCGGTGGG - Exonic
1113419540 13:110159930-110159952 GGGGGTCACCAGAGGCTGGCAGG + Intronic
1113489422 13:110679641-110679663 GGGCGTGACCGGAGGGAGGGAGG + Intronic
1114183696 14:20384581-20384603 GCAGGTGAGCTGAGGGAGGTAGG - Exonic
1114963046 14:27919239-27919261 GGGAGTCAGCAGAGGGTGGTGGG + Intergenic
1117320088 14:54613306-54613328 GGTGGAGACCAGAGGGAGGTGGG + Intronic
1118357286 14:65025155-65025177 GCATGTCAGCTGAGGGAGGTTGG + Intronic
1118741899 14:68745762-68745784 AGGGGACACCAGAGGCAGGTAGG - Intergenic
1119171268 14:72537952-72537974 GGAGGTCACTTGAGTGAGGAAGG + Intronic
1119647215 14:76356583-76356605 TGGGGTCACGTGAGGTTGGTGGG - Intronic
1121664016 14:95658296-95658318 TGGGGTCTCCTGAGAGAGGTGGG + Intergenic
1121723720 14:96130641-96130663 TGGGGGCACCAGGGGGAGGTCGG + Intergenic
1122056482 14:99101693-99101715 GGGGGGGATATGAGGGAGGTGGG - Intergenic
1123940996 15:25216618-25216640 TGGGGTCACCTCAGGGTGGCAGG + Intergenic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1127260786 15:57324558-57324580 GGGAGGGACCTGAGGGAGGGAGG - Intergenic
1130726858 15:86448053-86448075 GAGGGTCACCTGAGCCAGGGAGG + Intronic
1131514114 15:93066056-93066078 GTGGGGCAACTGAGGGAGGCCGG + Intronic
1132186684 15:99806952-99806974 CGGGGCCAGCTGAGGGAGGAAGG - Intergenic
1132429003 15:101745759-101745781 CGGGGCCAGCTGAGGGAGGAAGG + Intergenic
1132671129 16:1102725-1102747 GGGGGTCTGTGGAGGGAGGTGGG - Intergenic
1132671161 16:1102804-1102826 GGGGGTCTGTGGAGGGAGGTGGG - Intergenic
1132903936 16:2272560-2272582 GGGGGTTTCCTGAGTGAGGTGGG - Intergenic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1134625649 16:15720802-15720824 GGAGGCCAGCAGAGGGAGGTCGG - Intronic
1136343849 16:29663067-29663089 GGGGCTCACCTGAGGGAGGCAGG - Intronic
1136428714 16:30185125-30185147 AGGGGTGTCCTGGGGGAGGTGGG + Intronic
1136672887 16:31873986-31874008 GGGGGTCCCCAGAGGGAGGGAGG + Intronic
1137236560 16:46623215-46623237 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1137462695 16:48679934-48679956 GGAGGACACTTGAGGGAGATTGG - Intergenic
1139577744 16:67852905-67852927 GTGGATCACCTGAGTGAGGTCGG - Intronic
1140410803 16:74739332-74739354 GGGGGTCACTGGAGGGAGCTGGG - Intronic
1141481852 16:84311939-84311961 GCGGATCACCTGAGGTAGGGAGG + Intronic
1142413374 16:89927293-89927315 GAGGATCACCTGGGGGAGGTGGG + Intronic
1143130119 17:4672569-4672591 GTGTGGCACCTGAGGGTGGTGGG + Exonic
1143482280 17:7234572-7234594 GGGGATCACGTGACGGAGGGCGG - Intergenic
1143492082 17:7290418-7290440 GTGGGGCAACTGAGGGAGGCCGG + Exonic
1143545691 17:7593839-7593861 GGGGGTCAGCTCAGGGATTTTGG - Intronic
1143562350 17:7703526-7703548 GGGGGGCATATGAGTGAGGTGGG + Intergenic
1143584368 17:7844042-7844064 GGGGGGGTCCTGAGGGAGGGAGG - Intronic
1144416854 17:15056285-15056307 GCGGATCACCCGAGGGAGGTCGG - Intergenic
1145907685 17:28525148-28525170 GGGGGGCAAGTGGGGGAGGTAGG + Intronic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147214154 17:38889792-38889814 GGAGGTCACCTGAGGGTGACAGG - Intronic
1147315765 17:39619316-39619338 GGTGGGCACCTTAAGGAGGTGGG + Intergenic
1147459544 17:40559469-40559491 GAGTGTCTCCTGAGGGAGGTGGG + Intronic
1148243183 17:46013214-46013236 TGGGGTCACCTGAGGGTGCAAGG - Intronic
1148944606 17:51249168-51249190 GAGGATCACCTGAGGCAGGGAGG + Intronic
1150007364 17:61478146-61478168 GGGGGACCCCTGAGGGAGGGAGG + Intronic
1151547043 17:74799549-74799571 GGGGGTGTCCGGAGGGAGCTTGG - Intronic
1151769463 17:76150522-76150544 GGGAGTCCCTTGAGGGAGGCAGG + Intronic
1152540060 17:80970324-80970346 GGTGGGCACCGGAGGGAGGATGG - Intergenic
1155007496 18:21741506-21741528 GGGGGGCCCGTGAGGGAGTTGGG - Exonic
1155304962 18:24469916-24469938 GGGGCCTACCTGAGGGTGGTGGG - Intronic
1156007675 18:32462931-32462953 GCGGGGCAACTGGGGGAGGTTGG + Intronic
1157324191 18:46657276-46657298 GTGGCTCACCAGAGGGTGGTGGG - Intergenic
1157719622 18:49913888-49913910 GGAGTTCACCTGGGGGTGGTGGG + Intronic
1157872248 18:51241315-51241337 GGGAGTAACCTGCGGGAGGCTGG + Intergenic
1158407502 18:57173187-57173209 AGGGGTCACCTGAGAGAGTGAGG + Intergenic
1160100634 18:75916711-75916733 GTGGGACAGCTGAGGCAGGTGGG - Intergenic
1160232312 18:77057797-77057819 GGGGGACACCTGAGGAAGGCGGG + Intronic
1160802135 19:975023-975045 CGGGGCCACCTGAGGCAGGGAGG - Exonic
1161748230 19:6074852-6074874 GGAGGCCACCAGAGGGAGCTGGG + Intronic
1162575590 19:11497070-11497092 GGGGGAGACCTGAGTGAAGTGGG - Intronic
1163518318 19:17778257-17778279 GGGTGTGGCCGGAGGGAGGTTGG + Intronic
1165247000 19:34503557-34503579 GGGGGTCCCCTTGGGCAGGTGGG - Exonic
1165826537 19:38708970-38708992 GGGGGACACTTTAGGGTGGTTGG + Intronic
1166445996 19:42857404-42857426 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166453377 19:42919556-42919578 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166455863 19:42938865-42938887 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166471796 19:43084344-43084366 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166485413 19:43207292-43207314 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166492564 19:43271212-43271234 TGGGTTCCGCTGAGGGAGGTTGG + Intergenic
1167349493 19:48965596-48965618 GGGACTCACCAGAGAGAGGTAGG - Exonic
1167731721 19:51262986-51263008 GAGGATCACCTGAGGTAGGGAGG - Intronic
926109592 2:10173499-10173521 GGGCCTCTGCTGAGGGAGGTAGG - Intronic
926250509 2:11153221-11153243 GGGGGTCAGCTGGGTGAGGCAGG - Intergenic
929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG + Intronic
929989945 2:46778438-46778460 GGGGGGCAGCAGAGGGAGGTGGG + Intergenic
930313070 2:49766316-49766338 TGGGGTCTTATGAGGGAGGTGGG + Intergenic
935365066 2:102280393-102280415 AGGGGGCACCTGAGGCAGGCAGG + Intergenic
936072766 2:109382421-109382443 GGTGGGCTGCTGAGGGAGGTGGG - Intronic
937012617 2:118575597-118575619 GGGGGGCTCCTGGGTGAGGTAGG + Intergenic
937135006 2:119544652-119544674 GAGGGTGACCTGAGGATGGTGGG + Intronic
937674283 2:124572298-124572320 GGGGTCTACCTGAGGGTGGTGGG + Intronic
937903188 2:127038203-127038225 GGGGGACAGATGAGGGAGGTGGG - Intergenic
938399330 2:130975869-130975891 GGAGGACTGCTGAGGGAGGTGGG + Intronic
944681053 2:202077086-202077108 TGGGGTCACCTGGAGGAGCTGGG - Intronic
944692437 2:202170114-202170136 GGCTGTCACCTGAGGGAGGCTGG - Intronic
947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG + Intergenic
948210722 2:236191282-236191304 GTGGGTCAGCTGATGGAGCTGGG + Intergenic
948676596 2:239600664-239600686 GGGAGGCTCCAGAGGGAGGTTGG + Intergenic
949039826 2:241843080-241843102 GGGAGTCACCTCAGGAAGGAAGG - Intergenic
1168846360 20:947190-947212 GGGGGATACCTGAGGTAGCTGGG + Intergenic
1168846985 20:952021-952043 GGGAGTCACATGGGGGAGATAGG + Intergenic
1169262381 20:4148587-4148609 GTGGGTCCCCTGCGGGAGGGGGG + Intronic
1169310354 20:4533026-4533048 GGGGGCTACCTGAGGGTGGAGGG + Intergenic
1169498108 20:6133912-6133934 AGGGAGCACCTGAAGGAGGTGGG - Intergenic
1172400665 20:34648636-34648658 GGGGGTCACCTGAGTCTGGGAGG - Intronic
1173444088 20:43102530-43102552 GGGGAGCACCAAAGGGAGGTGGG - Intronic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1173613690 20:44389026-44389048 GGGGCGCACCTGAGGGAGTGGGG - Intronic
1174354376 20:49988411-49988433 TGGGGTCCCCTGAGTGGGGTGGG - Exonic
1174421154 20:50399931-50399953 AGGGGTCAGGTGAGAGAGGTGGG - Intergenic
1175417868 20:58813343-58813365 GGGGGCGACATGAGGAAGGTGGG - Intergenic
1175789228 20:61731235-61731257 GAGGGTCTCCTGAGGGATTTTGG + Intronic
1175792832 20:61752896-61752918 GGGGGACACCAGAGGGTGGGAGG + Intronic
1175808317 20:61843897-61843919 GGGGGTTCCCTCAGGGAAGTTGG - Intronic
1175817137 20:61889119-61889141 GGGGCTCACTAGAGGGAGGAGGG - Intronic
1176115380 20:63429789-63429811 GGGGGGCACCAGAGGCTGGTGGG - Intronic
1176127534 20:63482647-63482669 GGGGGTCGGCTGGGGGAGGTGGG - Intergenic
1177375464 21:20264762-20264784 GTGGGTCACCTGAGGTGGGGAGG - Intergenic
1179501198 21:41810057-41810079 GGGGGTCTGCAGAGGGAGGTGGG + Intronic
1179912553 21:44457791-44457813 AGGGTTCACCAGAGGGAGCTTGG + Exonic
1179994425 21:44967436-44967458 GAGGGGCACATGAGGGAGCTCGG - Intronic
1180872059 22:19151743-19151765 GGAGGTCTGCTGAGGGAGGAGGG - Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1182511681 22:30824556-30824578 AGGGGTCAGCTTTGGGAGGTGGG + Intronic
1182709138 22:32309816-32309838 GGGGGTGACCTGCGGGAAGGAGG + Intergenic
1183409291 22:37645512-37645534 TGGGGTCCCCTGGGGCAGGTGGG + Intronic
1183479626 22:38056490-38056512 GTGGGTTCCCTGGGGGAGGTTGG - Intronic
1183828657 22:40406649-40406671 CTGGGCCACCTGAGAGAGGTTGG - Exonic
1184799631 22:46751760-46751782 GGATGTAACCTGAGGGAAGTGGG - Intergenic
1185102343 22:48848085-48848107 GAGGCACACCTGTGGGAGGTGGG + Intronic
1185128803 22:49025913-49025935 GGGGGGTACCTGGGGCAGGTGGG + Intergenic
949188971 3:1228364-1228386 AGAGGTCATCTGGGGGAGGTGGG + Intronic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
950461578 3:13125334-13125356 GGGCCTCACCTGGTGGAGGTGGG - Intergenic
950478223 3:13227561-13227583 GGTTGTCACCTGGGTGAGGTGGG + Intergenic
950529669 3:13545996-13546018 GGCTGTCCCCTGGGGGAGGTGGG + Intergenic
952125115 3:30290953-30290975 GGGGGTCATGGGAGGGAGGGAGG - Intergenic
952388572 3:32860677-32860699 GGGAGTAACCTGAGGAAGGTGGG - Intronic
953727362 3:45411846-45411868 GGGGCCTACCTGAGGGTGGTGGG - Intronic
953980666 3:47411342-47411364 CGGGGTCAGCTGGGGGATGTGGG + Exonic
954840791 3:53509595-53509617 GGGGCTGACCCGAGGGAGGGCGG + Intronic
960122308 3:113959092-113959114 GAGGGTCACGTGAGGGAAGATGG + Intronic
960623927 3:119661915-119661937 GTGGATCACCTGAGTGAGGCTGG + Intronic
961391213 3:126553248-126553270 TGGGGTGACCTGGGGGAGGCAGG + Intronic
961749680 3:129087913-129087935 GGGGGGAAGCAGAGGGAGGTGGG - Exonic
961786479 3:129350091-129350113 GGTTGTCACCTGGGTGAGGTGGG - Intergenic
963337789 3:143997120-143997142 GGGGCTTACCTGAGGGAGAAGGG - Intronic
964000970 3:151771661-151771683 GCGGGTCACCTGAGGTCGGGGGG - Intergenic
964709524 3:159656939-159656961 GGATGTCACTTGAGGGAGGTAGG - Intronic
966747863 3:183295578-183295600 GGGGGTCACCTGAGGGAGGTAGG - Intronic
968075021 3:195811679-195811701 GGGGAGCACTTGGGGGAGGTGGG - Intronic
968278525 3:197458671-197458693 GGGGGTCCCTTGAAGGGGGTTGG + Intergenic
968504364 4:965116-965138 GGGGGTGGCCAGAGGGAGGTCGG - Intronic
968661249 4:1799694-1799716 GGGGGCCTCCTGGGGCAGGTTGG + Intronic
969524936 4:7699578-7699600 GGGGGTCCCCCGAGAGAGATGGG - Intronic
970620361 4:17811233-17811255 GGAGGGCCCCTGAGGGAGGGTGG - Intronic
970873715 4:20845491-20845513 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
971691452 4:29841695-29841717 GGGGCCTACCTGAGGGTGGTGGG + Intergenic
972760965 4:42103538-42103560 GGGAGTTACCTGAGGTATGTGGG - Intergenic
973319915 4:48799556-48799578 GGTGGTCACCTAAGGGAAGATGG + Intergenic
973340544 4:48999080-48999102 GGGGTCCACCAGAGGCAGGTAGG - Intronic
973348361 4:49081645-49081667 GAGTGTGCCCTGAGGGAGGTAGG + Intergenic
974593421 4:63985029-63985051 GAGAGTCAGCTAAGGGAGGTAGG + Intergenic
978558111 4:110002816-110002838 GGGGGCTACCTGAGGGTGGAGGG - Intronic
979287309 4:118940826-118940848 GGGGGTGACAGGAGAGAGGTGGG - Intronic
980409109 4:132391194-132391216 GAGTGTCACCTGAGGCTGGTGGG + Intergenic
981062771 4:140444373-140444395 GGGGCTTACTTGAGGGAGGATGG - Intronic
981125187 4:141097965-141097987 GGGGGGCATCTGAAGGAGATGGG - Intronic
982627372 4:157784979-157785001 GGTGGTAAGGTGAGGGAGGTGGG + Intergenic
982698908 4:158636908-158636930 GGTGGTCACTAGAGGCAGGTGGG - Intronic
983042767 4:162949685-162949707 GGAGGTCACTTGAGATAGGTGGG - Intergenic
985784238 5:1885899-1885921 GGGGGTCCCTAGAGGGAGGAAGG - Intronic
986059893 5:4178164-4178186 AGGGCTCACCTGATGAAGGTTGG + Intergenic
987123316 5:14788263-14788285 GGAGGTTTCCTGAGGGAGGAAGG - Intronic
988688737 5:33550445-33550467 GGTGGGGACCTGAGGTAGGTGGG + Intronic
988977100 5:36526494-36526516 GGGGGTCAACCGAGGGTGCTAGG - Intergenic
989069004 5:37490717-37490739 GGCAGTGACCTGAGGCAGGTGGG + Intronic
989630038 5:43472806-43472828 GGGGGTCAGCAGGGGGAGGTGGG + Intronic
991639122 5:68736249-68736271 GGAGTTGACCTGAGAGAGGTGGG + Intergenic
994718538 5:103352973-103352995 GAGGATCACCTGAGTGAGCTTGG + Intergenic
995512226 5:112921475-112921497 CGGGGCCCCCTGCGGGAGGTAGG - Intronic
996490230 5:124086104-124086126 GGAGGTACCCAGAGGGAGGTAGG + Intergenic
999438300 5:151581443-151581465 GAGGGTTAGCTCAGGGAGGTAGG - Intergenic
1000165631 5:158645796-158645818 GGGGCTTACCTGAGGGTGGAGGG + Intergenic
1001080067 5:168661026-168661048 GGGTGTCATCCGAGGGAGGCAGG - Intergenic
1001673488 5:173493281-173493303 GGGGGTCACTGGAGGTAGGTGGG + Intergenic
1002322944 5:178386572-178386594 GTGTGTCACCAGAGGGGGGTCGG + Intronic
1002327011 5:178416330-178416352 GGGAGCCTCCTGAGGGAGGCAGG - Intronic
1002477876 5:179479280-179479302 GCGGATCACCTGAGGGAGTTTGG - Intergenic
1002534067 5:179866481-179866503 TGGGGGCACCTCAGGCAGGTCGG + Intronic
1002859157 6:1064768-1064790 GGAGGGCAGGTGAGGGAGGTTGG + Intergenic
1003535003 6:6969100-6969122 GAGGGTGCCCTGAGGGAGGGAGG - Intergenic
1003749703 6:9041635-9041657 TGGGGTTTCCTTAGGGAGGTTGG + Intergenic
1004885074 6:20043358-20043380 GGGGCTTACCTGAGGGTGGAGGG - Intergenic
1005987582 6:30884267-30884289 GCGGGTTACCTGGGGGAGGCCGG + Intronic
1006096112 6:31657833-31657855 TGATGTCACCTGAGGGAGGCAGG + Intronic
1009506213 6:64483555-64483577 GGGGGTCACCAGAGAGAAGGAGG - Intronic
1014194958 6:118544745-118544767 AGGGGTCATTTGGGGGAGGTAGG - Intronic
1014544258 6:122714664-122714686 GGGGTTCACTTGAGGGTGGAGGG + Intronic
1017013918 6:150084627-150084649 GGGAGACTCCTGAGGGAGATTGG + Intergenic
1017611641 6:156193049-156193071 GGGGCCTACCTGAGGGAGGAGGG - Intergenic
1017627164 6:156360112-156360134 GGGGGTCCCCTGGCGGTGGTAGG + Intergenic
1018387957 6:163321977-163321999 GGGGGTCAGCTGGGGGAGCCAGG - Intergenic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019835755 7:3381504-3381526 GGGAGTGACCTGAGGGAGACTGG + Intronic
1019925242 7:4187180-4187202 AGGGGGCACCTGAGGGAGTGGGG + Intronic
1020023759 7:4884024-4884046 GGGGGTCCCCGGAGGAAGGGTGG + Intergenic
1021085479 7:16417624-16417646 GGGGATCACTAGAGGGAGGAGGG + Intronic
1022473427 7:30695178-30695200 GGGTGTCAGATGAGGGAAGTGGG + Intronic
1023075185 7:36474686-36474708 GGTCCTCACCTGAGGGAGCTTGG - Intergenic
1023485940 7:40686956-40686978 TGGAGTAACCTGAGGAAGGTGGG - Intronic
1023864513 7:44232440-44232462 GGGGGCCACGTGAGGGAGGTGGG + Intronic
1024548600 7:50542002-50542024 GGGGCTCAGGTGTGGGAGGTTGG + Intronic
1024793361 7:52992732-52992754 GAGAGTGTCCTGAGGGAGGTAGG + Intergenic
1025196233 7:56936449-56936471 AGGATTTACCTGAGGGAGGTAGG + Intergenic
1025236741 7:57239704-57239726 TGGAGTCACCTGAGGGGCGTCGG + Intergenic
1025675714 7:63640483-63640505 AGGATTTACCTGAGGGAGGTAGG - Intergenic
1026103106 7:67398854-67398876 GGGAGTGAGATGAGGGAGGTAGG + Intergenic
1026260477 7:68750888-68750910 GGTGGTCACCAAAGGCAGGTAGG - Intergenic
1026916308 7:74121999-74122021 GGGGGTCCCTTGAGGGAGCGTGG + Exonic
1028273273 7:88819484-88819506 GGGGGTTACCTGAGGCATTTTGG + Intronic
1029419783 7:100466701-100466723 GGGGGTCCCAGGAGGGAGGGTGG + Exonic
1029480262 7:100808000-100808022 AAGGCTCACCTGAGGGAGTTGGG - Intronic
1029674480 7:102058802-102058824 GGGATTTACCCGAGGGAGGTAGG + Intronic
1032197219 7:129796403-129796425 GGGGGTCCCCTGAGGGTGAGAGG + Intergenic
1032322468 7:130897627-130897649 GCGGGTCATCTGAGGGAGGCTGG + Intergenic
1033657049 7:143381477-143381499 GGGGGTCACCAAGGGGAGCTGGG + Intronic
1035062900 7:156082276-156082298 GGGGGCCACCTGGGGCAGGAAGG - Intergenic
1035133239 7:156675238-156675260 AGGGGTGAGCTGAGGGTGGTCGG + Intronic
1035280048 7:157772723-157772745 GGGGGACCCCTGTGGGGGGTGGG + Intronic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1037551922 8:19982807-19982829 GGATGTCACCTGAGGGATGGTGG - Intergenic
1037815905 8:22111752-22111774 GGGAGGCAGCTGAGGGAGGACGG + Intergenic
1037911135 8:22744248-22744270 TGGTAGCACCTGAGGGAGGTGGG + Intronic
1038200659 8:25409918-25409940 GGGCGTCACCTGTGTGATGTGGG + Intronic
1039053317 8:33514356-33514378 GGGGCAGCCCTGAGGGAGGTGGG + Intergenic
1039377030 8:37044972-37044994 GGGTGCCACCCCAGGGAGGTGGG - Intergenic
1039790831 8:40874346-40874368 GGGGCTCACCTGAAGATGGTGGG + Intronic
1040469743 8:47727368-47727390 GGGAGTCACCTGAGGTAGCAAGG - Intronic
1040655628 8:49504657-49504679 GGGGATCACCTGAGCCAGGGAGG - Intergenic
1042279218 8:67037060-67037082 GCGGATCACCTGAGGTCGGTCGG + Intronic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049292842 8:141813350-141813372 GGGGGTCAGATGAGGGTGCTGGG - Intergenic
1049292908 8:141813532-141813554 GGGGGTCAGATGAGGGTGCTGGG - Intergenic
1049292994 8:141813759-141813781 GGGGGTCAGATGAGGGTGCTGGG - Intergenic
1049310747 8:141932526-141932548 GGGGGACTCCTGAGGGTGGGAGG + Intergenic
1050445874 9:5722110-5722132 GTGGATCACCTGAGGTTGGTAGG - Intronic
1051133835 9:13895077-13895099 GGGGGCTACCTGAGGGTGGAGGG + Intergenic
1052301429 9:26956722-26956744 GCGGGTCTCCTGCGGGGGGTCGG - Intronic
1053122104 9:35555274-35555296 GCGGTTCCCCTGAGGGAGCTGGG - Exonic
1053450844 9:38192813-38192835 GGGGGGCATCTGTGGGAGGTGGG + Intergenic
1055567924 9:77587609-77587631 GGTGGTTATCTGGGGGAGGTGGG + Intronic
1055809317 9:80133808-80133830 GCGGATCACCTGAGGTCGGTCGG + Intergenic
1057067800 9:92072010-92072032 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
1058264402 9:102880066-102880088 GGGGGTTACCAGAGGTTGGTAGG + Intergenic
1059080387 9:111242959-111242981 GGGGCTTACCTGAGGAAGGAGGG + Intergenic
1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG + Intronic
1061226763 9:129284925-129284947 GGGGGTGGCCTGAGGGTGGCCGG + Intergenic
1061824524 9:133249446-133249468 GGGTGTCACAGGAGTGAGGTTGG - Intergenic
1061976431 9:134070234-134070256 GGGGGTCACCTTAGGGCAGTGGG - Intergenic
1062203861 9:135324645-135324667 GGTGGGCACAGGAGGGAGGTGGG + Intergenic
1062584261 9:137241850-137241872 CGGGGTCCCCGGAGGGCGGTCGG - Intronic
1062591701 9:137277426-137277448 AGGGATAACCTGGGGGAGGTGGG + Intergenic
1062614714 9:137391121-137391143 TGGGGACACCTGAGGAAGGGCGG - Intronic
1203745069 Un_GL000218v1:36956-36978 AGGGGTCAGCTGTGGGAGGGTGG - Intergenic
1203565039 Un_KI270744v1:82528-82550 AGGGGTCAGCTGTGGGAGGGTGG + Intergenic
1185629844 X:1507966-1507988 GGAGGTCTCCTGAGGGATGGCGG - Intronic
1187316124 X:18196812-18196834 AAGGGTGACCTGAGAGAGGTGGG + Intronic
1187760352 X:22576807-22576829 GAGGGTCACTTGAGGCAGGGAGG + Intergenic
1190214420 X:48470222-48470244 GGGGGCCCCCAGAGGGAGGCAGG + Intronic
1190244415 X:48681764-48681786 TGGGGACACGGGAGGGAGGTTGG + Intronic
1192436866 X:71148472-71148494 GGGGGTCCCCTGGGGGAGTATGG + Intronic
1193428758 X:81373949-81373971 GGGGCCCACTTGAGGGTGGTGGG - Intergenic
1196300747 X:114047611-114047633 GGGAGTCAGCGGAGGGTGGTGGG + Intergenic
1196645848 X:118116812-118116834 GGGGGGCTGCTGAGGGAGGGGGG + Intronic
1197150733 X:123217500-123217522 AGGGGTAACCTGCGGGTGGTAGG - Intronic
1199783310 X:151082624-151082646 GGGCGTCAGGAGAGGGAGGTGGG + Intergenic
1200872713 Y:8121050-8121072 GGTGGACACCTTGGGGAGGTGGG + Intergenic
1202187120 Y:22197299-22197321 GGTGGACACCTTGGGGAGGTGGG + Intergenic
1202204240 Y:22389097-22389119 GGTGGACACCTTGGGGAGGTGGG - Intronic
1202241137 Y:22770920-22770942 GGTGGACACCTTGGGGAGGTTGG - Intergenic
1202394123 Y:24404663-24404685 GGTGGACACCTTGGGGAGGTTGG - Intergenic
1202476662 Y:25265429-25265451 GGTGGACACCTTGGGGAGGTTGG + Intergenic