ID: 966749485

View in Genome Browser
Species Human (GRCh38)
Location 3:183308529-183308551
Sequence GAAAGAGCGCTCGCTGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966749485 Original CRISPR GAAAGAGCGCTCGCTGTGAA GGG Intronic
904228891 1:29050192-29050214 TAAAAAGCTCTGGCTGTGAAAGG - Intronic
907408353 1:54267879-54267901 TAAAGAGAGCTGGCTGTGCAGGG - Intronic
907516147 1:54994663-54994685 CAAAGTGGCCTCGCTGTGAATGG + Intergenic
910221710 1:84894620-84894642 GAAAGAGCTCTCTCTGTCAAGGG + Intergenic
911756884 1:101568684-101568706 GATAGAGCTCTCACTGAGAATGG - Intergenic
916589326 1:166175255-166175277 GAAAAAGAGCTCACTGTGCATGG - Intergenic
920403531 1:205692397-205692419 GAAGGGGAGCTCGGTGTGAAGGG - Intergenic
921328882 1:214015786-214015808 GAAAGAGAGCTCAATGTGACTGG - Intronic
922596869 1:226820724-226820746 GACAAAGGGCTCCCTGTGAATGG + Intergenic
1067497351 10:46773160-46773182 GAAAGAGGGCGCCCTGGGAAAGG + Intergenic
1067597301 10:47567255-47567277 GAAAGAGGGCGCCCTGGGAAAGG - Intergenic
1077216011 11:1395445-1395467 GAAAGGGGGCTCCCTGTGGAGGG - Intronic
1085505272 11:77055204-77055226 GAAACAGCACTTGCTTTGAAGGG + Intergenic
1089554296 11:119307083-119307105 GAAAGAATGCTCTCTGTGACTGG + Exonic
1095446510 12:42287870-42287892 GAAAGAACCATCACTGTGAAGGG + Intronic
1101662279 12:106776157-106776179 GAAAGAGCGCTCGCTGGACTTGG - Intronic
1102576007 12:113856507-113856529 GAAAGAGGGCTTCCAGTGAAGGG + Intronic
1102702448 12:114851268-114851290 GAAAATGCGCTGGCTGAGAAAGG + Intergenic
1102770940 12:115475251-115475273 GAAAGAAAGCGCTCTGTGAAGGG + Intergenic
1103200490 12:119084043-119084065 GTAATAGCGCTTGCTGTGTAGGG - Intronic
1108108922 13:47046447-47046469 GACAGAGCTCTGGCAGTGAATGG - Intergenic
1108273798 13:48788160-48788182 GAAAGAGCACTGGATGTGGAGGG + Intergenic
1110514285 13:76391002-76391024 GAAATAGTGCTCACTGTTAAAGG + Intergenic
1114815491 14:25953180-25953202 GAAAGAAAGCTCTCTGTGGAGGG - Intergenic
1117932980 14:60865910-60865932 GAAAGAGCGTTCCCAGTGAACGG - Intronic
1128313798 15:66647563-66647585 AAAAGAAAGCACGCTGTGAAGGG - Intronic
1129488545 15:75902010-75902032 GAAAGAACGCCCACTTTGAAAGG + Intergenic
1133957363 16:10456401-10456423 CAAAGAGCCCTCCCTGTGACTGG - Intronic
1134202130 16:12208048-12208070 GAAAGAGCATTCCCTGAGAAGGG + Intronic
1134448239 16:14346851-14346873 GGGAGATCCCTCGCTGTGAATGG + Intergenic
1151336062 17:73440470-73440492 GCAAGAGGGCTCGCTTTGAGAGG + Intronic
1164436018 19:28230181-28230203 CAAAGGGCGCTGGCTTTGAAAGG - Intergenic
925526186 2:4804958-4804980 GAAAGAGCGCTTGTGGGGAATGG - Intergenic
925874252 2:8298505-8298527 CAAAGAGCACTCACTGTGGAAGG - Intergenic
925971833 2:9111455-9111477 GAAGGAGAGCTCGCTGGGCACGG + Intergenic
926689278 2:15721905-15721927 GAATGAGCCCTCCCTGTGGAAGG + Intronic
927142590 2:20140285-20140307 GAAAAAGCCCTCTGTGTGAAGGG - Intergenic
936662278 2:114555642-114555664 GAAAGAAGGCTCCCTGTGTATGG - Intronic
940892039 2:159044569-159044591 GAAAGAGACCTGGCTGAGAATGG + Intronic
941133904 2:161689324-161689346 TATAGAGCACTTGCTGTGAACGG - Intronic
1170062116 20:12270014-12270036 GAAAGAGGGCTCTCAGGGAAAGG - Intergenic
1174483690 20:50848380-50848402 GAAAGAGCGCTCCCGGCCAAGGG + Intronic
1184239145 22:43202747-43202769 GAAAGAGGTTTCCCTGTGAATGG + Exonic
950486929 3:13279458-13279480 GAAAGAGCACTCTCTGAGAAAGG + Intergenic
950884082 3:16347659-16347681 GAAGGAGCTTTCTCTGTGAAAGG + Intronic
961726774 3:128935984-128936006 GACAGAGAGCTGGCAGTGAAAGG + Intronic
966749485 3:183308529-183308551 GAAAGAGCGCTCGCTGTGAAGGG + Intronic
967039324 3:185675381-185675403 GAAAGAACCATCACTGTGAAGGG - Exonic
969532483 4:7737472-7737494 GAAACAGGGCTGGCTTTGAAAGG + Intronic
969726630 4:8922039-8922061 GAAAGAGCACTCCAGGTGAAGGG - Intergenic
970251314 4:14119018-14119040 GAAAGGGTGATCGCTGGGAATGG + Intergenic
979708582 4:123750372-123750394 GAAAGAAAGCTCTCTCTGAAGGG - Intergenic
989361855 5:40610668-40610690 GATAGGGCTCTGGCTGTGAATGG - Intergenic
1002787780 6:417536-417558 GAGCGAGTGCTCGCTGAGAAAGG + Intergenic
1007673525 6:43576155-43576177 GACAGCGCGCCCGCTGCGAAGGG - Exonic
1012576583 6:100809016-100809038 GAAAGAGCACTTACTATGAACGG + Intronic
1012809876 6:103943859-103943881 AAAAGAGCACTTGCTTTGAATGG - Intergenic
1025261947 7:57425727-57425749 GACAGAGTGCTCGCTCCGAAGGG - Intergenic
1034960884 7:155363639-155363661 GAAGAAGCGTTCACTGTGAAGGG - Intronic
1038207335 8:25479218-25479240 GAAAGAGTGATGGCTATGAAGGG - Intronic
1045137181 8:99233660-99233682 GAAAGAACCATCACTGTGAAGGG - Intronic
1048136740 8:131753415-131753437 GAAAGAAATCTCACTGTGAATGG + Intergenic
1053486251 9:38458762-38458784 GGGAGAGAGCTCCCTGTGAATGG + Intergenic
1054979585 9:71189576-71189598 GAAAAAGTGATAGCTGTGAAGGG - Intronic
1055232592 9:74084273-74084295 GAAAGAACCCTTGCAGTGAAAGG - Intergenic
1059442786 9:114319174-114319196 GAAAGATCGCTCTGTCTGAATGG - Intergenic
1191902558 X:66054966-66054988 GAAAGGGCTGTCCCTGTGAAGGG + Intergenic
1199270851 X:145881370-145881392 TAAAGAGCGCCCTCTCTGAAGGG - Intergenic