ID: 966749503

View in Genome Browser
Species Human (GRCh38)
Location 3:183308687-183308709
Sequence TTGGAGACACACACCCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966749503_966749507 5 Left 966749503 3:183308687-183308709 CCTTTAGGGGTGTGTGTCTCCAA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 966749507 3:183308715-183308737 ACGTACAAGTCAATCACCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 97
966749503_966749505 3 Left 966749503 3:183308687-183308709 CCTTTAGGGGTGTGTGTCTCCAA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 966749505 3:183308713-183308735 TAACGTACAAGTCAATCACCTGG 0: 1
1: 0
2: 2
3: 5
4: 111
966749503_966749506 4 Left 966749503 3:183308687-183308709 CCTTTAGGGGTGTGTGTCTCCAA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 966749506 3:183308714-183308736 AACGTACAAGTCAATCACCTGGG 0: 1
1: 0
2: 0
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966749503 Original CRISPR TTGGAGACACACACCCCTAA AGG (reversed) Intronic
902659730 1:17892728-17892750 ATGGAGCCACACACCCTAAATGG + Intergenic
903512514 1:23886866-23886888 TTGGAGACAGACACCCTTTGCGG + Intronic
903838310 1:26220320-26220342 ATGTAGACACACTTCCCTAAAGG + Intergenic
904913522 1:33953205-33953227 TTGGAGACACACATCCCCTTGGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907680148 1:56555369-56555391 TTGCACACACACACCCCAACAGG - Intronic
916470076 1:165114995-165115017 TTGCAGACACACACGCCTGCAGG + Intergenic
916957636 1:169856104-169856126 TTGAAGACATACACCCATTATGG + Intronic
917837511 1:178952959-178952981 TGGGAGACACAGACACCTGAAGG + Intergenic
918694835 1:187532680-187532702 TTGGAGAGACACTTCCCTACAGG - Intergenic
924178201 1:241414180-241414202 TTGAAGACACAGACACCTGAGGG + Intergenic
1074349918 10:112726522-112726544 TAGGAAACACACACACCTGAGGG - Intronic
1075777780 10:124999272-124999294 TGGGAGAGACACTCTCCTAAGGG - Intronic
1076519316 10:131070877-131070899 TTGGAGACATTCACCTGTAAGGG - Intergenic
1077192105 11:1259884-1259906 CTGGAGACCCTCACCCCCAATGG + Intronic
1080807500 11:35667694-35667716 TTGCAGAAACACACACCTGAAGG - Intronic
1083826284 11:65205745-65205767 CTGCAGTCACACACCCCTGATGG + Intronic
1090076614 11:123583971-123583993 TTGGAGACCCAGTCCCCAAATGG - Intronic
1093560206 12:20529553-20529575 TTGGACACAGACACCCCTGGAGG + Intronic
1095103685 12:38207044-38207066 CTGGAGGCACACTCCCCCAAGGG + Intergenic
1096674235 12:53217925-53217947 TTGGAGACACACACACTCACAGG + Intronic
1099305275 12:80946984-80947006 ATACACACACACACCCCTAAAGG - Intronic
1101122130 12:101593266-101593288 TTGAAAACACACACCAATAAAGG + Intronic
1102010304 12:109614364-109614386 TGGGAGACAGAAACCCCAAAGGG + Intergenic
1106490042 13:30212967-30212989 TAGGACACAAAAACCCCTAAGGG + Intronic
1110539927 13:76696548-76696570 CTGGAAACACTCAGCCCTAATGG - Intergenic
1110633079 13:77732588-77732610 TAGCAGACACACAGACCTAAAGG + Intronic
1114048929 14:18903379-18903401 CTGGAGGCACACTCCCCCAAGGG + Intergenic
1114113634 14:19498554-19498576 CTGGAGGCACACTCCCCCAAGGG - Intergenic
1114115334 14:19616303-19616325 CTGGAGGCACACTCCCCCAAGGG - Intergenic
1115112344 14:29839570-29839592 ATGGAGACACAGAGCCCTACTGG - Intronic
1116442871 14:44974753-44974775 TTCCAGACACACACACCGAAAGG - Intronic
1117521454 14:56555457-56555479 TTGGAGACACACACAGCATATGG + Intronic
1120122864 14:80702746-80702768 TTGGAAACACACAAACCTCAGGG - Intronic
1123504987 15:20932972-20932994 CTGGAGGCACACTCCCCCAAGGG + Intergenic
1123562232 15:21506666-21506688 CTGGAGGCACACTCCCCCAAGGG + Intergenic
1123598477 15:21943953-21943975 CTGGAGGCACACTCCCCCAAGGG + Intergenic
1130512265 15:84599900-84599922 ATGGAGAGAGACACCCTTAATGG - Intergenic
1202970577 15_KI270727v1_random:233808-233830 CTGGAGGCACACTCCCCCAAGGG + Intergenic
1132851769 16:2028035-2028057 TGGGAGACAGACACACCTCAGGG - Intronic
1134139559 16:11706315-11706337 TTGGCGCCACTCACCCCTCAGGG + Intronic
1137630194 16:49937900-49937922 TTAGAGACACAGACCCCTGGGGG - Intergenic
1137789088 16:51159559-51159581 CAGGAGACACACACCTTTAAGGG - Intergenic
1141374334 16:83516261-83516283 ATGGAGCCACACTCCCCAAACGG - Intronic
1144750314 17:17644065-17644087 TTGGACACACACACACATAGAGG + Intergenic
1146065005 17:29627729-29627751 TTGGAGACACCCAGGACTAATGG - Exonic
1146241252 17:31229152-31229174 CTGGAGGCACACTCCCCCAAGGG - Exonic
1146410072 17:32575641-32575663 TAGGAGAAACACACCCCAGAGGG - Intronic
1147405934 17:40212230-40212252 TTGGAAAATCACAACCCTAATGG + Intergenic
1150652414 17:67018644-67018666 TTAGAGAGCCACACCCCTCAGGG - Intronic
1152683580 17:81682965-81682987 ATGTAGACACACTTCCCTAAAGG + Intronic
1157280703 18:46344795-46344817 TTGGGGACACACACACCTCTGGG - Intronic
1159529756 18:69640456-69640478 TTGGAAACACAGATTCCTAATGG - Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1163066229 19:14798117-14798139 TTGGACACAGACACACCTAGAGG + Intronic
1163287602 19:16358174-16358196 TTGGAAACACAGACCCGTCAAGG - Intronic
929865087 2:45710809-45710831 CTGCAGACCCTCACCCCTAAAGG + Intronic
932693121 2:73930470-73930492 TTTGAGAAACACACCCCTAAAGG + Intronic
934746654 2:96763840-96763862 CTGGAGAGACAGACCCCTAGTGG + Intronic
937321459 2:120963488-120963510 GTGGAGACACACACCCCAGGTGG - Intronic
938426243 2:131191635-131191657 CTGGAGGCACACTCCCCCAAGGG + Intronic
939177021 2:138760584-138760606 TTGGAGAAACACTAGCCTAAAGG - Intronic
939858688 2:147391939-147391961 TTGGAGACATACACAGCTGAAGG - Intergenic
943089565 2:183357880-183357902 TTGGAGACCCTCACATCTAAAGG - Intergenic
943503853 2:188728479-188728501 ATGGAGAAACACATCCCAAAAGG + Intergenic
945049494 2:205809546-205809568 ATTGGGACACACATCCCTAAAGG + Intergenic
946087206 2:217186065-217186087 TTGCAGACATACATCCCCAAGGG - Intergenic
948244648 2:236469549-236469571 TAGGAGAAACACAGCACTAAAGG - Intronic
1169113639 20:3048634-3048656 GTGGAGAGACCCACTCCTAATGG - Intergenic
1170067802 20:12333350-12333372 TAGGAGAAACACAACCCAAATGG - Intergenic
1172547582 20:35773352-35773374 TTGGAGCCACACTCCCCTTGAGG + Intronic
1176267430 20:64217555-64217577 TTGGACACACACGCCCGTAACGG - Intronic
1180467414 22:15625763-15625785 CTGGAGGCACACTCCCCCAAGGG + Intergenic
1182022420 22:27091869-27091891 TGGGAGACACACACACATAGAGG + Intergenic
1183656676 22:39189702-39189724 TTGGAGGCACACACCTGTGAAGG - Intergenic
949826284 3:8169013-8169035 ATGAAGTCACACACCCCTACTGG - Intergenic
951519128 3:23594864-23594886 TGGGAGTCACACAGCTCTAAAGG - Intergenic
952674167 3:36007171-36007193 TCACACACACACACCCCTAAGGG + Intergenic
955676656 3:61456083-61456105 ATGGATACACACACCACAAACGG - Intergenic
963959141 3:151288450-151288472 TTGGAGATCCACATCACTAATGG + Intronic
966749503 3:183308687-183308709 TTGGAGACACACACCCCTAAAGG - Intronic
967822862 3:193854352-193854374 TTGGAGATACAAGACCCTAATGG - Intergenic
968284357 3:197499345-197499367 TTGGAGAGCCCCTCCCCTAAGGG + Intergenic
968705240 4:2074611-2074633 TGGGAGCCTCACACCCCTAAGGG + Intronic
971758576 4:30734889-30734911 TTGGAGACACCCACCCAGCAGGG - Intronic
973893605 4:55391489-55391511 CTGGGGAGACAGACCCCTAAGGG - Intergenic
974544687 4:63285625-63285647 TTTGAGCCAGACACCGCTAAGGG - Intergenic
978365022 4:107972223-107972245 TTGGAGACAGAAACTCCTAAGGG + Intergenic
979096177 4:116553732-116553754 TTAGAGACACCCATCCCTCAAGG - Intergenic
984308457 4:178025247-178025269 TTGGATACTCACATCCATAAAGG + Intergenic
986159918 5:5218459-5218481 TTGCAGACACCCACTCCTAGAGG - Intronic
986795780 5:11210667-11210689 TTGAAAACACACACCCCAAAAGG + Intronic
987763269 5:22192576-22192598 GTACACACACACACCCCTAATGG - Intronic
991301460 5:65133015-65133037 TGGGAGAGACTCACCCCTCAGGG - Intergenic
991581084 5:68155824-68155846 TTGGAGACACACACACACAGAGG - Intergenic
991897989 5:71425660-71425682 GTACACACACACACCCCTAATGG - Intergenic
992887075 5:81169535-81169557 TTGGACACAGACACACCTAGAGG - Intronic
996611268 5:125382881-125382903 TTGGATACCCACATCCCTAGGGG - Intergenic
998733056 5:145103342-145103364 ATGGAGACACACACTCTTATAGG - Intergenic
1004990467 6:21131355-21131377 ATGGAGACAAACACCCTGAAAGG - Intronic
1006501215 6:34460162-34460184 TTGGAGAGAGGCACCCCTGAAGG + Intergenic
1007958739 6:45939999-45940021 TTCTTGACACACACCTCTAATGG + Intronic
1008357738 6:50574747-50574769 ATTGAGAGACTCACCCCTAATGG + Intergenic
1016851568 6:148624487-148624509 TGGGTAACACAAACCCCTAATGG - Intergenic
1022952573 7:35352498-35352520 TTGGAGACTCAAGACCCTAAGGG - Intergenic
1032661794 7:133992103-133992125 TTGAAGACACACACACAAAATGG - Intronic
1038658652 8:29477318-29477340 TTGGAGACAGACACACATACAGG - Intergenic
1040896135 8:52370285-52370307 TGAGAGACACAAACACCTAATGG + Intronic
1041108348 8:54462770-54462792 TTGGAGACAAATACACATAAAGG + Intergenic
1041895132 8:62915662-62915684 ATATACACACACACCCCTAAGGG + Intronic
1043351196 8:79362700-79362722 TTGGAGACAAAAACCCTCAATGG - Intergenic
1043526705 8:81105156-81105178 TTGGAGTCAGGCACCCCTGACGG + Intronic
1045506433 8:102781989-102782011 TTTGTGGCACACTCCCCTAAAGG + Intergenic
1046614751 8:116463753-116463775 TTGGAGAAAAACACCCGTGATGG + Intergenic
1048887634 8:138921150-138921172 TGGGAGACACACACTCCACAGGG + Intergenic
1053596373 9:39566070-39566092 TTGGAGACAGACACACGTAGAGG - Intergenic
1053854340 9:42322710-42322732 TTGGAGACAGACACACGTAGAGG - Intergenic
1054569883 9:66798948-66798970 TTGGAGACAGACACACGTAGAGG + Intergenic
1056429457 9:86512748-86512770 TTGGACACACACATCACTTAGGG + Intergenic
1062153209 9:135032091-135032113 TTGGATACAAACACCCTTTAAGG - Intergenic
1195398814 X:104439926-104439948 TTGGAGCCACAAACTCTTAAGGG + Intergenic
1197166100 X:123379319-123379341 TTGGACACACAAAACCCTCATGG - Intronic
1198211349 X:134519247-134519269 TTGGACACAGACACCCATAGAGG - Intronic
1200954529 Y:8930416-8930438 GTGGACACACCCACCCCTCAGGG - Intergenic
1200958364 Y:8973080-8973102 ATGGAGACGCCCACCCCTCAGGG - Intergenic
1202232657 Y:22671811-22671833 GTGGACACACCCACCCCTCAGGG - Intergenic
1202310499 Y:23524347-23524369 GTGGACACACCCACCCCTCAGGG + Intergenic
1202560303 Y:26146247-26146269 GTGGACACACCCACCCCTCAGGG - Intergenic