ID: 966749722

View in Genome Browser
Species Human (GRCh38)
Location 3:183310460-183310482
Sequence TTGCCCAGGCTGGAGTGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701980
Summary {0: 36772, 1: 108043, 2: 179343, 3: 213379, 4: 164443}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966749722_966749731 27 Left 966749722 3:183310460-183310482 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 966749731 3:183310510-183310532 AATTACCGGGTGTGATGGTGGGG 0: 1
1: 0
2: 3
3: 26
4: 181
966749722_966749727 14 Left 966749722 3:183310460-183310482 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 966749727 3:183310497-183310519 AACTCAAAAAAAAAATTACCGGG 0: 1
1: 1
2: 73
3: 2105
4: 17021
966749722_966749726 13 Left 966749722 3:183310460-183310482 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 966749726 3:183310496-183310518 CAACTCAAAAAAAAAATTACCGG 0: 1
1: 0
2: 16
3: 263
4: 3870
966749722_966749729 25 Left 966749722 3:183310460-183310482 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 966749729 3:183310508-183310530 AAAATTACCGGGTGTGATGGTGG 0: 1
1: 7
2: 78
3: 897
4: 10044
966749722_966749728 22 Left 966749722 3:183310460-183310482 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 966749728 3:183310505-183310527 AAAAAAATTACCGGGTGTGATGG 0: 1
1: 7
2: 114
3: 1581
4: 17476
966749722_966749730 26 Left 966749722 3:183310460-183310482 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG 0: 1
1: 3
2: 40
3: 487
4: 4937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966749722 Original CRISPR TTGCCCAGGCTGGAGTGCAA TGG (reversed) Intronic
Too many off-targets to display for this crispr