ID: 966749723

View in Genome Browser
Species Human (GRCh38)
Location 3:183310470-183310492
Sequence TCTCACTCTGTTGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 785866
Summary {0: 21776, 1: 73212, 2: 167026, 3: 221294, 4: 302558}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966749723_966749728 12 Left 966749723 3:183310470-183310492 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 966749728 3:183310505-183310527 AAAAAAATTACCGGGTGTGATGG 0: 1
1: 7
2: 114
3: 1581
4: 17476
966749723_966749730 16 Left 966749723 3:183310470-183310492 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG 0: 1
1: 3
2: 40
3: 487
4: 4937
966749723_966749727 4 Left 966749723 3:183310470-183310492 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 966749727 3:183310497-183310519 AACTCAAAAAAAAAATTACCGGG 0: 1
1: 1
2: 73
3: 2105
4: 17021
966749723_966749731 17 Left 966749723 3:183310470-183310492 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 966749731 3:183310510-183310532 AATTACCGGGTGTGATGGTGGGG 0: 1
1: 0
2: 3
3: 26
4: 181
966749723_966749726 3 Left 966749723 3:183310470-183310492 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 966749726 3:183310496-183310518 CAACTCAAAAAAAAAATTACCGG 0: 1
1: 0
2: 16
3: 263
4: 3870
966749723_966749729 15 Left 966749723 3:183310470-183310492 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 966749729 3:183310508-183310530 AAAATTACCGGGTGTGATGGTGG 0: 1
1: 7
2: 78
3: 897
4: 10044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966749723 Original CRISPR TCTCACTCTGTTGCCCAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr