ID: 966749724

View in Genome Browser
Species Human (GRCh38)
Location 3:183310474-183310496
Sequence GGAGTCTCACTCTGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495393
Summary {0: 7938, 1: 35398, 2: 100561, 3: 153188, 4: 198308}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966749724_966749731 13 Left 966749724 3:183310474-183310496 CCTGGGCAACAGAGTGAGACTCC 0: 7938
1: 35398
2: 100561
3: 153188
4: 198308
Right 966749731 3:183310510-183310532 AATTACCGGGTGTGATGGTGGGG 0: 1
1: 0
2: 3
3: 26
4: 181
966749724_966749727 0 Left 966749724 3:183310474-183310496 CCTGGGCAACAGAGTGAGACTCC 0: 7938
1: 35398
2: 100561
3: 153188
4: 198308
Right 966749727 3:183310497-183310519 AACTCAAAAAAAAAATTACCGGG 0: 1
1: 1
2: 73
3: 2105
4: 17021
966749724_966749729 11 Left 966749724 3:183310474-183310496 CCTGGGCAACAGAGTGAGACTCC 0: 7938
1: 35398
2: 100561
3: 153188
4: 198308
Right 966749729 3:183310508-183310530 AAAATTACCGGGTGTGATGGTGG 0: 1
1: 7
2: 78
3: 897
4: 10044
966749724_966749726 -1 Left 966749724 3:183310474-183310496 CCTGGGCAACAGAGTGAGACTCC 0: 7938
1: 35398
2: 100561
3: 153188
4: 198308
Right 966749726 3:183310496-183310518 CAACTCAAAAAAAAAATTACCGG 0: 1
1: 0
2: 16
3: 263
4: 3870
966749724_966749728 8 Left 966749724 3:183310474-183310496 CCTGGGCAACAGAGTGAGACTCC 0: 7938
1: 35398
2: 100561
3: 153188
4: 198308
Right 966749728 3:183310505-183310527 AAAAAAATTACCGGGTGTGATGG 0: 1
1: 7
2: 114
3: 1581
4: 17476
966749724_966749730 12 Left 966749724 3:183310474-183310496 CCTGGGCAACAGAGTGAGACTCC 0: 7938
1: 35398
2: 100561
3: 153188
4: 198308
Right 966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG 0: 1
1: 3
2: 40
3: 487
4: 4937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966749724 Original CRISPR GGAGTCTCACTCTGTTGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr