ID: 966749725

View in Genome Browser
Species Human (GRCh38)
Location 3:183310495-183310517
Sequence CGGTAATTTTTTTTTTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2709
Summary {0: 1, 1: 0, 2: 18, 3: 246, 4: 2444}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966749725_966749736 21 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749736 3:183310539-183310561 TGTAATTCCAGCTACTTGGGAGG 0: 3066
1: 57543
2: 153617
3: 261201
4: 537211
966749725_966749734 18 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749734 3:183310536-183310558 GCCTGTAATTCCAGCTACTTGGG 0: 2083
1: 44834
2: 172258
3: 271952
4: 451520
966749725_966749737 27 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749737 3:183310545-183310567 TCCAGCTACTTGGGAGGCTGAGG 0: 5379
1: 101964
2: 212023
3: 250600
4: 262115
966749725_966749733 17 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749733 3:183310535-183310557 TGCCTGTAATTCCAGCTACTTGG 0: 2811
1: 58859
2: 107670
3: 161209
4: 236996
966749725_966749729 -10 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749729 3:183310508-183310530 AAAATTACCGGGTGTGATGGTGG 0: 1
1: 7
2: 78
3: 897
4: 10044
966749725_966749730 -9 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG 0: 1
1: 3
2: 40
3: 487
4: 4937
966749725_966749731 -8 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749731 3:183310510-183310532 AATTACCGGGTGTGATGGTGGGG 0: 1
1: 0
2: 3
3: 26
4: 181
966749725_966749739 30 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749739 3:183310548-183310570 AGCTACTTGGGAGGCTGAGGTGG 0: 12605
1: 27761
2: 42780
3: 108181
4: 184073

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966749725 Original CRISPR CGGTAATTTTTTTTTTGAGT TGG (reversed) Intronic
Too many off-targets to display for this crispr